FUNDAMENTAL LABORATORY PROCEDURES

Transcription

1 Bio260 Page 1 TABLE OF CONTENTS Laboratory Safety... 5 Lab Journal... 9 Microscopy Cultiavtion Techniques Smear Preparation and Simple Stain The Gram Stain Pure culture techniques I: The Streak Plate Method Pure culture techniques II: Special Media Cell Counting Culture Characteristics Where Do Microorganisms Occur? The Effectiveness of Hand Hygiene Bacterial Structures Effects of Temperature on Bacterial Growth Modes of Metabolism I Modes of Metabolism II An Overview OF Microbial Metabolism Mutation Transformation Pathogenicity epidemiology The Safety of Water Supplies IMViC Reactions How Clean is Your Kitchen? Control of Microbial Growth Pure Culture Project Gram Stain Practical Unknown project Comgen Overview ComGen Additional protocols Appendix A: Additional Staining Protocols Appendix B: Additional metabolic tests Appendix C: General growth characteristics

2 Bio260 Page 2

3 Bio260 Page 3 FUNDAMENTAL LABORATORY PROCEDURES

4 Bio260 Page 4

5 Bio260 Page 5 Safety LABORATORY SAFETY To sign and turn in The microorganisms that you will use in these laboratory exercises are of little or no risk to healthy students provided that standard microbiological practices are followed. The few organisms that pose even a slight risk are all normal inhabitants of the body. The following rules are to be followed in the laboratory at all times for your safety and the safety of others. Personal Protection: 1. Wear safety goggles or safety glasses for normal laboratory procedures involving liquid cultures that do not generate a splash hazard (e.g., proper pipetting, spread plates, etc.). Use safety goggles and face shields or safety goggles and masks when performing procedures that may create a splash hazard. If work is performed in a biological safety cabinet, goggles and face shields/masks do not need to be worn. 2. Wear closed-toe shoes that cover the top of the foot. 3. Wear gloves when handling microorganisms or hazardous chemicals. 4. Wear laboratory coats. Many stains will dye material and cannot be removed. Avoid wearing long, full, or loose sleeves. Standard Laboratory Practices: 1. Wash hands after entering and before exiting the laboratory. 2. Tie back long hair (shoulder length or longer). 3. Do not wear dangling jewelry. 4. Disinfect bench before and after the laboratory session with a disinfectant known to kill the organisms handled. Use disinfectants according to manufacturer instructions. 5. Do not bring food, gum, drinks (including water), or water bottles into the laboratory. 6. Do not touch the face, apply cosmetics, adjust contact lenses, or bite nails. 7. Bring only your lab materials to the laboratory desk. Other items (coats, purses, etc.) are to be left by the door. Do not handle personal items (cosmetics, cell phones, calculators, pens, pencils, etc.) while in the laboratory. 8. Label all containers clearly. 9. Keep door closed while the laboratory is in session. 10. Laboratory technician or instructor approves all personnel entering the laboratory. 11. Minimize the use of sharps. Use needles and scalpels according to appropriate guidelines and precautions. 12. Use proper transport vessels (test tube racks) for moving cultures in the laboratory and store vessels containing cultures in a leak-proof container when work with them is complete. 13. Use leak-proof containers for storage and transport of infectious materials. 14. Use microincinerators or disposable loops rather than Bunsen burners.

6 Bio260 Page 6 Safety 15. Arrange for proper (safe) decontamination and disposal of contaminated material (e.g., in a properly maintained and validated autoclave) or arrange for licensed waste removal according to local, state, and federal regulations. a. Place all cultures in the correct bins for discarding. As a courtesy to our laboratory technician, please remove all labels from tubes before discarding the cultures. b. Place pipettes in pipette washer. c. Place swabs and any other contaminated materials in special disposal bag. d. Any non-contaminated broken glass should be put into the glass disposal box. e. Sharps go into the red sharps can. 16. Do not handle broken glass with fingers; use a dustpan and broom. 17. Notify instructor of all spills or injuries. 18. Notify instructor of all spills or injuries. Document all injuries according to university or college policy. 19. Keep note-taking and discussion practices separate from work with hazardous or infectious material. 20. Use only institution-provided marking pens and writing instruments. 21. Teach, practice, and enforce the proper wearing and use of gloves. 22. Immune-compromised students (including those who are pregnant or may become pregnant) and students living with or caring for an immune-compromised individual should consult a physician to determine the appropriate level of participation in the laboratory. I have read the above rules and agree to abide by them. I understand that if I am found to be in violation of these rules, I may be deemed a hazard to myself and my lab mates and may be dismissed from the class. Signature and date Printed Name

7 Bio260 Page 7 Safety LABORATORY SAFETY To keep for your records The microorganisms that you will use in these laboratory exercises are of little or no risk to healthy students provided that standard microbiological practices are followed. The few organisms that pose even a slight risk are all normal inhabitants of the body. The following rules are to be followed in the laboratory at all times for your safety and the safety of others. Personal Protection: 1. Wear safety goggles or safety glasses for normal laboratory procedures involving liquid cultures that do not generate a splash hazard (e.g., proper pipetting, spread plates, etc.). Use safety goggles and face shields or safety goggles and masks when performing procedures that may create a splash hazard. If work is performed in a biological safety cabinet, goggles and face shields/masks do not need to be worn. 2. Wear closed-toe shoes that cover the top of the foot. 3. Wear gloves when handling microorganisms or hazardous chemicals. 4. Wear laboratory coats. Many stains will dye material and cannot be removed. Avoid wearing long, full, or loose sleeves. Standard Laboratory Practices: 1. Wash hands after entering and before exiting the laboratory. 2. Tie back long hair (shoulder length or longer). 3. Do not wear dangling jewelry. 4. Disinfect bench before and after the laboratory session with a disinfectant known to kill the organisms handled. Use disinfectants according to manufacturer instructions. 5. Do not bring food, gum, drinks (including water), or water bottles into the laboratory. 6. Do not touch the face, apply cosmetics, adjust contact lenses, or bite nails. 7. Bring only your lab materials to the laboratory desk. Other items (coats, purses, etc.) are to be left by the door. Do not handle personal items (cosmetics, cell phones, calculators, pens, pencils, etc.) while in the laboratory. 8. Label all containers clearly. 9. Keep door closed while the laboratory is in session. 10. Laboratory technician or instructor approves all personnel entering the laboratory. 11. Minimize the use of sharps. Use needles and scalpels according to appropriate guidelines and precautions. 12. Use proper transport vessels (test tube racks) for moving cultures in the laboratory and store vessels containing cultures in a leak-proof container when work with them is complete. 13. Use leak-proof containers for storage and transport of infectious materials. 14. Use microincinerators or disposable loops rather than Bunsen burners.

8 Bio260 Page 8 Safety 15. Arrange for proper (safe) decontamination and disposal of contaminated material (e.g., in a properly maintained and validated autoclave) or arrange for licensed waste removal according to local, state, and federal regulations. a. Place all cultures in the correct bins for discarding. As a courtesy to our laboratory technician, please remove all labels from tubes before discarding the cultures. b. Place pipettes in pipette washer. c. Place swabs and any other contaminated materials in special disposal bag. d. Any non-contaminated broken glass should be put into the glass disposal box. e. Sharps go into the red sharps can. 16. Do not handle broken glass with fingers; use a dustpan and broom. 17. Notify instructor of all spills or injuries. 18. Notify instructor of all spills or injuries. Document all injuries according to university or college policy. 19. Keep note-taking and discussion practices separate from work with hazardous or infectious material. 20. Use only institution-provided marking pens and writing instruments. 21. Teach, practice, and enforce the proper wearing and use of gloves. 22. Immune-compromised students (including those who are pregnant or may become pregnant) and students living with or caring for an immune-compromised individual should consult a physician to determine the appropriate level of participation in the laboratory. I have read the above rules and agree to abide by them. I understand that if I am found to be in violation of these rules, I may be deemed a hazard to myself and my lab mates and may be dismissed from the class. Signature and date Printed Name

9 Bio260 Page 9 Journal LAB JOURNAL "A laboratory notebook is one of a scientist s most valuable tools. It contains the permanent written record of the researcher s mental and physical activities for experiment and observation, to the ultimate understanding of physical phenomena. The act of writing in the notebook causes the scientist to stop and think about what is being done in the laboratory. It is in this way an essential part of doing good science." from Writing the Laboratory Notebook by Howard M. Kanare; American Chemical Society 1985 A laboratory journal is a record of the daily research performed in the lab. While most scientists keep lab journals, the nature of the journal varies slightly depending on the field and personal preferences of the scientist. A good journal is a detailed record of the experiments performed, and includes important information on the materials used and exactly how the experiment was set up. Data for each experiment is collected in the journal and often thoughts about what happened and why are jotted down. Any sources of error are also noted. One of my goals for you in this class is for you to practice good scientific record keeping by recording your laboratory work in a laboratory notebook. Because scientific data are supposed to be reported accurately, some labs have very strict standards for the format of the laboratory journal, e.g., only bound journals (not looseleaf) may be allowed, or journals with carbon pages may be required. These types of journals help discourage the experimenter from disposing of pages of unwanted data or from altering data to make it fit a desired outcome. In order to keep your lab journal neat and organized, you may be tempted to record data on loose pieces of paper, then transfer your data to your notebook. However, this isn t a good lab practice and I strongly discourage you from doing it. It doesn t matter if your lab notebook is messy it s a working document, not a finished product. Normally, scientists report their finished work by writing papers and submitting them to scientific journals, and you ll get to practice this when you write a paper in scientific format for me on your unknown project. To save you time and extra work, however, you ll be allowed to turn in your weekly labs to me directly from your lab notebook and I promise not grade you on neatness. For this lab, I require that you use a bound laboratory journal with carbon pages. You can either buy the less expensive version with the piece of carbon paper you have to move between the pages yourself, or the more expensive version that has the automatic carbon paper. When you turn in labs, please turn in the original copy and keep the carbon copy for yourself. To help you and your instructor keep track of your work, you ll be ask to keep specific information in your lab notebook. First and foremost, you should have a journal entry for every day you work in the laboratory. The simplest of all entries would include the date and a brief note about what you did, for example 10/26/07: Inoculated a gelatin deep agar with

10 Bio260 Page 10 Journal my unknown bacterium and placed it at 25 degrees. For regular lab days when you will spending significant amounts of time and performing multiple tasks, each journal entry should contain the following information: 1. The date 2. Pre-lab notes to yourself about what you will be doing (in order to succeed in this laboratory, you need to be very organized). 3. Any data collected that day. Data, or results, are your observations; in other words, what you saw. This might be a color change in a medium, the appearance of a bacterium as it grows on a plate, etc. In science (and medicine), it s very important to keep track of and report on your observations because other scientists will want to know what you based your decisions on. As a medical example, if you took a patients temperature, you wouldn t just write down had a fever which is your decision or conclusion you d write down the actual temperature (102 degrees F) you recorded. The temperature is the data or observation. 4. The conclusions you drew from the results. Your conclusions are the decisions you make about what you saw; in other words, what you think about the results. In micro lab, you might conclude that a test for a particular enzyme is positive, or you might conclude that a bacterium had a Gram-negative staining reaction. In the medical example above, your conclusion is had a fever. When scientists present their work to others, they give their both their data and conclusions on a subject. They support their conclusions with examples from their data, and discuss the significance of their conclusions (why they re important). To help you practice making observations and writing thoughtful conclusions, I ve written post-lab questions for all the laboratory experiments we ll do as a class. You should always double check to make sure you ve answered all the post-lab questions before you turn a lab into your instructor. 5. Evaluation of results and sources of error, if applicable. If you make a mistake during a lab, such as putting something at the wrong temperature, you should always note the error. Because your laboratory handouts contain the information on materials and procedures, you are not required to enter these into your journal, as long as you did them exactly the same way as the written protocol. Often, however, this will not be the case. You may incubate your culture at a different temperature, or for a different amount of time. In these cases, you should simply make a short note of the changes. For example, you might jot down "incubated at 25C instead of 37C." Many laboratory journals are required to be strictly chronological, that is, everything done on a particular day is entered in the same place in the journal. However, previous students have indicated that they find this confusing and prefer to keep all information relating to a particular lab together. Therefore, you may leave spaces as necessary to keep topics together. Also, some students have found it convenient to skip to the back of their lab journal to keep a separate section for their unknown. However you choose to keep your journal, you should be sure to accurately date all new entries.

11 Bio260 Page 11 Journal Example 1 (very detailed): July 15, 2009 EXAMPLES OF JOURNAL ENTRIES To do: o Inoculate 4 tubes of nitrate broth with P. aeruginosa, B. subtilis, S. aureus, and soil sample. o Incubate at 37 C for at least 48 h. prelab (level of detail is up to you) data/ results (what you saw) conclusions (what you think) Nitrate reduction: Possible outcomes: 1. Look for presence of gas in Durham tube which would indicate that nitrate has been reduced to N 2 by the organism. 2. Test for nitrites by adding 20 drops sulfanilic acid reagent and 20 drops dimethyl- -naphylamine reagent. A + test is indicated by a red, purple or maroon color. 3. If #2 is negative, add a small amount of zinc powder and a few drops of 6 N HCl. A red color is + for nitrate indicating the nitrate has not been reduced by the bacteria. Actual Results: July 20, 1999 (data table would be here, describing observations of colors of all tubes) Conclusions and Evaluation (notice that conclusions are supported by data) The control had nitrite test and a red zinc indicating NO 3 not reduced by bacteria. P. aeruginosa had a nitrite test, no color change on zinc plus gas present indicating NO 3 NO 2 N 2 by bacteria. B. subtilis had nitrite test, red zinc test, indicating no NO 3 reduction by bacteria. S. aureus was + for nitrite (NO3 NO2 by S. aureus itself)

12 Bio260 Page 12 Journal Example 2 (not as detailed): June 24, 2009 Prelab data conclusions To do: cells) Gram stain two species of bacteria. Results: (labeled drawings would be here, describing observations of colors of the Conclusions: B. cereus was Gram+, big rods easy to see. S. aureus was Gram+ cocci. Too many in my prep to see the arrangement well. Evaluation: My smears were a little too dense with bacteria. I need to be more careful about how much inoculum I take from a plate culture. Pre-lab Questions: 1. What is the difference between results and conclusions? Why do scientists have to include both in their reports? 2. Should scientists write down observations on loose scraps of paper? Why or why not?

13 Bio260 Page 13 Journal 3. Assume that you're working in the lab on both a class exercise and also an individual project. What types of information should you include in your journal entry for the day? 4. When you're writing your conclusions, what resource should you be sure to refer to in order to make sure you address all the important concepts for a lab?

14 Bio260 Page 14 Microscopy

15 Bio260 Page 15 Microscopy MICROSCOPY One important technique for a Microbiologist to master is use of a binocular light microscope. Because Cellular Biology is a prerequisite for Microbiology, you should have some experience with the care and use of a light microscope. The small size of bacteria, however, makes them especially challenging subjects to view on a microscope. Your first challenge will be to locate the bacteria on a slide. Once located, it can be easy to lose them, especially when changing objective lenses. Determination of details such as shape and arrangement of bacteria can also be challenging. However, in order to identify bacteria, you must be able to quickly overcome these and other problems. The purpose of this exercise is to help you review the microscope techniques you learned in Cellular Biology, to learn good drawing and labeling technique, and to begin to develop mastery over the special difficulties encountered when observing bacteria. I. Use and Care of the Microscope: A. Care of the microscope 1. Each student will be assigned a microscope. You are responsible for maintenance of your microscope throughout the quarter. If you have a problem with your scope, notify the faculty immediately. 2. Clean the lenses with lens paper only (not a paper towel or Kim wipes). Lens paper is very finely textured and will not scratch the lenses. You should clean your lenses at the end of every laboratory session. Dirty lenses do not allow the light to pass through your microscope properly and will compromise the image. The faculty will spot check your microscopes throughout the quarter. Failure to keep your microscope clean will result in one point being deducted from your lab score for that day. Clean top eyepiece (ocular) lens occasionally as eyelashes leave an oily film. 3. Always remove the slide and clean lenses when finished. 4. Clean stage and condenser if oily. Keep clean. 5. Use two hands when carrying the microscope. With one hand grasp the microscope arm and place the other hand under the base. Do not tilt the microscope when carrying it. 6. Do not force parts. Call your instructor if you should require assistance. 7. Always raise the objective (or lower the stage) while focusing so that the specimen and lens move apart from each other. 8. Store your microscope with the low power objective down and no oil on lenses or stage. B. Using the accompanying diagrams (Figs. 1 & 2), review of the parts of the microscope 1. Ocular lens(es). (Fig. 1) Each ocular contains an ocular lens, which magnifies ten times (10X). The distance between your oculars can be adjusted to your pupil distance. 2. Objective lenses. (Fig. 1)Three lenses are located on the nosepiece. Each lens magnifies by a different power and each lens has a different name. The low power lens magnifies 10 times (10X), the high dry lens magnifies 40 times (40X) and the oil immersion lens magnifies 100 times (100X). The total magnification of the microscope is the product of

16 Bio260 Page 16 Microscopy the magnification of the ocular lens times the magnification of the objective lens being used. 3. Rotating nosepiece. (Fig. 1) Turn it carefully and note that each objective lens clicks into place directly above the opening that lets light through the stage. 4. Mechanical stage. (Fig. 1) Note the spring-loaded lever which acts to hold a slide in place. by turning the Mechanical stage adjustment knobs, your slide can be moved from side to side and front to back. Note that on your microscopes, the fine focus knob is a smaller knob inset into the coarse focus knob Figure 1. A compound microscope.

17 Bio260 Page 17 Microscopy 5. Coarse focus adjustment knob. (Fig. 1) This knob raises and lowers the nosepiece. Never use this knob with the 40X or 100X objective in position. This will prevent you from forcing an objective lens through a slide. 6. Fine focus adjustment knob. (Fig. 1) This knob is used while looking through the eyepiece to refine focus on an object. An experienced microscope always has their hand on this knob while examining slides and will constantly focus up and down in order to see a specimen in three dimensions. 7. Condenser lens. (Fig. 1) The condenser lens focuses light from the light source onto the specimen on the slide. The position of the lens is adjusted with the condenser adjustment knob. C. Adjusting the light. In order to create a good image within the microscope, you need to be able to properly adjust your light. There are several adjustments you can make on your microscopes. 1. Voltage knob (light rheostat). This changes the intensity of light being emitted from your light source. In general, your rheostat should be set at about 50% of its full range. 2. Substage diaphragm. (Fig. 1) The substage diaphragm regulates the amount of light passing through the specimen being viewed. Usually the higher the power, the more open the diaphragm. 3. Light source diaphragm. This is another diaphragm that you can use to regulate the light passing through your specimen. 4. The condenser. (Fig. 1) The condenser must be adjusted properly so that light is focused on the specimen. To properly adjust the condensor, a complicated process of adjustments is required. For lab, you should leave your condensor lens almost all the way up. If you want to learn the process of how to fine-tune this adjustment, ask your instructor to show you individually. Some microscopes have additional filters: 1. Neutral density filter (N.D.). (Fig. 2) This filter reduces the intensity of light passing through your sample. It is most useful when viewing specimens under low power. (You can leave your light adjusted appropriately for high power, then just slide your ND filter in when working at low power.) 2. Blue filter. (Fig. 2) By inserting the blue filter, you change the light quality from yellow light to blue light. This may affect the brightness of the image as well as the resolution (see below). voltage blue filter N.D. diaphragm

18 Bio260 Page 18 Microscopy II. Fig. 2. The knobs on the front of some microscopes. Principles of Microscopy: There are many types of microscopes. However, certain principles underlie them all. A. MAGNIFICATION is the result of one or more (in the case of the compound microscope) lenses. The objective lens (nearest the specimen) magnifies and produces a real image. The eyepiece or ocular lens magnifies the real image producing a virtual image that is seen by the eye. The total magnification is the product or the magnification of the objective and the magnification of the eyepiece. B. RESOLVING POWER is the ability of a microscope to distinguish between two closely adjacent points. The resolution of your eye is about 0.1 mm. Thus, if two objects are separated by less than 0.1mm, you will see only one object, not two. Resolution is a function of the wavelength of light used and the numerical aperture, a characteristic of the lens system used. The diameter of the smallest object visible is the resolving power. Resolving power = wavelength numerical aperature x 2 Table 1. The resolving power of the objective lenses of your microscope. (The wavelength of yellow light is approximately 0.58 m.) Lens Numerical aperture Resolving power 10X m 40X m 100X m C. WORKING DISTANCE is the space between the objective and the specimen when the specimen is in focus. The higher the magnification, the smaller or the shorter this distance (Fig. 3). The shorter the working distance, generally speaking, the greater the amount of light required to see the specimen. Thus, the diaphragm of the condenser should be almost completely open when used with the oil immersion lens. Figure 3. The relationship between objective length and working distance. 4X 10X 40X Objective Length Working Distance

19 Bio260 Page 19 Microscopy Table 2. The working distance for each of the objectives on your microscope. Objective Working Distance 10X 2.0 mm 40X 0.5 mm 100X 0.2 mm CAUTION: Due to the closeness of the 40X and 100X lenses to the slide, you CANNOT focus using the coarse adjustment knob. In addition, care must be taken even with the 10X lens. If a slide is too thick, the 100X objective lens will strike the coverglass. This could damage BOTH the lens and the slide. D. PARCENTER AND FIELD OF VIEW The objective lenses are all PARCENTERED, meaning something located in the center of one objective lens will appear in the center of all other objective lenses. This is a HORIZONTAL centering. Related to this concept of parcentering is FIELD OF VIEW, meaning the portion of a slide that is visible when an objective lens is being used. As magnification increases, field of view decreases (i.e., the image is magnified more, but you can see less of it at one time, see Fig. 4). Thus, you will save yourself a great deal of trouble if you remember to center the object you are viewing before you increase magnification. If you do not, your object may be out of the field of view of the higher powered lens and thus be lost. Fig. 4. The relationship between magnification and field of view. 10X Diameter or field of view 40X 100X

20 Bio260 Page 20 Microscopy Table 3. Field of view for the objective lenses on your microscope. Objective Lens Field of View* 10X 1.7/2.0 mm 40X 0.42/0.5 mm 100X 0.18/0.2 mm *Varies with microscope model E. PARFOCAL AND DEPTH OF FOCUS The objective lenses are PARFOCAL. This means that when an object is in focus in the VERTICAL center of one objective lens, it will be approximately in focus with all other objective lenses. Related to the concept of parfocal is DEPTH OF FOCUS. Depth of focus is the amount of vertical space that can be in focus at one time with a particular objective lens. As magnification increases, depth of focus decreases (Fig. 5). Before increasing magnification, make sure your object is in the best vertical focus by twisting the FINE adjustment knob back and forth until the image is as sharp as you can make it. Increase magnification by moving to the next most powerful objective lens, and REFOCUS again using the fine adjustment knob. Again, if your image is not centered before you increase magnification, you may lose it when you increase magnification. Fig 5. The relationship between depth of focus and magnification. Depth of Focus 10X 40X 100X F. VIEWING BACTERIA ON THE MICROSCOPE The bad news about looking at bacteria on the microscope is that they are small (!) and can be hard to find and interpret. The good news is that most students in this class get much better with microscopes than they ever have been before, and many even come to enjoy looking at bacteria on the microscope. In order to maximize your success, follow the directions below and/or the directions from your instructor. The two features of bacteria that you will most commonly be asked to identify from your microscopes are their shape (morphology) and how they are grouped (arrangement). The three most common shapes of bacteria are spherical (cocci), rod-shaped (bacilli) and curved (spiral) (see Figure 6). Depending on how a particular bacterium undergoes cell division, different arrangements of these shapes may be seen. For example, bacteria that only divide in one plane of division (always separate from each other in the same orientation) and don t completely separate

21 Bio260 Page 21 Microscopy from each other will form long chains. This arrangement is called strepto- (see Figure 6). Bacteria that divide in multiple planes of division (separate from each other in all different directions), will form clusters. This arrangement is called staphylo-. The morphology and arrangement of a particular bacterium can help with its identification, but is not sufficient by itself; other characteristics are also needed. III. Procedure A. Viewing prepared slides 1. Obtain a prepared slide of Bacteria Types: Gram Stained. The slides have three vertical smears of stained bacteria on them. Each vertical smear contains one of the common shapes of bacteria. (You should look at, draw, and label a sample from each vertical smear.) 2. Place the prepared slide on the stage, specimen side up. 3. Center the specimen over the stage light hole as carefully as possible. 4. Open the diaphragm and lower the low power objective until it cannot be lowered further. 5. Slowly raise the objective (or lower the stage depending upon the type of microscope you are using) using the coarse adjustment until the specimen comes into view. 6. Bring the specimen into sharp focus with the fine adjustment. Reducing the diaphragm opening may be necessary. Generally, the diaphragm will be almost closed when using the low power objective. 7. Shift to the high power objective by rotating the nosepiece until the objective clicks into place. Focus using the fine adjustment only. It may be necessary to open the diaphragm about halfway. 8. After bringing the specimen into focus using the high power objective, you are ready to use the oil immersion objective. Focusing of the oil immersion objective requires more care than that of the other objectives, but the procedure is essentially the same. 9. Rotate the nosepiece slightly so that you can place a small drop of immersion oil on the portion of the slide that will be directly under the objective. Then rotate the nosepiece until the objective clicks into place. The tip of the objective should be immersed in the drop of oil. Using only the fine adjustment, slowly focus until the image appears. More than likely, the diaphragm will need to be opened further to obtain optimum illumination. 10. Draw a few representative cells of each type of bacteria in your lab journal as they appear under oil immersion. Make the drawings reasonably large, drawing a the edge of your field of view for scale (see Figure 6 for an example). 11. Using Figure 7 as a guide, label the various morphologies and arrangements that you see. Be sure to label your drawings and use lines to indicate which labels go with which drawings. 12. When you are done, be sure to clean your microscope with lens cleaner and lens paper. First wipe your lenses with clean, dry lens paper to absorb the oil. Then moisten some lens paper with lens clear and rub the lenses with the wet lens paper. Then, finish by rubbing again with clean, dry lens paper. So, the procedure for cleaning is DRY-WET-DRY. Repeat as many times as necessary to get the lenses

22 Bio260 Page 22 Microscopy clean (there should be no oil on the last dry wipe.) Don t be afraid to rub firmly with the lens paper; once immersion oil gets dried on there it can take a few tries to get it off. The most common source of microscope problems in our lab is dried oil on the 40X lens. RENE S TWO HELPFUL TRICKS FOR LOOKING AT STAINED SPECIMENS: 1. Before you look through the ocular lenses in the eyepiece, look from the side at the surface of your slide. Shine light through your slide and move the slide until the stain color is visible in the light path coming through the slide. 2. Put your lowest power objective lens into place over the smear. Now, use the coarse and fine focusing knobs to bring that lens as close to the slide as you can without touching it with the lens. You should now be almost there. Look through the ocular lenses in the eyepiece and sharpen the focus of the image. 1000X streptococci Edge of FOV diplococci Figure 6. An example of a properly drawn and labeled specimen.

23 Bio260 Page 23 Microscopy Figure 7. Shapes and arrangements of bacterial cells.

24 Bio260 Page 24 Pre-lab questions: Study Guide 1. What is the total magnification with the following objective lenses in place? 10X 40X 100X 2. Assume a blue filter is placed over the light source so only light of wavelength 0.45 m would pass through. What is the resolution when the following objective lenses are in place? 40X 100X 3. If you were using a microscope with a blue filter and the 100X lens in place, would you be able to see a structure that was 10 m in diameter (hint: resolving power indicates the smallest thing you can see clearly, anything larger is also clearly visible)? 4. Which type of light gives better resolving power, blue light or yellow light? Why? 5. In your own words, what are the steps you would take in order to find a bacterium and then observe it under oil? 6. What are the two special features (single words) of the microscope that allow you to quickly locate a specimen under high power? 7. Why are the lenses of a microscope ALWAYS cleaned with lens paper and NOT with Kim Wipes? 8. What is the difference between morphology and arrangement of bacteria?

25 Bio260 Page 25 Microscopy Post-lab questions: 1. In your lab journal, draw and label the bacterial cells you viewed today. To give an idea of scale, you should draw the cells within a circle that represents your field of view and label your drawing with the total magnification that you used to view the sample (see Figure 6). The label should indicate the morphology and arrangement of each type of bacteria that was seen. Use lines to indicate which labels go with which drawings. Be sure to draw representatives of the three common morphologies (shapes) of bacteria: cocci, bacillia, and spirals. You may see multiple arrangements for each of these shapes, so sketch a few different examples of each to show the diversity.

26 Bio260 Page 26

27 Bio260 Page 27 Cultivation Techniques CULTIVATION TECHNIQUES Microorganisms require suitable nutrients as well as a favorable environment for growth. First, the culture medium must contain those nutrients essential for the growth of a given microorganism. Second, this medium must provide suitable surroundings for growth--the proper ph, osmotic pressure, oxygen, temperature, etc. Many different substances will serve satisfactorily as a culture medium. When the exact concentrations of each nutrient is known, the medium is said to be chemically defined (or synthetic). For routine cultivation in the laboratory, an undefined (complex) medium is known whose exact content is not specifically known. This medium is called Tryptic Soy and it contains a complex mixture of peptones of casein and soybean, NaCl, K 2 HPO 4, glucose and water. Tryptic-soy or any nutritional medium can exist in essentially one of two forms: (1) liquid (broth) or (2) solid (agar). I. Culture Media A. Liquid Media A liquid medium is called a broth and is used to rapidly grow large numbers of bacteria. Liquid medium is always stored in test tubes (Fig. 1). The broth frequently used for routine cultivation is trypic soy broth (TSB). Broths have some disadvantages of which you should be aware. 1. The rapid growth of bacteria results in rapid use of nutrients and rapid pollution of the medium with waste products. Therefore, the rapid growth period will be followed by a rapid period of death. Thus, broths cannot be used for long term storage. 2. Bacteria settle to the bottom of the test tube due to the pull of gravity and the medium becomes anaerobic (lacks oxygen). 3. Broth may interfere with the preparation of slides. However, because cell density in a broth culture is typically less than it is on an agar culture, smears made from broth are generally better for seeing the natural arrangement of bacteria on a slide. B. Solid Media Solid media are made solid by the addition of agar, a polysaccharide that is isolated from red algae (sea weed). Agar is liquid at high temperatures (95 C) and solidifies at moderate temperatures (45 C). Bacteria cannot digest agar or penetrate deeply into its fibrous surface. As a result, bacteria that are grown on solid media only grow at the surface of the medium. Growth is slow because nutrients must diffuse up to the bacteria from the medium. Essentially, the agar acts as a reservoir, supplying nutrients and absorbing waste products, resulting in prolonged growth of bacteria. Thus, agar is preferential for long term storage. The solid medium frequently used for routine cultivation is trypic soy agar (TSA).Solid media may be stored in either petri plates or test tubes.

28 Bio260 Page 28 Cultivation Techniques Growth on solid media has some useful properties: 1. Because growth occurs on the surface of the agar, it is possible to distinguish features of bacterial colonies. A colony is a group of billions of cells of the same species of bacteria. Each colony grows from the division of a single cell (or a few cells). Colonies have visible characteristics such as color, texture, and shape. 2. Surface growth also makes it possible to isolate one species from a mixture of species growing on agar. 3. It is usually easier to prepare slides from surface growth on agar than it is to prepare slides from broth. However, care must be taken or the cell density in the smear will be too great and it will be difficult to see the natural arrangement of the bacteria on the slide. Petri plates Petri plates are composed of two round shallow dishes that fit one inside the other. The media is poured when it is still liquid into the smaller, bottom dish. The larger dish acts as loose cover over the lower dish. As the agar cools, it forms a thin layer of solid media over the bottom of the dish (Fig. 1). Petri plates are always stored inverted (upside down). Sometimes the medium is too warm (above 50 C) when poured and water will condense on the lid. If the plates were stored right side up, the condensation would drip down onto the media. As the water spread across the media, it would drag any microbes growing in the dish around with it, dispersing them in a messy smear over the surface of the plate. If microbes are smeared all over the surface of your plate, it's hard to examine them for their unique growth characteristics. If a dish does have condensation on the lid it can be removed without smearing the colonies on the plate if you use the following procedure: Hold the closed dish upside down over a sink. While one hand holds the bottom portion of the dish, use the other hand to remove the lid and shake it quickly downward once, flicking the water drops into the sink. Return the lid to its original position. Petri dishes have a large surface area for growth. However, only about ml of media are generally poured into a single petri dish, creating a thin layer of solid media over the bottom of the plate. Thus the agar reservoir is shallow and petri dishes are not adequate for long term growth. Also, due to the thinness of the agar, petri plates quickly become dessicated (dried out), especially when incubated at warm temperatures. Petri plate cultures should never be incubated at 37 C for longer than 48 h. When petri plate cultures cannot be observed until after h, incubate and store them at room temperature. Slants and deeps In test tubes, solid media can be stored in slants or in deeps. A slant is prepared by pouring about 4-6 ml of media into a test tube, then positioning the tube at an angle while the media solidifies (Fig. 1). A deep is prepared by pouring about ml of medium into a test tube and allowing the test tube to remain upright while the medium solidifies. Slants have an increased surface area and are used to culture microorganisms in a sustained manner. Deeps have little surface area and are not usually used to grow bacteria. Special media for some biochemical tests are in the form of deeps.

29 Bio260 Page 29 Cultivation Techniques An agar plate Broth tube Agar slant (2 views) Agar deep front view side view Fig. 1. Different forms of culture media indicating relative volumes of media contained in each. C. Media Preparation Since most of your laboratory study will be made with pure cultures (i.e. the culture contains only organisms originating from a single individual), a culture medium must be sterilized and maintained in a sterile condition, free of living forms. At the same time, you must be able to inoculate this sterile medium with a pure culture of microorganisms without outside contamination. (Contamination is when you get microbes you didn't want into your culture!) The procedure for working without introducing unwanted microbes is commonly referred to as aseptic technique. (We use aseptic technique in the microbiology laboratory to keep our cultures pure and our media sterile, but it's also used by surgeons when they perform surgery.) Since any medium immediately after preparation contains microorganisms from its ingredients and from the surfaces of the utensils and glassware, it must be sterilized (i.e. heated to a point where all cells present are destroyed). Otherwise, a mixture of organisms would result. Prior to sterilization, the container is usually plugged with cotton or loosely capped. This prevents the entry of new contaminants but permits free interchange of air or gases. Media containing moisture, whether broth or agar, are most often sterilized by the use of steam under pressure, better known as autoclaving. The temperature of free-flowing steam (and thus boiling water) is 100 C at sea level. Although this temperature is enough to destroy the vegetative forms of microorganisms, it cannot destroy the resting structures (spores) of spore forming bacteria. Applying 15 pounds of pressure per square inch (psi) to free-flowing steam increases the temperature to 121 C. Maintaining the temperature at 121 C for minutes will completely sterilize the media.

30 Bio260 Page 30 Cultivation Techniques II. Asepsis One of the skills you need to master is the ability to transfer microorganisms from a pure culture to sterile media without introducing contamination. Aseptic techniques are those techniques used to prevent contamination. Asepsis is the condition resulting from proper technique, i.e., asepsis refers to having cultures that are free from contaminating organisms. You will practice aseptic technique throughout the quarter and these techniques should become so familiar to you that you will perform them without thinking about it. A. Inoculation To grow a microbial culture in a sterilized medium, cells (the inoculum) are transferred (inoculated) into the medium, using special precautions to maintain the purity of the culture being transferred. Tools Three tools are commonly used to transfer inoculum: needles, loops, and bent glass rods (Fig. 2). 1. Bent glass rods are used only for inoculation of media in petri dishes. The rod will deliver a large amount of inoculum and is used to spread it evenly over the surface of the agar. 2. Loops are used for cultures in petri plates or tubes. A loop may be used to transfer a loopful of a broth culture to sterile media. From cultures on agar, a quarter of the loop is filled with inoculum taken from the edge of the colony. 3. Needles are generally used to deliver small amounts of inoculum to agar deeps. Handle Shaft Turret Needle Loop Figure 2. Inoculating needle and loop.

31 Bio260 Page 31 Cultivation Techniques Streaking and stabbing Inoculation onto solid media can be done by streaking or stabbing. Streaking means to pull the inoculating instrument lightly across the surface of a solid medium. You must practice a light touch so that you do not dig down into the agar. Digging into the agar results in dumping most of your inoculum into one spot, rather than spreading it out over the surface of the media. Stabbing involves a straight up and down motion using an inoculating needle. Sterilization Sterilization, which is the killing of all living material, can be achieved using bunsen burners or microincinerators. Microincinerators are electrical heaters that have a ceramic core. The core can heat up to 800C, which is hot enough to sterilize. To use the microincinerator: 1. Plug it in and turn it on. Let it heat up for about 10 minutes before using. 2. Place your loop into the microincinerator for a few seconds (Fig. 3), until the wire of your loop glows red. Once it glows red, it is sterile. 3. Allow the loop to cool for about 20 seconds before you transfer your inoculum. 4. Remember to re-sterilize your loop after use. Microincinerators are becoming increasing popular in microbiology laboratories because they reduce the formation of aerosols, tiny particles of liquid or solids that become airborne because they're suspended in a gas. The presence of aerosols contaminated with microbes is a significant risk factor for infection and contamination of lab cultures. By using microincinerators instead of bunsen burners, a microbiology lab decreases the risk for students and lowers the chances of crosscontamination between cultures. Also, using a microincinerator reduces the risk of burns. However, microincinerators can create airflow which increases the chance of contamination, so it's best to keep them at the back of your work area. Figure 3. Using a microincinerator.

32 Bio260 Page 32 Cultivation Techniques Bunsen burners provide an open flame from a controlled gas flow. They are effective and relatively inexpensive tools for sterilizing equipment. However, when you place liquids or solids in an open flame, small aerosols may be created and scattered into the environment. Also, bunsen burners increase the risk of burns, especially when using gloves. Gloves can melt if they come into contact with open flame, causing a severe burn. Always use extreme caution if flaming while wearing gloves. For safety, always keep a lit bunsen burner in the same place on your desk. The safest position is adjacent to the gas outlet. Turn off the burner when not in use. A lit burner is the most dangerous piece of equipment in the laboratory. The flame is often invisible, and we get used to the noise. It is easy to forget that it s there. In the inoculation procedure, the needle or loop used to transfer microorganisms should be heated to redness by flaming immediately before and after making a transfer. Hold the wire portion down in the flame to heat first the entire length of the wire and then the lower part of the holder (Fig. 4). Figure 4. Proper methods for flaming. Transferring inoculum Before removing inoculum from a broth stock culture, you must mix to resuspend the population. This is done by holding the test tube in one hand and using the index finger to hold on the cap. Using the index finger of your other hand, flick the bottom of the tube several times to create a swirling motion. Do not flick too violently or the culture will splash upward and contaminate the cap. During a transfer, hold tubes at an angle in your left hand (if you are right-handed) and grasp caps between fingers of the right hand (Fig. 4). (Never lay a cap down.) To reduce the chances that a

33 Bio260 Page 33 Cultivation Techniques contaminant will fall into a culture tube, the air in the tube is warmed before and after you put your inoculating loop into the tube. You can warm the air either by placing the mouth of the tube into a microincinerator for a few seconds or by passing it through a bunsen burner flame for a few seconds. Again, to reduce the risk of contamination, be very careful not to leave culture tubes open any longer than necessary. Figure 5. Flaming an open culture tube prior to inoculation. The tube is held almost horizontally and the cap held in the little finger of the right hand which holds the inoculating loop. B. Incubation Following inoculation, a culture is incubated in an environment providing suitable growth conditions. In this context, growth means the development of a population of cells from one or a few cells. The mass of daughter cells becomes visible with the naked eye either as a cloudiness (turbidity) in liquid broth or as an isolated colony on solid media. The proper temperature is important for growth. All biological reactions are catalyzed by enzymes. Every enzyme has a specific temperature range at which it functions best. Most microorganisms that cause human diseases have enzymes that function optimally at body temperature (37 C). Scientists define incubation as providing cells with the proper temperature for growth. After inoculation, most cultures will be placed in the 37 C incubator. However, recall that cultures in petri dishes should not be left in the 37 C incubator for longer than 48 h because the combination of higher temperature plus thin agar leads to drying out. Cultures that need to be incubated for longer than 48 h may be placed into a plastic sandwich bag, or may be placed in the 25 C incubator or in a cupboard. Also, don't forget to store your petri dishes with their bottoms (agar) up.

34 Bio260 Page 34 Cultivation Techniques C. Discarding Cultures When cultures are no longer useful, they are to be discarded properly. Anything that contains live bacteria must be disposed of in the laboratory biohazard disposal station: 1. All tape must be removed. 2. Caps from tube cultures should be placed into the caps basket. 3. Tubes should be placed in a slanted basket. Because tubes are disposed of in slant basket without caps, care must be taken that they don t spill over. 4. Plates should be placed in an autoclave bin. 5. Any other materials that are contaminated with live waste should be placed in the biohazard waste can.

35 Bio260 Page 35 Cultivation Techniques III. Procedure A. Familiarize yourself with the lab. Working in pairs, locate the following: 37 C incubator for your lab section 25 C incubator for your lab section cupboard for culture storage biohazard discard station staining racks slide holders your inoculating tools (in your equipment drawer) B. Practice making a smear. 1. Each person should obtain a clean test tube with cap. 2. Place a couple of inches of tap water into your test tube. The water will be your practice bacterial "culture." 3. Take out a microscope slide and place it on your bench. 4. Turn on your microincinerator and let it warm up for 10 min. 5. Hold your capped test tube in your left hand. 6. Practice creating a swirling motion to resuspend the culture in the tube. 7. Hold your inoculating loop in your right hand as if it were a single chopstick (see Fig. 5). 8. Heat your loop (see Fig. 3) to redness then allow it to cool. 9. Remove the cap from your test tube by using the little finger and palm of your right hand (see Fig. 4). 10. Put the mouth of your test tube into the microincinerator for a few seconds. 11. Insert your loop into the test tube and collect a loopful of water. 12. Again, heat the mouth of your test tube. 13. Replace the cap on your test tube. 14. Spread your water onto the microscope slide. 15. Re-heat your loop (see Fig. 3). C. Practice inoculating a tube of media with bacteria from another tube 1. Obtain two test tubes with caps (you can use the tube from part B above as one). Place a little tap water in each tube. One test tube is your source of bacteria, the other represents a tube of sterile media. 2. If you haven't already, turn on your microincinerator. 3. In one hand hold the test tube of bacteria. 4. In your other hand, hold your inoculating loop as if it were a single chopstick (see Fig. 5). 5. Flame your loop and let it cool. 6. Using the little finger and palm of the hand that is holding the loop, remove the cap from the test tube. 7. Heat the mouth of the test tube. 8. Insert the cooled loop into the liquid and pick up a loopful of bacteria. 9. Heat the mouth of the test tube again, recap it, and place it back into the rack. 10. Pick up your tube of sterile media.

36 Bio260 Page 36 Cultivation Techniques 11. Again using the little finger and palm of the hand holding the loop, remove the cap from the test tube. 12. Heat the mouth of the test tube. 13. Insert the loopful of bacteria into the sterile media. Gently move your loop back and forth a couple of times, then remove it from the tube. 14. Re-heat the mouth of the test tube, recap it, and place it back into the test tube rack. 15. Re-heat the loop.

37 Bio260 Page 37 Cultivation Techniques Study Guide Pre-lab questions: 1. What is the chemical (not physical) difference between TSA and TSB? 2. What are the advantages and disadvantages of TSA and TSB? TSA Advantages: Disadvantages: TSB 3. Define the following terms: pure culture inoculate incubate contaminate aseptic technique aerosol

38 Bio260 Page 38 Cultivation Techniques 4. Why are media and cultures in petri plates stored upside down? 5. Why is it necessary to heat a loop to redness when it is flamed? Why is it necessary to cool a loop after it has been flamed before placing it into a bacterial culture? 6. Immediately after a needle or loop is flamed, it is sterile. What factors would determine the length of time it will remain sterile? 7. Why are many cultures incubated at 37 C? Under what circumstances might you not incubate a culture at 37.

39 Bio260 Page 39 Simple Stain SMEAR PREPARATION AND SIMPLE STAIN Unstained microbial cells are nearly transparent when observed by light microscopy and thus are difficult to see. Effective use of a microscope requires bacteria to be mounted on a slide and stained. However, in order to stain microorganisms, a smear preparation must first be made. A bacterial smear is a dried preparation of bacterial cells on a glass slide. Making a smear involves spreading an aqueous suspension of cells on a glass slide and allowing it to air dry. In order to be useful, a smear must have the following qualities: 1. The bacteria must be spread evenly over the slide and be concentrated enough to be located, but dispersed enough so that their natural arrangement can be seen. 2. The bacteria must be adequately fixed to the slide so they don t wash off during staining. 3. The bacteria must not be deformed so that their original morphology can be observed. I. Cleaning Microscope Slides Clean, grease-free slides are essential for obtaining good stained preparations. Some brand new slides are sold as pre-cleaned. These can be used without any preparation. If slides aren t precleaned, of if they are re-used, they must be cleaned according to the following procedure: 1. Wet the tip of your index finger and rub it on some abrasive cleanser (e.g., Bon Ami. Comet, Ajax, etc.). 2. Holding the slide by the sides, spread the paste formed over both surfaces of the slide. 3. Wash the slide thoroughly with running water, first rubbing away the cleanser, then just letting water flow over the slide. 4. Apply several drops of 95% ethyl alcohol to the slide and allow it to air dry. 5. Flame the "up" side of the slide for a moment in the Bunsen burner. (Notice you have metal slide holders.) Allow it to cool. 6. Store cleaned slide right side up between sheets of a folded paper towel. NOTE: If you are preparing multiple smears, set up each smear individually. Once a smear is drying, it is fine to set up another smear so that multiple smears can dry at one time. (Obviously, you should label your slides before you set up your smears.) When you begin staining, stain one slide at a time, i.e., complete the entire staining protocol for one slide before beginning another. Timing can be critical and if you attempt to run an assembly line you run the risk of ruining all of your slides. All slides must be labeled. Attach a slide label sticker or small square of tape to the end of the slide on the same surface as the smear. Write in the following information. Name of bacterium Staining technique Your name or initials Date Two detectable problems that result from dirty slides:

40 Bio260 Page 40 Simple Stain 1. If all oil is not removed from the slide, then the bacteria will be arranged in many concentric circles around the oil that remains on the slide. 2. If all cleanser is not removed from the slide, the stain will attach to it and form a colored haze over the slide. II. Smear Preparation from a Solid Culture Smears made from solid cultures are usually better than those made from broth. The most common problem is the use of too much inoculum. Remember to only fill about a quarter of your loop with inoculum from the edge of the culture. III. Smear Preparation from a Broth Culture Smear preparations from broth cultures are more difficult for a couple of reasons. One problem is that chemicals in the nutrient broth interfere with adhesion of the bacteria to the slide. Another problem is that broth cultures may contain a lower concentration of bacteria than those on solid media. After resuspending a broth culture, examine it for turbidity (cloudiness). The more cloudy the culture, the higher the concentration of bacteria. If a culture is not very cloudy, you must take a larger sample when making a smear than you would if the culture was very cloudy. IV. Simple Staining A simple stain is a solution of a single dye that colors the cell uniformly. Their purpose is to highlight the entire microorganism. To illustrate how dyes/stains work, recall the lab exercise in Cell Biology in which you used methylene blue to stain your cheek cells. Most dyes/stains are salts in which one of the ions is colored, i.e., it reflects light of a specific wave length. This ion is called a chromophore and it will specifically bond to a cell or a structure within the cell. E.g., Methylene blue is methylene blue chloride (MBCl) which, when ionized, becomes: MB + (chromophore) + Cl - MB + (methylene blue cation) ataches to negatively charged particles (e.g., DNA - in the nucleus): MB + + DNA - MBDNA (stained) If the color-bearing ion (chromophore) is positively charged, the stain is basic. When used to stain cheek cells, methylene blue acts as a structural stain, i.e., it stains only certain structures within the cell. When methylene blue is used to stain bacteria, the entire bacterial cell stains, so methylene blue acts as a simple basic stain. Four basic dyes used in the laboratory are crystal violet, safranin, carbol fuchsin, and methylene blue.

41 Bio260 Page 41 Simple Stain If the chromophore of a dye is negatively charged, the stain is acidic. An example of an acidic stain is eosin. Procedure A. Smear preparation from a solid culture 1. Using your dropper bottle, place 1-2 drops of tap water on a previously labeled slide. 2. Flame the inoculating loop and cool for a few seconds 3. Touch the growth on the slant with one side of the loop. (Do not scrape or dig into the agar. If you dig into the agar, it will mix with the inoculum. Chunks of agar will cause cells to clump and the chunks will absorb stain.) 4. Very briefly touch the side of the loop with the cells to the drop and move it back and forth once. 5. Spread the cells to an area the size of a dime using the other side of the loop where no cells were present. 6. Resterilize the inoculating loop. 7. Allow the smear to air dry (don t use heat). When dry, the smear may appear faintly cloudy or very little may be seen depending upon the amount of growth in the tube. 8. The smear must be "heat fixed" to be certain that the cells will adhere to the slide and not be washed off during staining procedures. This is accomplished by holding the slide for two seconds (count "one mississippi, two mississippi") in front of the mouth of the microincinerator (using a slide holder so you don't burn your fingers). Do not overheat the slide. You should be able to touch the underside of the slide comfortably to the back of your hand. When the bacteria become too hot during the fixing process, they become distorted. However, if you are too fast in your passes, the bacteria will wash off during the staining process. 9. Once smear is complete, proceed to simple staining protocol below. B. Smear from a broth culture 1. Disperse the bacteria that have settled to the bottom of the culture tube by swirling the tube gently. 2. Flame the inoculating loop and cool for a few seconds. 3. Transfer 2 to 3 loopfulls of culture to a previously labeled slide. Resterilize the loop between loopfuls. 4. Spread the suspension out to approximately the size of a dime. 5. Resterilize the inoculating loop. 6. Allow the smear to air dry. When dry, it should look very faintly white. 7. Heat fix, holding at the mouth of the microincinerator for three seconds. Broth cultures are more difficult to fix to the slide and so more heat must be applied. 8. When smear is complete, proceed to staining protocol below.

42 Bio260 Page 42 Simple Stain C. Simple Stain 1. Flood your smear with methylene blue or crystal violet stain, allow it to remain for 15 seconds, and then rinse gently with water. (Never apply the running water directly onto the smear. Hold the slide at an angle over the sink, allowing the water to make first contact with one end of the slide and wash over the smear.) 2. Dry the smear in the air or by blotting with bibulous paper. Do not rub slide with paper as this can mechanically force cells off the slide. 3. Examine your smear under low, high, and oil immersion objectives. Cover glasses are not used to protect smears commonly produced in the laboratory. If you wish to save your slide, carefully blot off the oil with a Kim wipe folded twice. Although this will remove some of the cells from the smear, if you are careful, these slides can be viewed 3-4 times before they are no longer useful. Obtain a slide box and use tape to label it with your name. 4. Draw representative cells. 5. If a problem exists, repeat from start to finish using the same culture. Change only one step and see what effect this one change makes.

43 Bio260 Page 43 Simple Stain Pre-lab questions: Study Guide 1. What are three qualities of an effective and useful bacterial smear? 2. What would a slide look like if it had been improperly cleaned? 3. What would happen to the smear if you failed to heat fix the slide before staining? 4. Under what conditions might you use the following amount from a broth culture when making a smear? Two loopfulls: Three loopfulls: 5. Define and give an example of a basic simple stain. Be sure your definition is complete! Post-lab questions: 1. Draw and label your smears in your lab journal. Draw a circle that represents your field of view and draw the bacteria to scale. Your label should include morphology, arrangement, and source (solid or broth culture). 2. Evaluate the quality of your smears for cleanliness and density. Are there any modifications you should make in your technique?

44 Bio260 Page 44 Simple Stain

45 Bio260 Page 45 Gram Stain THE GRAM STAIN Simple staining depends upon the fact that microorganisms differ from their surroundings and thus can be stained to contrast with their environment. Microorganisms also differ from one another chemically and physically and, therefore, may react differently to a given staining procedure. This is the basic principle behind differential staining -- a method of distinguishing between types of microorganisms. Most bacteria can be divided into two groups: thin walled and thick walled. The bacterial cell wall is external to the plasma membrane. Thin walls are composed of an outer membrane and a thin inner layer of peptidoglycan. Thick walls are mostly layers of peptidoglycan. The Danish bacteriologist Christian Gram developed a staining technique that can be used to distinguish between these two groups of bacteria. The technique relies upon the ability of lipids to dissolve in an alcohol wash. Bacteria are first stained with a basic simple stain that stains the outer layer of the wall in both types of bacteria. An alcohol wash is then applied. The alcohol wash dissolves the outer phospholipid layer of thin walled bacteria and the primary stain washes away. The alcohol wash does not wash the primary stain away from thick walled bacteria. Because the thin walled bacteria are now colorless and could not be seen, a second stain, or couterstain, is then applied to the bacteria. The counter stain is pale and will not affect the color of the thick walled bacteria, but will make thin walled bacteria visible. This differential stain to distinguish between thin and thick walled bacteria is called the Gram stain. To do a Gram stain, you must apply a series of four chemical reagents to the bacteria: primary dye, mordant, decolorizer, and counterstain. The primary dye, crystal violet, colors all the bacteria purple. The Gram's iodine acts as a mordant, enhancing the ionic bonds between the crystal violet dye and the bacteria. The decolorizing solution of acetone-alcohol dissolves the phospholipid bilayer of thin walled bacteria and thus washes away the purple color from these cells. (Timing of the application of the decolorizer is critical - you should decolorize only until no more dye drips off, then immediately rinse with tap water to stop the decolorizing process.) Safranin is the counter stain, acting to color all bacteria a pink color. This pink color will not be visible on the thick walled bacteria, which have already been colored purple. The possible results of the gram staining process are: Thick walled bacteria will be purple and are said to be gram positive Thin walled bacteria will be pink are said to be gram negative NOTE: Thick walled bacteria in cultures older than 24 h may also be decolorized. The exact reasons for this are not yet known, but the wall properties of bacteria change as the cultures age. In Gram-positive bacteria, the crystal violet doesn't stick as well to the wall in older cultures. As a Gram-positive culture ages, more and more pink cells will appear in a Gram-stained slide. Thus, the gram-staining process is valid only when done on young (less than 24 h old) cultures of bacteria.

46 Bio260 Page 46 Gram Stain As confirmation of the Gram-stain reaction, a 3% KOH test may be done. When thinwalled bacteria are mixed with 3% KOH, their cells lyse, causing cellular contents to be released. The DNA that is released is very viscous and will result in a stringy consistency to the mixture. Thick-walled bacteria resist the lysis and do not become stringy. Researchers who tested the reliability of the KOH test found that 97% of the time it gave the same results as the Gram stain. I. Materials hour cultures of E. coli and S. aureus. You will need both solid and liquid cultures of each species. II. Procedure 1. Prepare smears of two species of bacteria as indicated by your instructor. Follow the protocol for smear preparation given in the Smear Preparation and Simple Stain lab (only the smear preparation part, not the simple stain part). You may put both smears on a single slide or on separate slides. However, be sure to label the smears carefully so that you can distinguish one organism from another. 2. Apply Crystal violet for 1-2 minutes. 3. Wash off the excess stain by holding the slide under a stream of water. Do not tilt the slide until it is under the water. 4. Flood the slide with Gram's iodine and allow it to react for 1 minute or longer. Rinse as instep No.3. Shake the excess water off or blot lightly, but not to dryness. 5. Holding the slide at an angle, carefully add the decolorizing solution (acetonealcohol) one drop at a time. As soon as color stops coming off the slide, after about 8-10 seconds, rinse with water to stop the decolorizing action. 6. Flood the slide with safranin and allow it to react for seconds. 7. Drain the excess stain from the slide and thoroughly wash it. 8. Carefully blot the stained slide using a paper towel. Do not rub. 9. Examine with the oil immersion objective. Make a representative drawing of each organism, noting color, morphology, and arrangement of cells. III. Confirmation of Gram Stain with KOH 1. Place a drop of 3% KOH on a clean glass slide. Use your loop to pick up a fresh colony of the bacterium from a solid culture to be tested and mix it into the 3% KOH for 30 seconds. Lift up some of the mixture with the loop to check for stringiness (if the cells lyse, the DNA will cling to the loop and make sticky tendrils). 2. Record whether or not you saw sticky tendrils. 3. Repeat steps 1 & 2 for the other species of bacteria.

47 Bio260 Page 47 Gram Stain Study Guide Pre-lab questions: 1. What is the role of the Gram's iodine in a Gram Stain? What color would all bacteria become if the iodine in the gram reaction step was omitted? 2. What color would Gram negative bacteria be after the iodine treatment but before the alcohol destaining? 3. What is the role of the alcohol wash in the Gram Stain? What color would all bacteria become if the alcohol step in the gram reaction was omitted? 4. What color would Gram negative bacteria be after the alcohol wash? 5. The cells from a 48-h, pure culture of gram positive bacteria would appear under oil to be what color(s) after Gram-staining was completed? Explain. 6. What are the differences between Gram positive and Gram negative bacteria which account for the different staining reaction?

48 Bio260 Page 48 Gram Stain 7. If you perform a confirmation test with KOH and you observe sticky tendrils, what can you conclude about the wall structure of the bacterium? Why can you conclude this? Post-lab questions: 1. Record drawings of your smears in your lab journal. Draw a circle that represents your field of view and draw the bacteria to scale. Be sure to label the bacteria with the color they appeared after the Gram stain. 2. For each organism that you Gram stained, what was the morphology, arrangement and Gram staining reaction (Gram + or Gram -- ) of the organism? 3. For each KOH test, record whether or not you saw stringy tendrils. Also record your conclusion for Gram reaction based on the KOH test. 4. Do your conclusions from your Gram stains and KOH tests agree or contradict each other? If they contradict, why might this be so?

49 Bio260 Page 49 PCI: Streak Plate Method PURE CULTURE TECHNIQUES I: THE STREAK PLATE METHOD To characterize and identify microorganisms, it is necessary to isolate them in a pure culture in which all of the cells have originated by cell division from a single cell. Bacteria in natural communities occur in extremely large numbers, e.g., billions of cells per milliliter of liquid or per gram of a solid. One method to obtain a pure culture is to dilute a sample from nature until individual bacteria exist in or on agar widely separated from one another. When these individual bacteria grow, they will form isolated colonies that are visible to the naked eye. One common dilution method for obtaining pure cultures is the streak plate method. In some cases, for example when a desired organism is in the minority in a mixed population, the streak plate method may be insufficient to obtain the organism into pure culture. In these cases, special media that either favor the growth of the organism or that repress the growth of undesirable organisms may be used (see Pure Culture Techniques II). STREAK PLATE METHOD Microorganisms as they occur in nature are generally found intimately mixed with other forms. The simplest procedure for separating microorganisms from mixtures in order to secure pure cultures is the streak plate method. The streak plate method isolates microorganisms by diluting them. As an inoculation loop is pulled across the surface of solid agar, microorganisms on the loop are deposited onto the agar. The further you drag a loop across the surface of the agar, the fewer the microorganisms that remain on the loop. Eventually, you will deposit individual microorganisms onto the agar. If you deposit individual cells that are well spaced out onto the agar, these cells may grow into isolated colonies, or colonies that aren't touching any other colony. Because isolated colonies usually grow from a single cell and don't touch any other sources of growth, they are most likely pure. In order to achieve isolation, you need to zig zag your loop across the agar. Figure 1. The T-streak.

50 Bio260 Page 50 Gram Stain There are different patterns of zig-zagging that microbiologists use. One of the simplest is the T-streak (Fig. 1). A slightly more complicated, but widely-used method is the four quadrant streak (Fig. 2). Figure 2. The four quadrant streak (by Dr. Katherine H. Baker, Penn State) Procedure A. Streak Plate Method 1. Obtain 3 TSA plates. 2. Using a sharpie, label the bottom (along the edge) of each petri dish with the following information: student name date type of medium bacterial species or source 3. Turn each dish over, and draw a T on the bottom of the plate, dividing the plate into 1 half and 2 quarters (see Fig 1A). (This marking need not be done after you become familiar with this procedure.) 4. Select 3 different organisms from cultures of mixed organisms set up during the last lab. Pick no more than two apparently different colonies from any one type of source (i.e., air, human body, soil, lab floor etc.)

51 Bio260 Page 51 Gram Stain 5. Using the aseptic technique learned previously, remove a bit of a colony with a sterile inoculating loop. 6. Now lift the lid of the labeled petri dish, and hold it with your left hand over the surface to prevent air contamination. 7. Place the bit of inoculum in the top of the half section, and streak it back and forth across the surface of the solid agar about 10 times down to the dividing line, as shown in Figure 1B. Let the loop ride along the surface with just enough pressure to contact the surface but not enough to dig into it. (It may be a few periods before you can do this consistently.) 8. Give the petri dish a one-quarter turn. Heat the loop, air cool it, and check its temperature by touching it to a sterile: section of the agar: if the agar sizzles or melts, the loop is too hot. 9. Reinoculate the cooled loop by streaking it across the last part of the streak you just made. Continue streaking by spreading into the next quarter of the agar (Fig. 1C). 10. Heat the loop again, cool as before, and streak the last quarter (Fig. 1D). 11. Repeat this procedure with the other two organisms you have selected. 12. Invert the inoculated dishes, and incubate them at 25 C or 37 C, as appropriate, until the next lab period. B Study guide Pre-lab questions: 1. Give one reason for not digging the loop into the surface of the agar when performing a T-streak. 2. What would be the effect of condensation on the lid of your plate dripping onto the surface of your streak? (Remember that the condensation is water from the inside of the plate and has therefore been autoclaved.) 3. How could a streak plate become contaminated?

52 Bio260 Page 52 Gram Stain 4. How would you recognize a contaminant on a streak plate? Post-lab questions: 1. Make a simple labeled diagram of the appearances of your three T-streaks in your lab journal, e.g. using the format illustrated below. Source Isolated Colonies (Y/N)? # Different Types of Colonies 2. What adjustments in your pure culture streaking technique are necessary to achieve good separation?

53 Bio260 Page 53 Cell Counting PURE CULTURE TECHNIQUES II: SPECIAL MEDIA In some cases, for example when a desired organism is in the minority in a mixed population, the streak plate method may be insufficient to obtain the organism into pure culture. In these cases, special media that either favor the growth of the organism or that repress the growth of undesirable organisms may be used. I. Selective and Differential Media Selective media favor the growth of one type of microorganism over other types of microorganism. Selective media are made with chemicals that either repress the growth of one species or group, or that enhance the group of one species or group. For example, dyes might be included that suppress the growth of gram positive bacteria, thus favoring the growth of gram negative bacteria. Sometimes, selective media are also combined with chemicals that undergo color changes when certain species of bacteria grow on them. The color change may occur in the media and/or in the bacterial colony itself. Because the color change allows identification of the presence of these bacteria, these types of media are said to be differential. Three types of selective media are available in the laboratory: PEA (Phenyl-Ethanol Agar) contains phenyl-ethanol which inhibits the growth of gram negative rods. Thus, PEA is selective for gram positive bacteria. EMB (Eosin/Methylene Blue) Agar contains eosin and methylene blue which inhibit Gram positive bacteria. EMB also contains the sugar lactose. If a lactose fermenting organism grows on EMB, the acid production from the fermentation causes the dyes to change color. Large amounts of acid production will cause the colonies to develop a green sheen (Table 1). Smaller amounts of acid production cause the production of a pink color (Table 1). Thus, EMB is selective for gram negative bacteria and differential for lactose fermenters. SS (Salmonella-Shigella) Agar contains bile salts and brilliant green dye which select against gram positive bacteria and many gram negative bacteria. It also contains lactose, neutral red as a ph indicator, and a sulfur source (thiosulfate). Gram negative lactose fermenting bacteria that are able to grow will produce pink colonies, while gram negative non-lactose fermenters such as Salmonella and Shigella will produce colorless colonies (Table 1). In addition, species that can reduce the thiosulfate to H 2 S may develop black centers in their colonies. Thus SS Agar is selective for gram negative bacteria and differential for lactose fermenters and thiosulfate reducers. Mannitol Salt Agar contains 7.5% NaCl which selects against bacteria that aren t salt-tolerant. It also contains 0.5% mannitol, meat extract, and the ph indicator phenol red. Salt-tolerant bacteria that are also mannitol fermenters

54 Bio260 Page 54 Cell Counting will produce acid, causing a color change in the ph indicator. The acid diffuses into the agar, causing it to change color from pink (neutral) to yellow (acid). Thus, mannitol salt agar is both selective for salt-tolerant bacteria and differential for mannitol fermenters. Table 1. Colonial Growth Characteristics of Four Bacterial Types on Differential and Selective Media Medium E. coli Enterobacter aerogenes Salmonella sp. Staphylococcus aureus EMB Metallic sheen, flat colonies SS PEA TSA no growth or pink colonies no growth or restricted growth Mucoid (slimy) colony, dark center, light edge no growth or pink colonies no growth or restricted growth Colony with same color as medium (light purple) colorless colony no growth or restricted growth No growth or restricted growth (pinpoint colonies) no growth or restricted growth Growth of colonies, beige to light yellow Growth of all four organisms will produce colonies similar in appearance. II. Enrichment Media Sometimes, a microbiologist wishes to isolate an organism that is a relatively rare member of a microbial community. A rare organism might be overlooked on a streak plate or hidden by the growth of other members of the community. In order to enhance the growth of a rare organism, enrichment media are used. Enrichment media contain special nutrients necessary to stimulate growth of a particular organism. Usually this growth is at the expense of the remaining organisms, so that the rare organism outcompete the others. Enrichment media are used in healthcare to identify the presence of pathogens. If you have a sore throat, a doctor might swab your throat to check for Streptococcus pyogenes. To encourage the growth of S. pyogenes over your normal microbiota, the swab is used to inoculate a plate of blood agar. Bacteria like S. pyogenes that are capable of lysing the red blood cells and using them as an energy source will have an advantage over other bacteria present on the swab and will grow better. After the throat culture has been incubated, the plate can be examined to determine whether any S. pyogenes is present. You ll swab your own throat and use blood agar in the Pathogenicity lab exercise in order to examine your throat microbiota. Scientists also use enrichment media to isolate bacteria for use in bioremediation, the cleaning up of pollution using living organisms. A sample from nature contains many different kinds of bacteria, but by growing those bacteria on a particular food source, scientists can enrich the sample for useful organisms. For example, growing a mixed culture of bacteria on media that contains only petroleum as a carbon source will enhance the growth of bacteria that are able to metabolize petroleum. This technique has been

55 Bio260 Page 55 Cell Counting used to identify oil-eating bacteria for use in cleaning up oil spills. In this lab exercise, we ll take a mixed culture of bacteria from the soil and use selective and enrichment media to encourage the growth of particular subsets of the population. Although Tryptic Soy Agar is not an enrichment medium, it s high nutrient content favors the growth of many species of soil bacteria. The bacterial population of soils is dominated by species of Pseudomonas, Arthrobacter, Bacillus, and others. We will use TSA as a control to show the relative number of bacterial species in the soil. Because Glucose Peptone Acid Agar contains acid, it is selective against species that can t tolerate acid and thus favors the growth of fungi, which are more capable of tolerating acid conditions than are most bacteria. Fungi are eukaryotic organisms with a filamentous growth form. Their colonies often appear hairy and may show color changes as spores are formed. The dilution plate method we ll use in this lab favors rapidly growing and sporulating molds such as Penicillium and Aspergillus (these are the types of fungi you often find growing on your old bread). Actinomycete Isolation Agar is an enrichment medium because it contains glycerol which favors the growth of actinomycetes, soil bacteria that have a fungal-like filamentous growth habit. The species most likely to be observed are members of the genus Streptomyces. Streptomyces typically appear as dry, circular, opaque, convex colonies.

56 Bio260 Page 56 Cell Counting III. Procedure A. Selective and Differential Media 1. Materials (per group of 4) a. One plate each of EMB, SS, PEA, Mannitol Salt agar and TSA. b. Cultures of the following organisms: E. coli Enterobacter aerogenes Salmonella typhimurium Staphylococcus aureus 2. Divide one plate of each medium into four parts. Label the quadrants with the names of the four organisms you are using. 3. Streak each quadrant with one of the organisms (Fig. 1). 4. Incubate all plates at 37 C. Salmonella E. coli Staphylococcus aureus Enterobacter aerogenes Figure 1. A sample plate inoculated with four different bacteria. B. Selective and Enrichment Media Materials: Per class: 1 g soil ml flasks with 100 ml sterile water Sterile 1 ml pipettes liquid TSA (enough to pour 12 plates) liquid Glucose Peptone Acid Agar (enough to pour 12 plates) liquid Actinomycete agar (enough to pour 12 plates) Per group of 4: Sterile 1 ml pipettes 6 sterile Petri dishes

57 Bio260 Page 57 Cell Counting Procedure: As a class: 1. Weigh out 1 gram of soil on a filter paper. Transfer soil to 500 ml flask with 100 ml sterile water. This gives a 1:100 dilution because you've put 1 g of soil into 100 ml water. Label the flask 1: Fit rubber stopper firmly in place and shake vigorously for 5 minutes. 3. Using a sterile pipette, transfer 1 ml of soil suspenion to the second 500 ml flask with 100 ml water. Return pipette to 1:100 flask. The 2 nd 500ml flask represents a 1:100,000 dilution because you diluted your original 1:100 dilution by another 100ml water. Label the flask as 1:100, Shake the 1:100,000 dilution 25 times. As a group of 4: 1. Label six Petri dishes as 1:100,000 dilutions. Label two of the plates as TSA, two of them as Glucose Peptone Acid, and two of them as Actinomycete. 2. Inoculate your Petri dishes as follows: a. Using the classroom stock 1:100,000 dilution and the pipette in it, place 1.0 ml of the solution in three of your six Petri dishes (3 plates will serve as uninoculated controls and won t get any soil sample). b. Add liquid TSA to your 2 TSA Petri dishes. One TSA plate will have liquid from your dilution; the other is the control and won't have any of the dilution. (Before you pour, the agar should be cooled to the point that you can hold your wrist against the glass without getting burned, but it should still feel quite warm.) Pour agar over your inoculum until it covers the entire bottom surface of the plate. Mix thoroughly by gently rotating the plate. c. Repeat step b for your Glucose Peptone Acid plates and your Actinomycete plates, using the appropriate agar for each.

58 Bio260 Page 58 Cell Counting Study guide Pre-lab questions: 1. EMB is both selective and differential. What does that mean? (In your answer, be sure to define both terms and explain how EMB functions as both types of agar.) 2. Which media used in this lab would be most likely to permit all Gram-negative organisms to grow, and best differentiate between them? Explain your choice. 3. Which medium would inhibit the growth of rapidly growing Gram-negative bacilli in a mixed culture containing Staphylococcus (a gram positive organism) so that you could obtain a pure culture of Staphylococcus? Explain your choice. 4. Explain how mannitol salt functions as both a selective and differential agar. 5. Actinomycete agar is an enrichment medium. Define enrichment medium and explain how actinomycete agar functions as an enrichment medium. 6. Define and give an example of bioremediation. 7. It is generally accepted that dilution plate counts (the kind of plating we re doing with the soil sample) onto a medium like TSA only reveal ~10% of the bacteria that live in the soil. Why might this be so?

59 Bio260 Page 59 Cell Counting 8. If a microorganism is not salt tolerant, would you be able to use mannitol salt agar to determine whether the organism is a mannitol fermenter? Post-lab questions: 1. Create a table in your notebook for your data from the selective media and TSA control plate (see Table 1 for an example). Your data should include the relative amount off growth as compared to that on the TSA control (e.g., same as on TSA, better than on TSA, less than on TSA), as well as a description of the appearance of the growth, including color. 2. Based on your data from the selective media, which organisms appear to be Gram negative? Why? 3. Based on your data from the selective media, which organisms appear to be Gram positive? Why? 4. Based on your data from the selective media, which organisms appear to be lactose fermenters? How could you tell? 5. Based on your data from the selective media, which species were capable of reducing thiosulfate? How could you tell? 6. Based on your data from the selective media, which species appear to be salt-tolerant? How could you tell? 7. Based on your data from the selective media, which species are definitely capable of fermenting mannitol? From your data, can you say for sure which species can t ferment mannitol? Why or why not? 8. Create a table in your notebook for your data from the soil samples. For each sample, include following: the media type (TSA, glucose peptone acid, actinomycete) # of colony types (different kinds of colonies) a brief description of each type, including such features as relative size, color, surface texture, and shape, the # of colonies of each type, and the total number of colonies per plate. (Use your uninoculated controls as comparison to distinguish colonies from particles in the media.) For counting purposes, anything less than 200 colonies is considered countable. If there are more than 200, you can label it TNTC, which means Too Numerous To Count

60 Bio260 Page 60 Cell Counting 9. Compare your three types of plates. Does one sort of growth seem to dominate each type? If so, which type? Is there something that appears rare on one type of plate, but more abundant on another? If so, describe. 10. Did the enrichment technique of the actinomycete agar appear to work? Justify your answer. 11. Did the selective technique of the glucose peptone acid agar appear to work? Justify your answer.

61 Bio260 Page 61 Cell Counting CELL COUNTING There are many situations in which microbiologists or public health officials may want to know the number of bacterial cells in a population. Microbiologists monitor the number of bacteria in our food and water in order to ensure that it is safe for consumption. Water is also monitored determine whether it is safe for swimming or the harvesting of shellfish. A physician might need to monitor the concentration of bacteria in a patient s body fluid while the patient is undergoing antibiotic therapy for an infection. Because bacterial populations may contain thousands to millions of individual cells, most methods of counting them are based on direct or indirect counts of very small samples taken from the population. I. Direct Count Methods Direct Count methods involve actually counting the cells in a population. In a direct microscope count, a very small sample of the population is placed into a special microscope slide that contains a very small counting chamber that has a known volume. The number of bacterial cells visible in the chamber is counted. Because the chamber has a specific volume, the concentration (# cells/volume) of bacteria in the population is now known. (Note that this is the same method by which blood cells are counted in a hemocytometer.) Bacterial cells can also be counted electronically in machines called coulter counters. In this method, a sample from the population is placed in the machine. The sample is passed between two electrodes. Every time a cell passes between the electrodes it causes a disturbance in the electrical field, and the cell is counted. Both direct microscope counts and electronic cell counts have the advantage that the population count is determined immediately. However, they both have the disadvantage in that they do not distinguish between living and dead cells. In the dilution plate method, a sample from the population is inoculated onto an agar plate. The plate is incubated to allow bacterial growth. Because every cell in the population will divide and produce a visible colony, the colonies on the plate may be counted, thus determining the number of cells that were present in the sample taken from the population. Because the number of cells in the population is so numerous, it is usually not practical to take even a small volume from the original population and place it directly on the plate doing so would produce more colonies than could be reasonably counted. In microbiology, a reasonable number of colonies to count is considered to be somewhere between , more than this is designated too numerous to count, or TNTC. In order to achieve this countable number, the serial dilution technique is employed: a series of dilutions of the original population is made, and samples from each dilution are placed onto agar plates. The plate that has the appropriate number of colonies is counted, and the count is multiplied by the dilution factor of the plate in order to determine the number of bacteria in the original population.

62 Bio260 Page 62 Cell Counting For example, assume you wish to know the number of bacteria in the flask below (Fig. 1). If a 1 ml sample was taken from the flask and placed in 9 ml of water in tube A, the contents of tube A would represent a 10-fold dilution of the original sample. If 1 ml was taken from Tube A and placed in 9 ml of H 2 O in Tube B, that is another 10-fold dilution, and represents a total of a 100-fold dilution from the original. If 1 ml from Tube B is placed in 9 ml of H0 in Tube C, that is another 10-fold dilution, now representing a fold dilution of the original. 1 ml from each of tubes A-C are placed onto petri plates and the plates are incubated overnight. Let s say the plates from tube A and B are both too numerous to count, but plate C has 53 colonies on it. Plate C was inoculated from Tube C, which represented a 1000-fold dilution of 1 ml taken from the original population. So, to determine the total number of bacterial in the original population, we must multiply 53 colonies by the dilution factor of 1000, resulting in a count of 53,000 cells/ml in the original population. 1ml 1 ml 1 ml A B C each tube contains 9 ml H ml from each tube is plated 1: : : Figure 1. Using dilution plating to determine the concentration of cells is a liquid sample. There are two basic methods for preparing dilution plates. In the pour plate method, which you will do today, a serial dilution is performed, and samples from each tube are aseptically pipetted into sterile, empty petri dishes. Agar, melted and cooled to 50 C, is then aseptically poured over the inoculum. Colonies will grow throughout the agar and on the surface of the agar. Because of the differences in oxygen availability, colonies that grow within the agar will have a different appearance than those found on the surface of the agar. In the spread-plate technique, a sample is pipetted directly onto the surface of a solidified agar plate. The liquid is then aseptically spread over the medium with a sterilized bent glass rod. In both methods, the plates are incubated for hours and the colonies are then counted. One disadvantage to these techniques is that, because the cells must be given time to grow into visible colonies, the population count is not determined immediately. Also, the accuracy of this method depends on the assumption

63 Bio260 Page 63 Cell Counting that each cell will grow into a single colony. This is not always true bacteria vary in their arrangements, and it is possible that a colony may have arisen from more than one cell. Another potential disadvantage is that these techniques are dependent on accurate dilution technique and thus more subject to human error than direct cell counts. One advantage to dilution plate techniques over direct microscopic or electronic counts, however, is that these techniques do distinguish between living and dead cells. II. Indirect Count Methods Indirect methods do not count cells directly, but rather assess a property of the population, such as mass or turbidity (cloudiness), that is proportional to the number of cells in the population. For example, filamentous organisms such as molds may be dried and their dry weight determined. Because a single individual mold can become very large (e.g., you may have heard of giant mycorrhizal fungi that span acres of land), increase in mass is sometimes considered a more suitable measurement of growth than is increase in cell number. For bacterial populations, increase in cell number is sometimes assessed indirectly by measuring the turbidity, or cloudiness, of the sample. The greater the number of bacterial cells in a solution, the more the light rays entering the solution are refracted (bent) by the cells, giving the solution a cloudy appearance. Turbidity can be measured with an instrument called a spectrophotometer. Spectrophotometers measure the amount of light that passes from a light source to a light collector inside the machine. If a cloudy bacterial sample is placed between the source and the collector, light will be refracted and will not pass into the collector. The machine records the amount of light that passes into the collector, and thus relative turbidity of samples can be determined. This turbidity is proportional to the number of bacterial cells in the population and thus can be used to estimate the number of bacteria in the population. The turbidity can be measured as its absorbance, by the amount of light absorbed by the sample. The units for absorbance are O.D., which stands for optical density. Day One: Materials: Spectrophotometer 2 clean test tubes 2 tubes of TSB 1 tube containing E.coli in TSB 1 ml and 5 ml sterile pipettes Procedure: I. Estimation of cell concentration by turbidity measurement: 1. Turn on the spectrophotometer and set to 600nm. 2. Use a 5 ml pipette to transfer 5 mls of TSB to a clean test tube. 3. Place tube in spectrophotometer and adjust reading to zero. 4. Use a 5 ml pipette to transfer 4.5 mls of TSB to a clean test tube.

64 Bio260 Page 64 Cell Counting 5. Swirl the E.coli culture and transfer 0.5 ml to the tube containing 4.5 mls TSB using a sterile pipette. Swirl to mix evenly. (Note: This is a 1:10 dilution of your E. coli sample that you re doing in order to lower the cell density so the spectrophotometer can take a reading. You ll need to account for this dilution when calculating your estimate of cell density (see formula below). However, you won t use this dilution after that, so base your dilution scheme and your actual plating on your estimate of the concentration of your original tube.) 7. Place the tube in the spectrophotometer and record the optical density. (the optical density should be between.050 and.800, if it is not you must adjust the dilution) 8. Estimate the cell concentration or your original E. coli broth using the following formula: optical density reading x dilution x 10 9 cells/ml reading from the machine If you put 0.5 ml of your original into 4.5 ml of H2O, then you did a 1:10 dilution to get a reading. You need to multiply by 10 here to account for that. (In other words, you got a reading on a sample that was 10x more dilute than your original, so you need to magnify your estimate by a factor of 10 to make it match your actual original sample.) If you didn't dilute your original, don't multiply by cells per ml is the standard for bacterial cells in solution 9. Use the cell concentration estimate from the turbidity that you calculated in step #8 above to devise a dilution scheme (see Figure 2) that will result in a countable number (30-200) of colonies on a plate. See the procedure for Day 2 for a list of materials that will be available to you. *Draw your dilution scheme in your journal. 10. Place your tube of E. coli in the 5 C incubator (refrigerator) until the next lab. If spectrophotomer gave an estimated cell concentration of 5 x cells/ml, you could plan a dilution scheme as follows (see Figure 2). Use a sterile pipette to transfer 1 ml of the E.coli culture into a flask containing 99 mls of sterile water. The dilution in this flask is Estimated concentration in this flask is 5 x 10 8 cells/ml. Mix well to get an even suspension and then use a sterile pipette to transfer 1 ml of the 10-2 dilution into a flask containing 99 mls of sterile water. The dilution in this flask is Estimated concentration in this flask is 5 x 10 6 cells/ml.

65 Bio260 Page 65 Cell Counting Mix well and repeat above to get your 10-6 dilution. Estimated concentration in this flask is 5 x 10 4 cells/ml. Next, transfer 1 ml of the 10-6 dilution into 9 mls of sterile water. You now have a 10-7 dilution. Estimated concentration in this tube is 5 x 10 3 cells/ml. Repeat the last step to get the next two dilutions, 10-7 and The estimated concentrations will be 5 x 10 2 cells/ml and 5 x 10 1 cells/ml, respectively. The last plate has the best target dilution (50 cells is between 30 and 200). Transfer 1.0 ml of your 10-7 and 10-8 dilutions to their corresponding plates. To create a 10-9 dilution that is 10x less than your ideal plate, plate just 0.1 mls (100 ul) of the 10-8 to its plate and spread using a sterile glass spreader. If your prediction from turbidity was accurate, you should see ~50 colonies on the 10 8 plate after incubation.

66 Bio260 Page 66 Cell Counting Figure 2 Example of dilution scheme based on turbidity measurement: 1ml 1ml 1ml E. coli Estimate based on spec: 5 x cells/ml 99ml H 2 O 99ml H 2 O 99ml H 2 O Dilution: 10-2 Dilution: 10-4 Dilution: 10-6 Est: 5x10 8 Est: 5x10 6 Est: 5x10 4 1ml 1 ml 1 ml each tube contains 9 ml H 2 0 Dilution: 10-6 Dilution: 10-7 Est: 5x10 4 Est: 5x ml 0.1 ml Dilution: Est: 5x10 0 Dilution: 10-8 Dilution: 10-9 Est: 5x10 2 Est: 5x10 1

67 Bio260 Page 67 Cell Counting Day Two: Materials: ml flasks containing 99 ml sterile water 3 test tubes containing 9 ml sterile water 1 ml sterile pipettes 3 TSA plates small beaker containing ethanol glass rod spreader Procedure: II. Determination of cell concentration by dilution plating. Because the turbidity measurement is an estimate of cell concentration, you ll try to get a more accurate count by executing the dilution scheme you developed last time. 1. Label 3 plates with successive 10-fold dilutions: one that is your ideal dilution from your scheme, one that is 10X more, and one that is 10X less. 2. Execute your dilution scheme to create the corresponding dilutions for your three plates. 3. For each of your three dilutions, use a fresh sterile pipette to transfer 1 ml (or 0.1 ml, according your plan) of the dilution to the surface of the corresponding plate. 4. Surface sterilize a glass spreader by dipping it into the alcohol then passing it through a flame. After cooling, use the spreader to spread the 1 ml drops over the surface of the plates. (Be sure to sterilize again between each plate). Pre-lab questions: 1. State 3 reasons microbiologists might be interested in counting the number of bacteria in a population. 2. What is the difference between direct counts and indirect counts? Give an example of each and explain how it works.

68 Bio260 Page 68 Cell Counting 3. What is turbidity? How can it be used to enumerate bacteria? 4. State one advantage and disadvantage each for direct microscopic counts and the dilution plate method. 5. A food sample with an unknown number of contaminating bacteria was serially diluted to The 10-6 plate contained 96 colonies. What was the original microbial concentration? Show your work. 6. Your lab partner serially diluted a sample 9 times, by a factor of 1:10 for each dilution. She spread plated 1.0 ml from dilutions 8 and 9. The following day she counted her spread plates: for dilution 8, she estimated 676 colonies; for dilution 9, she counted 71 colonies. Diagram her dilution scheme (include the volumes used and give the dilution for each step) and calculate the starting cell concentration of the sample (show your work).

69 Bio260 Page 69 Cell Counting 7. Using a spectrophotometer, you estimate that a water sample from a local lake contains 8.3x10 4 cells/ml. Draw a dilution scheme resulting in a countable plate. Post-lab questions: 1. If the optical density of a culture of bacteria is 1.0, what is the predicted concentration of the culture? (Hint: What is the standard for bacterial cultures?) 2. What was your culture concentration from the turbidity measurement? Show and explain your calculations. 3. Draw your dilution scheme with adequate detail such that someone could easily repeat your procedure. (include all dilutions and volumes). 4. Create a table to record the number of colonies in each of your dilution plates. 5. Using your optimal plate (closest to the desired range of colonies per plate) was the cell concentration of your culture as determined by dilution plating? Show your calculations. 6. Why do we use only plates with colonies for our calculations? 7. How did your turbidity estimate and dilution plate experiment compare? What are some factors that could cause these numbers to differ?

70 Bio260 Page 70 Cell Counting

71 Biol 260 P a g e 71 Culture characteristics CULTURE CHARACTERISTICS Bacterial cultures show distinctive characteristics when grown on different culture media. These culture characteristics, which are useful in identification of bacteria, include abundance of the growth, size of colonies, surface texture of growth, and color of the growth. Imagine, for example, that you'd discovered a new species of animal. As part of the description you'd include about that animal, you'd certainly include what it looks like. Similarly, in the classical tradition of microbiology, when new species were discovered their appearance in different media was recorded. Culture characteristics may be observed from a single streak on an agar slant, from colonies on a streak isolation plate, from stabs into gelatin deeps, and from broth cultures. The type of characteristics that can be observed on each of these media is different. The terms used to describe these characteristics need not be memorized, but should be recognized and used when examining cultures. I. Characteristics of growth on agar A. Characteristics than can be defined for both single streaks and colonies 1. Surface texture smooth rough mucoid wrinkled shiny, glistening dull or granular slimy or gummy 2. Consistency is determined by touching an inoculating loop/needle to the surface of the growth. butyrous butter-like viscous stringy or rubbery dry brittle or powdery 3. Optical features/opacity opaque translucent opalescent (iridescent) 4. Pigmentation Under certain conditions, surface growth can undergo chromogenesis, i.e., develop color. White is considered the absence of chromogenesis. Most species that will develop color do after 24 h at 37 C.

72 Bio250 Page 72 Culture characteristics B. Additional characteristics that can be defined for single streak on agar slant A single streak on an agar slant is performed by drawing an inoculating needle or loop vertically across the surface of the slant in a straight line from bottom to top (Fig. 1). The various growth patterns that may result from a single streak are as follows (Fig. 1). Filiform uniform growth along the line of inoculation Echinulate growth margins exhibit a toothed appearance Beaded growth shows separate or semi-confluent colonies along the line of inoculation Effuse growth is thin, veil-like and usually spreading Arborescent growth is branched and tree-like Rhizoidal growth has a root-like appearance Inoculation Growth patterns after incubation Figure 1. Single streak characteristics. C. Additional characteristics than can be used to define colonies Colony appearance is determined by hereditary traits, but is often influenced by culturing conditions including temperature and the medium on which the bacteria are grown. However, under any one set of conditions, the colony appearance is remarkably constant. Colonies should be observed under magnification, either on a colony counter or dissecting microscope.

73 Bio250 Page 73 Culture characteristics 1. Size Colonies observed for size must be widely separated from each other. Under crowded conditions, colony size is reduced. Most colonies reach maximum size within hours. In a few slow-growing species, as well as in some motile species, the colonies may continue to enlarge after 48 hours. Colony size is described as follows: pinpoint small large swarm extremely small, a fraction of a millimeter in diameter 1 to 5 mm in diameter 5 to 10 mm in diameter colony of motile bacteria spreading across entire agar surface 2. Shape The form, margin, and elevation (when colony is viewed from the side) may be characteristic of a species. See Figure 3 for terminology. II. Broth cultures In examining the growth in broth cultures, note the characteristics on the surface of the broth, below the surface, and at the bottom of the tube. Handle the tubes with care upon the first observation. Examine your tubes first by looking up from the bottom of the tube. Cells may have settled to the bottom of the tube to form a sediment. Often, this is the only sign of growth. Alternatively, cells may have evenly dispersed throughout the media, interrupting the light path and creating turbidity. Many organisms grow completely over the surface of the broth, forming a pellicle. Some organisms form a ring of scum around the edge of the tube. This can be seen by tilting the tube slightly. Broth cultures can be examined for the following characteristics, which are illustrated in Figure 2. A. Amount of growth: scanty moderate abundant B. Surface growth pellicle a thick scum covering the entire surface membranous a thin scum covering the entire surface flocculent floating adherent masses of bacteria ring scum around the edge of the tube

74 Bio250 Page 74 Culture characteristics C. Subsurface growth turbid uniform growth granular small suspended particles flocculent large suspended particles flaky very large suspended particles D. Sediment amount type To determine type, agitate the tube and resuspend the material. Describe using same terminology as for subsurface growth. E. Odor putrid fruity negligible Turbid Flocculent Sediment Pellicle Ring Figure 2. Growth characteristics in nutrient broth.

75 Bio250 Page 75 Culture characteristics Procedure Note that for each of these exercises you are working in teams of four. Divide the work evenly among you so each person gets to practice each type of inoculation. A. Broth cultures Materials per group of four 4 tubes of tryptic soy broth Cultures of Bacillus subtilis, Escherichia coli, Serratia marcescens, and Enterococcus faecalis 1. Inoculate each of the other tubes with one loop from one of the stock cultures. 2. Incubate the tube of Serratia at 25 C and all other tubes at C for 48 hours. 3. Compare inoculated tubes with the control by placing them against a bright background and also a dark background. 4. For each culture, record the characteristics listed in part II (A-E) above. Note that for determining odor, hold an open tube several inches away from your nose, then create a current of air toward your nose by waving your hand over the tube. B. Colony Characteristics Materials per group of four 6 TSA plates Cultures: Gram + cocci Staphylococcus aureus Staphylococcus epidermidis Gram + Rods Bacillus subtilis Bacillus cereus Gram Rods Escherichia coli Pseudomonas aeruginosa 1. Make a streak plate for each species on TSA. 2. After streaking, incubate the plate of Pseudomonas at 25 C and all other plates at C for 48 hours. 3. Examine the colony morphology of each species and note the characteristics from part I A and C above.

76 Bio250 Page 76 Culture characteristics C. Single Streak Characteristics Materials per group of four 4 TSA slants Cultures of Bacillus cereus, Staphylococcus aureus, E. coli, and Bacillus subtilis. 1. Make a single streak for each species on a TSA slant. Heat your needle, cool, then pick up inoculum. Beginning at the bottom of the slant, draw a single line up toward the top of the slant. 2. Incubate at C for 48 hours. 3. Examine the growth and describe using the terminology from part I A and B above.

77 Bio250 Page 77 Culture characteristics Figure 3. Colony characteristics

78 Bio250 Page 78 Culture characteristics Study Guide Pre-lab questions: 1. What are three characteristics you could describe for colonies? for single streaks? for broth cultures? Post-lab questions: 1. Make a data table in your lab journal and record your data for your Broth Cultures. Amount of growth can be indicated by the following scale: None=0, slight=+, moderate=++, heavy= Make a data table in your lab journal and record your data for your streak plates. 3. Make a data table in your lab journal and record your data for your single streaks. 4. Which species showed chromogenesis? Were the broth cultures and colonies of each species the same color?

79 Bio260 Page 79 DEMONSTRATION EXERCISES

80 Bio260 Page 80

81 Bio260 Page 81 Microorganisms WHERE DO MICROORGANISMS OCCUR? 1 I. Overview All environmental situations, including our laboratory, are populated by a wide variety of microorganisms, most commonly bacteria, fungi and viruses. You should be aware of the ubiquity of these microorganisms, and how easily they can contaminate your cultures. Although microbes are found everywhere, the number of microbes and the composition of microbial populations will differ from place to place. Environments that have available water and lots of nutrients will typically be able to support the greatest numbers and diversity of species. For example, a healthy garden space that has lots of decaying organic matter from compost and is watered regularly will probably have a booming, diverse microbial population. In fact, this population is an essential component of healthy soil. Environments that are lacking in water and/or nutrients, or that present specific challenges to microbes, will have lower numbers or lower diversity of microbes. Human skin, for example, has lots of nutrients, but it is fairly dry. Thus, your skin is host to a large population of microbes, but the types of microbes that can live there are far fewer than in soil (i.e., diversity is lower): in order to live on the skin, microbes must have strategies to survive the challenges presented there. In this lab, we will inoculate growth media from variety of natural sources. These inoculations will also serve as the beginning of your pure culture project. Please feel free to bring in samples from home that you wish to test for the presence of bacteria, e.g., dirt from your yard, a telephone or remote control, a cutting board, old make-up, etc. II. Materials: (Per team of four students) 8 petri plates containing tryptic soy agar (TSA) a general growth medium for microbes 1 tube sterile water 1 package sterile swabs III. Procedure 1. Obtain your plates and label them with the following information: Date, type of medium Initials of team members (or team numbers) How the plate is going to be inoculated (see #2 below) Note that petri dishes should always be labeled along the edge of the bottom dish (Fig. 1). Dishes are labeled on the bottom because lids can be switched between dishes and along the edge because writing across the entire surface of the bottom may obscure the bacteria you want to look at Note that you may bring in items from home to test for microbes during this lab.

82 Bio260 Page 82 Microorganisms Label here label bottom bottom Figure 1. Proper location of Petri dish label. 2. Working in groups of four, inoculate your plates with swabs. To swab, take a sterile swab, put it in sterile water, roll the swab across the test surface, then roll the swab across the plate. Required plates: Plate 1: Remove the lid and expose the plate to the laboratory air for 30 minutes. Plate 2: Use a swab to sample a source with lots of diverse types of organic matter such as soil, the surface of a plant, or a puddle. Suggested plates (but feel free to substitute anything you want your cell phone, your belly button, the men s urinal, the drinking fountain, the anatomy lab, the bottom of your shoe get creative and have fun!): Plate 3: Remove the lid and expose the plate to the air outside the building for 30 minutes. Plate 4: Inoculate a plate from somewhere wet, like in the drinking fountain or the laboratory sink. Plate 5: Inoculate a plate with a sample from your body such as hair, a swabbing from the top of your nose, from your lips, from your forehead, armpit, back of your hand etc. Plate 6: Inoculate the plate with a swabbing from the floor near the edge of your lab table. Plate 7: Inoculate the plate with samples from the environment such as swabbing from a door handle, drinking fountain, shelf, bottom of shoe, and/or anywhere else you can think of. Plate 8: Inoculate the plate with a swabbing from the inside corners of your drawer/cabinet. 3. Recover and invert (turn agar-side up) all plates, then incubate them for 48 h. Environmental samples should be incubated at 25 C, samples from your body should be incubated at 35 C.

83 Bio260 Page 83 Microorganisms Study Guide Pre-lab questions: 1. What is the proper way to label a petri dish? (location and necessary information) 2. Do you expect that all sources of inoculum will yield similar results? Why or why not? 3. Do you think that every microbe in an environment you sampled will be able to grow on your Petri dish? Why or why not? Post-lab questions: 1. Set up a data table in your lab journal and record your data. For each sample, include the inoculum source, # of colony types (different kinds of colonies), a brief description of each type, including such features as relative size, color, surface texture, and shape (seetable 1 as an example), the # of colonies of each type, and the total number of colonies per plate. For counting purposes, anything less than 200 colonies is considered countable. If there are more than 200, you can label it TNTC, which means Too Numerous To Count 2. From the count of the number of colonies on the plate exposed to laboratory air, calculate the number of bacteria that fall on one square foot of the lab in one hour. (Your petri dish covers approximately 1/15 of a sq. ft.) Show your calculation. Based on your calculation, is it OK to leave a Petri dish open on your bench? Why or why not? 3. From what kinds of sources did you get the greatest diversity of colony types (colonies that look different from each other)? Why do you think this might be so? (Hint: think about possible sources of diversity in the environment you sampled)

84 Bio260 Page 84 Microorganisms 4. From what kinds of sources did you get the greatest number of colonies? Why do you think this might be so? (Hint: think about factors in the environment you sampled that might support abundant microbial growth). Table 1. An example data table Source # of colony Description of each # s of each type types type Toes 2 Small, white 15 Kitchen sponge Medium yellow 3 Small red Clearish yellow Big, irregular, beige 5 Total colonies per plate: TNTC (= too numerous to count) 2 Total colonies per plate: TNTC

85 Bio260 Page 85 Handwashing THE EFFECTIVENESS OF HAND HYGIENE Between 5 and 15% of patients admitted to a hospital, will acquire a new infection during their stay. These hospital acquired infections (or nosocomial infections) occur from a combination of three primary factors: the presence of compromised hosts, the numbers of infectious organisms, and the chain of transmission that exists between patients, especially via health care personnel. The number one way to prevent transmission of disease via health care personnel is through good hand hygiene. Microbiota of the skin At any one time, your hands are hosts to thousands of bacterial cells. These include transient species that you pick up from your environment activities like touching doorknobs, using a shared computer keyboard, shaking hands, or doing some gardening. Your hands are also home to your normal microbiota, the bacteria that live attached to your skin. Typical normal residents of the human skin include species of Staphylococcus, Micrococcus, and Corynbacterium (Table 1); these species vary in abundance and distribution over the human torso. Your forearm, for example, has about 12,000 microbial cells per square inch, while the most area of your armpit has about 500,000 microbes per square inch! Good hand hygiene can remove transients and temporarily reduce the numbers of normal microbiota on your hands. But what is the most effective way to clean your hands? Is soap and water best? or hand sanitizer? Should you air dry your hands or use a paper towel? Table 1. Characteristics of some normal microbiota of human skin Species Colony Gram Stain Comments Staphylococcus aureus Large golden colonies Gram-postive cocci in clusters Opportunistic pathogen, may cause abscesses, boils, impetigo, food poisoning, kidney Staphylococcus epidermidis Medium white colonies Gram-postive cocci in clusters Corynebacterium sp. Tan round colonies Gram-positive irregular rods Micrococcus sp. Small yellow or red Gram-positive cocci circular colonies in small clusters, Propionibacterium acnes Cream to reddish brown circular colonies diplos, or tetrads Gram-positive irregular rods disease Typically avirulent, but may be opportunistic Avirulent (except C. diphtheriae) Avirulent Can cause acne

86 Bio260 Page 86 Handwashing Scientific Method One way to tackle a question like figuring out the best method of handwashing is to use the scientific method (Fig. 1). Although scientists are all unique, certain common principles apply to the realm of science. One of these is that science only deals with questions about the natural world; in other words, questions that can be answered through observations by the five senses. Another common approach is the use of controlled experiments to answer questions. In a controlled experiment, scientists compare groups of subjects that differ by only one factor in order to determine the effect of that factor. Figure 1. The Scientific Method (from Ms. Babiak's science class)

87 Bio260 Page 87 Handwashing Scientists have certain language they use to describe their methods. In a controlled experiment: The factor that differs from group to group is called the experimental (or independent) variable. The factors that are the same from group to group are the controlled variables. The response measured by the scientist is the responding (or dependent) variable. A group that receives an experimental treatment is an experimental group. A group that is used for comparison and doesn't receive the experimental treatment is a controlled group. The scientific method is often shown as a loop, rather than a linear process (Fig. 2) because it never really stops. Based on their observations, scientists form ideas called hypotheses about how they think the world might work. They test these ideas through experimentation and more observation and continually revise their ideas in response to new information. Scientists also critically review each other's work in a process called peer review and they share information via journals and conferences. When ideas stand the test of time and scientific inquiry, they become scientific theories. These theories represent the closest approximation, at any given time, to what a scientist would consider "truth." Figure 2. Feedback within the scientific method (adapted from a diagram from NAU).

88 Bio260 Page 88 Handwashing In this lab, you'll have a chance to test out different methods of hand hygiene and practice your understanding of the scientific method of inquiry. IV. Procedure Materials per class: 1 g soil 1000 ml H2O hand sanitizer soap paper towels water swabs Materials per group of four: 8 Petri dishes (2 per person) Step 1: 1. With your group discuss the possible experimental variables that could affect the effectiveness of hand washing. 2. Have each person in the group choose a different variable to test. Record each person's name and their variable in your lab book. 3. For your variable, write down your hypothesis of how you think the variable will affect your results. Step 2: 1. Discuss your ideas about experimental design with your group. (A dilute solution of dirt+water will be available to the whole class if you want to pick up some transients before you begin. Other available materials are listed above in the materials section.) 2. Things to consider when designing your protocol include: How long will you apply a treatment such as soap or hand sanitizer? How long would you dry with a paper towel? What will you use for a control group? How will make sure your experimental group and control group are comparable? In other words, what things do you want to make sure to keep the same between the two? What will you record for your data? How long will you incubate plates? At what temperature? Will you sample your hands by rubbing them directly on agar, or will you use swabs? 3. Once you've worked out your protocol, write it down in your lab notebook. Step Three: Carry out your experiment and record your results.

89 Bio260 Page 89 Handwashing Pre-lab questions: 1. Define the following: experimental variable Study Guide controlled variable responding variable 2. To a scientist, how is a hypothesis different than a theory? Post-lab questions: 1. Record the variables chosen by each of your lab partners. 2. Record your hypothesis for your variable. 3. Record the details of your experimental procedure. 4. Record your data for your experiment in your lab journal. 5. Which bacteria on your hands seemed to be normal microbiota and which were transient? How could you tell? 6. Compare the results of your experiment with the results of your lab partners. Which experimental variable seemed to have the greatest effect on the success of hand hygiene? Support your answer with evidence from your lab group's experiments. 7. Compare the results of your experiment with the results of your lab partners. Which method overall seemed to remove the most microbes from yours or your lab partner's hands? Support your answer with evidence from your lab group's experiments. 8. Why do surgeons need to scrub their hands intensively before a surgery and then wear gloves during a surgery? Support your answer with evidence from your experiment. 9. A recent study compared the normal microbiota on the surface of nurses' hands with those on the surface of the general public and found that nurses have a significantly different population on their hands. Why might this be so?

90 Bio260 Page 90 Handwashing

91 Bio260 Page 91 Structures BACTERIAL STRUCTURES Bacteria possess few structures large enough to be seen with a light microscope. These structures are part of the bacterium s fine structure. In contrast, the ultrastructure of a bacterial cell are structures that can only be seen with an electron microscope. The fine structures of a bacterial cell include the cell wall, endospores, flagella, the glycocalyx (capsule, slime layer), and inclusion bodies (volutin, PHB, starch). Not all species of bacteria have all of these structures. The presence or absence of one or more of these structures can be used to help determine the scientific name of an unknown bacterium. In this lab, we will observe bacterial cells for the presence of endospores, flagella and a glycocalyx. I. Glycocalyx The glycocalyx is defined as any polysaccharide or glycoprotein containing structure outside the bacterial cell wall. Capsules vary in thickness and may or may not be closely associated with the cell surface. The glycocalyx has several important functions. With this structure, bacteria can adhere to other bacteria and to the surface of inert material such as soil. They may also adhere to plant or animal cells, forming microcolonies that are the major type of bacterial growth. The glycocalyx also provides bacteria with some protection from antibacterial agents such as antibiotics, viruses and phagocytes. Capsules also appear to increase the virulence of some organisms by protecting them from the defense mechanisms of their hosts. Capsules may provide specific immunologic properties to some bacteria. Based on these properties, some bacteria such as pneumococci are differentiated into different strains. Because the glycocalyx does not bond easily to dyes, a negative stain technique is used to visualize it. A material such as India ink, which contains particles too big to enter bacterial cells, is mixed with a small amount of a bacterial culture. The mixture of ink and bacteria is placed at one end of a microscope slide and then dragged across the slide. The india ink will stain the background around the cells, without staining the cells (hence the name negative stain). The ink/bacteria smear is then stained with safranin, which can penetrate the bacterial cells. The result of this procedure is pink bacterial cells on a black background of ink. The glycocalyx should appear as a clear halo around the pink cells. II. Endospores. When certain bacteria are stressed by a poor environment, they form endospores (spores within the cell) as a survival mechanism. Such spores are remarkably resistant to conditions that quickly kill off vegetative bacteria. Almost all endospore-forming bacteria belong either to the genus Bacillus, aerobic bacteria that are very common in the soil, or to the genus Clostridium, anaerobic bacteria common in soil and intestines. (The genus Clostridium includes the species that cause tetanus and botulism.)

92 Bio260 Page 92 Structures Endospores resist the usual stains and will appear in Gram-stained or simple stained preparations as relatively transparent spots within the stained cells. In this lab, you will use a special staining technique that will stain the spores. The spores themselves can be stained if heat is used to drive the stain into the protective spore coat of the endospores. In older cultures, the spore-bearing cells begin to disintegrate, leaving the naked spores. Size, shape, and position of the spores are used as aids in identifying and classifying the various species of Bacillus and Clostridium. III. Flagella The flagella of bacteria have a diameter of about 15 nm, which is below the resolving power of the light microscope. However, several methods have been developed to enable determination of the presence or absence of flagella in a particular species. Flagellar stains are mordants and act to coat flagella, making them thicker and thus visible with the light microscope. The chemicals used in staining flagella are more toxic and caustic than most, and will not be used in our laboratory. The presence of flagella can also be observed indirectly by their action. A bacterium possessing a flagellum is motile. (Some bacteria are also motile by other means.) Motility in bacteria can be observed either by slides or by culture. The best method for observing motility on a slide is called the hanging drop method. Hanging drop mounts are made by placing a drop of liquid on a cover glass and then supporting the cover glass over a slide by placing it on a cushion of petroleum jelly. The drop of liquid then hangs suspended over the slide. When viewed on the light microscope, truly motile bacteria will show directed motion. Non-motile bacteria may often show a quivering or vibratory motion known as Brownian motion. Brownian motion is caused by the kinetic energy of molecules and is not true motility. Flagella can also be detected by use of motility medium. Motility medium is a gel-like medium that prevents both the diffusion of oxygen and the distribution of nonmotile bacteria. Although the environment of the medium lacks oxygen, respiration in this media can continue because an indicator molecule called tetrazolium acts as the final electron acceptor for the electron transport chain. Tetrazolium in its oxidized state lacks color, upon accepting electrons (reduced state), it becomes a pinkish color. Thus, the presence of bacteria is demonstrated by a red color in the medium. Motility medium must be stabbed with an inoculating needle containing inoculum from a solid growth medium. The stab should penetrate and exit the motility medium to form a single straight stab line. Once incubated, the medium should not be agitated while warm. Ideally, the cultures should be observed after 24h of incubation. Motile organisms will move away from the stab line and will be indicated by red lines radiating away from the red stab line. An organism that is nonmotile will be trapped in the agar and will be indicated by a single red stab-line.

93 Bio260 Page 93 Structures Procedure A. Glycocalyx As group of 4 1. Observe the prepared slide of a capsule stain at 400x or 1000x. 2. Sketch and label your observations. B. Endospores As individuals Materials h 2 old cultures of Bacillus sp. Malachite Green Safranin 1. Set up a ring stand over your bunsen burner. Place a solid asbestos square over the ring stand. Place a glass beaker or tin can (not aluminum beaker) that is half-full of water on top of the asbestos square. Heat the water until it begins to boil. 2. Meanwhile, prepare a smear of the culture. 3. Dry and heat fix the smear. 4. When your water is boiling and your smear is ready, place an asbestos square from which a hole has been cut on top of the beaker. Then, place your slide over the hole. 5. Flood the slide with malachite green. 6. Heat the slide until the malachite green begins to steam. Steam for seconds. Add more stain if necessary to prevent drying out. 7. Wash with tap water for about 30 seconds. 8. Stain with safranin for about 30 seconds. 9. Wash, dry, examine and draw the spore, indicating the position in the cell. C. Flagella: Hanging drop mounts As pairs (each person should set up one hanging drop) Materials 6-12 h broth cultures of Escherichia coli 6-12 h broth cultures of Staphylococcus aureus 1. Place a thin border of petroleum jelly around the edge of a cover slip. You may do this either by squeezing the jelly out of a syringe, or by placing a dollop of jelly onto your hand and running the edges of your cover slip through the jelly Note: When spore staining an unknown bacterium, you will have to find the optimal age of the culture to observe spores. I recommend that you stain several ages of cultures. If you don t observe spores, even on an older culture (72hours or older), you can attempt to further stress your bacteria by growing them on Nutrient Agar, which is basically the agar thickener without any added food. Failure to observe spores is not a guaranteed negative for spore production, so you should re-check your culture at several time points in order to be sure.

94 Bio260 Page 94 Structures 2. Place two or three loopfulls of broth culture in the center of the cover glass and suspend it over the glass slide. 3. The high power objective will yield the best results for examination of this slide. Because there is so little contrast between the culture medium and the bacteria, the iris diaphragm of the microscope condenser will need to be closed more than halfway. It is very difficult to find the focus of the drop at first. Therefore, focus first on the edge of the drop. This will make it easier to locate the bacteria. D. Flagella: Motility Medium As group of 4 Materials 2 tubes of motility medium S h broth cultures of Escherichia coli 6-12 h broth cultures of Staphylococcus aureus 1. Stab a motility tube with each species. Try to stab directly up and down, so that your needle leaves by the same path it entered. 2. Incubate tubes for 24 h at 37 C. Be careful not to agitate the warm tubes of medium when removing them from the incubator. 3. Observe for red streaks radiating from the red stab line. This is a positive test for motility Note: When checking an unknown bacterium for motility, it s advisable to double-check a negative result from motility medium by doing a hanging drop. Some motile bacteria don t demonstrate their motility well in the agar.

95 Bio260 Page 95 Structures Study Guide Pre-lab questions: 1. How important are capsules for bacteria to be able to cause disease? 2. Why is it necessary to use a negative stain technique to view capsules? In your answer, be sure to include a definition of a negative stain. 3. In performing the spore stain, why is it necessary to heat the malachite green? 4. In a natural habitat such as soil, what advantage does endospore production afford to members of the genera Bacillus and Clostridium over the nonsporing bacteria? (Think about what it must be like to live in the soil and think about what kinds of conditions might trigger endospore production.) 5. How can you distinguish between Brownian motion and true motility? 6. Although you can see motility in bacteria, why is it difficult to see the flagella that cause the motion? 7. Why can bacterial flagella be easily seen with the electron microscope? 8. How does the indicator in motility medium function to demonstrate motility? 9. What is the appearance of a positive motility test using Motility Medium S? 10. What is the function of the agar in Motility Medium S?

96 Bio260 Page 96 Structures Post-lab questions: 1. Draw your observations of the capsule stain. Draw a circle to indicate the size of your field of view and draw the bacteria to scale. Label the cell and the capsule. 2. Draw your observations of your spore stain.. Draw a circle to indicate the size of your field of view and draw the bacteria to scale. Label the cells and the spores. 3. What shape were the spores observed in the spore stain (spherical, ellipsoidal)? 4. If you were able to observe a cell in the process of making a spore (the spore was inside the parent cell), where were the spores located in the cell (centrally, terminally, both)? 5. What was the shape and arrangement of each species of bacteria (yours and your partner's) observed in the hanging drop? Describe the motion you saw in each hanging drop. Make a conclusion based on the hanging drops of whether each species of bacteria showed true motility or Brownian motion. 6. Make a sketch of your motility stabs. Make a conclusion based on your motility stabs of whether each species of bacteria showed true motility or not. 7. Do your conclusions for motility based on the hanging drops agree or disagree with your conclusions based on the motility stabs? If they disagree, why might that be so?

97 Biol260 P a g e 97 EFFECTS OF TEMPERATURE ON BACTERIAL GROWTH Different bacteria have different optimum growth temperatures and will grow at different temperature ranges. The ability of a bacterium to survive a particular temperature is determined by the heat sensitivity of its particular enzymes, membranes, ribosomes, and other cellular components. The minimum growth temperature is the lowest temperature at which growth will occur. Low temperatures slow the rate of enzyme-catalyzed reactions. If these rates become too slow, life processes cannot be sustained. The maximum growth temperature is the highest temperature at which growth will occur. High temperatures can denature enzymes, thus preventing necessary reactions from occurring. High temperatures may also affect the stability of the plasma membrane. The optimum growth temperature is the temperature that produces the most rapid growth. This temperature usually correlates with the temperature of the bacterium s normal environment. For example, most human pathogens grow best at body temperature, or 37ºC. Most bacteria can be classified into one of three major groups, two of which can be further subdivided. Psychrophiles are cold-loving microbes that can grow at minimum temperatures below 0ºC. Optimum growth temperatures are about 15ºC, and growth rarely occurs above 20ºC. (Another group of cold-loving organisms, the psychrotrophs, can grow from 0-30ºC and has optimum temperatures around 20ºC.) Mesophiles are moderate-temperature loving microbes and include the human pathogens. Their optimum growth temperatures are between 25-40ºC, minimum temperatures are as low as 10ºC, and maximum temperatures are around 45ºC. Thermophiles are heat-loving microbes whose optimum temperatures are around 60ºC (extreme thermophiles, or hyperthermophiles, have even higher optimums). Minimum temperatures are around 40ºC and maximum temperatures are around 75 (extreme thermophiles can survive temperatures up to 110ºC!). Procedure A. Materials (per group of 4) 1. Slant cultures of the following five organisms: Bacillus sp., Escherichia coli, Pseudomonas fluorescens, Serratia marcescens, and Staphylococcus aureus. 2. Six petri plates of TSA.

98 Bio260 Page 98 Temperature B. Procedure Label the bottoms of the dishes with your group name and the following temperatures (one per plate): 5ºC, 15ºC, 25ºC, 35ºC, 45ºC, and 55ºC. 2. Mark the bottom of each plate into five equal segments. Label each segment with the name of the one of the bacteria (Fig. 1). 3. Streak each section of each plate with the appropriate bacterial species (Fig. 1). 4. Place all plates in the inverted position in the appropriate incubators, except the 5ºC plate, which should be placed on the front table. Your instructor will place the 5ºC plate in the refrigerator. For plates that are being placed at temperatures above 37ºC, or if plates will be incubated over the week-end, place the plates inside a plastic bag. 5. Examine and record the growth (amount, color) in all plates after 48 h. Return the 5ºC plate to the refrigerator for another week and re-examine. Figure 1. Inoculation of a 5-sectored plate Remember that lowering the temperature lowers kinetic energy and causes cells to grow more slowly. Thus, if you are testing growth at temperatures lower that room temperature (25C), you will need to give the bacteria additional time to show growth. For low temperatures like 5C or 10C, you should incubate the plates for at least a week. 5 High temperatures will cause solid media to dry. If you are incubating plates at temperatures above 37C, be sure to place the plates in a ziploc bag. If you are incubating at 37C for more than two days, you should also place the plates in a ziploc bag.

99 Bio260 Page 99 Temperature Pre-lab questions: Study Guide 1. Define psycrophile, mesophile, and thermophile. 2. Where in nature would you go to locate a psychrophile? a mesophile? a thermophile? Post-lab questions: 1. Describe the appearance (amount of growth, color of growth) of each organism on each plate. 2. Make a data table in your lab journal and record the minimum, optimum, and maximum temperatures at which growth occurred for each species. 3. Based on your data, which organisms appear to be psychrophiles or psychrotrophs? 4. Based on your data, which organisms appear to be mesophiles? 5. Based on your data, which organisms appear to be thermophiles? 6. Except for differences in colony size which may differ due to growth rate and drying, did any of the species appear different when grown at different temperatures?

100 Bio260 Page 100 Temperature

101 Biol260 P a g e 101 Modes I MODES OF METABOLISM I All organisms use oxidation-reduction reactions in order to obtain energy in the form of ATP. That is, electrons are removed from an energy source (e.g., glucose is oxidized) and transferred to an electron carrier (e.g., NAD + is reduced to NADH + H + ) in a process that ultimately leads to ATP production. If the organism is capable of performing respiration, then electrons in the electron carrier may be transferred to an electron transport chain that produces relatively large amounts of ATP. In addition, many organisms can produce relatively small amounts of ATP by another pathway, called fermentation. In fermentation, electrons in the electron carrier are passed to organic molecules and an electron transport chain is not utilized. The most familiar type of energy metabolism to you is probably aerobic respiration in which electrons from food are passed to electron carriers, then to an electron transport chain, and finally to oxygen. Indeed, many people think oxygen is required for life because of this process. However, this is not true. Many microorganisms can grow in the absence of oxygen and some absolutely require its absence they are poisoned by it. These organisms obtain their ATP by processes that do not require oxygen, such as fermentation. Another process by which organisms obtain ATP in the absence of oxygen is anaerobic respiration. This is very similar to aerobic respiration, but molecules other than oxygen (e.g., NO 3 -, SO 4 - ) are used to accept electrons in the electron transport chain. Both types of respiration produce relatively more ATP than does fermentation, and thus organisms that are respiring will grow faster than those that are using fermentation as their sole source of ATP. I. Oxygen Requirements Based on their oxygen requirements and ability to tolerate oxygen, organisms are divided into five groups. Aerobes, often called obligate aerobes, must have oxygen to live. For these organisms, oxygen is the final electron acceptor during aerobic respiration. Microaerophiles require oxygen for aerobic respiration, but they demand a higher concentration of carbon dioxide and less oxygen than is usually found in air. Facultative anaerobes have the enzymes necessary to utilize oxygen in respiration, but do not require oxygen. When oxygen is depleted from an environment, facultative anaerobes can either substitute other electron acceptors and perform anaerobic respiration, or they may perform fermentation. Aerotolerant anaerobes do not utilize oxygen in their metabolism, but neither are they killed by it. They carry out fermentation and also produce the enzymes necessary to neutralize the toxic derivatives of oxygen. Obligate anaerobes are poisoned by oxygen and its toxic derivatives.

102 Bio260 Page 102 ModesI II. Thioglycollate Medium This medium contains the reducing compound sodium thioglycollate which binds to free oxygen. This creates in increasingly oxygen-free environment as you move deeper into the tube. The medium is typically stored in a screw cap vial. The medium is sterilized in an autoclave with the caps unscrewed slightly so oxygen is removed as gases are expelled from the medium. Once the medium has been autoclaved and cooled, the caps are screwed tight to prevent the return of oxygen. In order to determine whether the medium is usable, the medium also contains a redox potential indicator which turns green in an oxidized environment. Older tubes may have a thick greenish upper layer (extending to a depth greater than 30% of the medium), indicating that the medium is too aerobic to be used. If this is the case, loosen the screw cap and place the tube in a boiling water bath for 10 min to drive out the dissolved oxygen. Tubes with a thin greenish layer may be used directly, without reheating. IV. Gas Pak System Many pathogenic bacteria, e.g., Streptococcus pyogenes and Clostridium perfringens, grow either anaerobically or in a reduced oxygen environment. Cultivation of anaerobes can be carried out by various methods, one of which is the Gas Pak Pouch System. Cultures are placed in the pouch along with a packet containing chemicals that release hydrogen and carbon dioxide when activated by contact with air. The hydrogen reacts with gaseous oxygen, forming water and removing the gaseous oxygen from the pouch. Carbon dioxide is released into the pouch, increasing it s concentration. The high levels of CO 2 and absence of O 2 favor the growth of anaerobic bacteria. V. OF medium Whether an organism is oxidative (uses oxygen in aerobic respiration) or fermentative (can do fermentation, does not require oxygen) can be determined by using OF basal medium with the desired carbohydrate added. OF medium is a nutrient semisolid agar deep containing a high concentration of carbohydrate and a low concentration of peptone. The peptone will support the growth of nonoxidative-nonfermentative bacteria. Two tubes are used: one open to the air and one sealed to keep air out. OF medium contains the indicator bromthemol blue, which turns yellow in the presence of acids, indicating catabolism of the carbohydrate. Alkaline conditions, due to the use of the peptone and not the carbohydrate are indicated by a dark blue color. Uninoculated OF medium is a deep green. We will use OF medium that has been prepared with glucose. Interpretation of the tubes is according to the following table. Sealed tube Open tube Conclusion Yellow Yellow Capable of fermentation Green Yellow Strictly oxidative Green Green Cannot metabolize glucose

103 Bio260 Page 103 ModesI Procedure A. Thioglycollate Medium 1. Materials per group of four: a. Broth cultures of Clostridium sp., Pseudomonas aeruginosa, Escherichia coli, Staphylococcus aureus, and Enterococcus faecalis. b. 5 tubes of melted thioglycollate agar, that has been held at 50ºC c. 5 sterile droppers 2. Using a sterile, cotton-plugged Pasteur pipette, inoculate a tube of thioglycollate by putting two droppersfull (about 2 ml) of broth culture into the bottom of a tube. 3. Repeat the procedure using the other cultures. 4. Mix each tube by holding it firmly between the palms of both hands and rolling the hands back and forth. This mixes the inoculum throughout the medium without introducing oxygen into the medium. 5. Place the tubes into a beaker of cold water, just above the level of the agar, until they are completely resolidified. 6. Incubate all cultures at 37ºC until the next lab period. Examine for growth pattern. Growth will give the medium a cloudy appearance that is best seen in comparison with a control tube of uninoculated medium (available in the control rack). B. Gas Pak System 2. Materials per group of four: a. Two TSA plates b. Cultures listed above. 3. Divide the bottom of each plate into five equal sections. 4. Label each section with the names of the species to be used. Label one plate anaerobic and the other aerobic. 5. Streak each section with a different species. 6. Invert one plate and place it in a GasPak pouch at the front of the room. Each pouch can hold 1-4 plates, so we ll use 2 pouches for the whole class. When 3 plates are in the pouch, remove a generating packet from its foil wrapper and place it into the GasPak pouch. The little pellet attached to the pouch is an oxygen indicator. When it is white, oxygen is absent. If it is blue, oxygen is present. Squeeze excess air from the GasPak pouch and seal the Ziploc securely. 7. Place the anaerobic plates in the GasPak pouch and the aerobic plates into the 25ºC incubator until the next lab period. When you return to retrieve your plates, be sure the oxygen indicator tablet is white (no oxygen). C. OF Medium 1. Materials per group of four: a. Four tubes of OF medium. b. Sterile mineral oil. c. Cultures of Pseudomonas aeruginosa, E. coli

104 Bio260 Page 104 ModesI 2. For each species, inoculate two tubes of medium by stabbing to within one centimeter of the bottom of the tube. 3. Take one tube of the pair for each species and cover the medium with a layer of sterile mineral oil. The oil should be about 1-2 cm thick. 4. Incubate the tubes at 37ºC until the next lab period.

105 Bio260 Page 105 ModesI Study Guide Pre-lab questions: 1. Define aerobe, facultative anaerobe, microaerophile, aerotolerant and obligate anaerobe. 2. What is the reducing compound in thioglycollate medium? What is its function? 3. Why is water vapor present in the Gas Pak Jar after incubation? 4. How can you tell from OF-glucose medium whether an organism catabolizes glucose oxidatively? Whether it ferments glucose? Whether it doesn t use glucose? Post-lab questions 1. Create data tables and record your data in your lab journal: For thioglycollate, record the amount and position of growth in each tube. For the gas pak plates, record amount of growth on each plate. You can use Ø for no growth, + for slight growth, ++ for moderate growth, and +++ for abundant growth. For OF media, record amount of growth and color of media. 2. For each test, make tentative conclusions regarding the relationship between the bacterial species and oxygen. Then, review your data and used the combined results to answer questions 3-6.

106 Bio260 Page 106 ModesI 3. Based on all available data, which organisms tested were obligate aerobes? How could you tell? Be sure to include evidence to support your claim and reasoning. 4. Based on all available data, which organisms tested were facultative anaerobes or aerotolerant anaerobes? How could you tell? Be sure to include evidence to support your claim and reasoning. 5. Based on all available data, which organisms tested were obligate anaerobes? How could you tell? Be sure to include evidence to support your claim and reasoning. 6. Based on all available data, which organisms tested were microaerophilic? How could you tell? Be sure to include evidence to support your claim and reasoning.

107 Biol260 P a g e 107 Modes II MODES OF METABOLISM II I. Catalase Production Oxygen is both beneficial and poisonous to living organisms. It is beneficial because its strong oxidizing ability makes it an excellent terminal electron acceptor, as in aerobic respiration. However, oxygen is also a toxic substance. One damaging effect of oxygen is due to toxic derivatives of oxygen such as superoxide radicals, hydroxyl radicals, and hydrogen peroxide. All of these are powerful oxidizing agents. They combine in various ways with organic chemicals within cells and destroy cellular constituents very rapidly. Aerobic and facultative anaerobic bacteria have developed protective mechanisms to reduce oxygen toxicity. Aerobic and facultative anaerobic bacteria usually contain the following enzymes: Superoxide dismutase, which catalyzes the conversion of superoxide radicals into oxygen and hydrogen peroxide; Catalase, which catalyzes the conversion of hydrogen peroxide into gaseous oxygen and water; and Peroxidase, which catalyzes the conversion of hydrogen peroxide and protons into water. Obligate anaerobic bacteria are deficient in these enzymes and cannot grow in the presence of oxygen. The presence or absence of catalase is useful in differentiating groups of morphologically similar bacteria such as gram positive cocci. Catalase production can be detected by adding the substrate hydrogen peroxide (H 2 O 2 ) to an appropriately incubated TSA culture (slant or plate). If catalase is produced by a species of bacteria, bubbles of free O 2 gas will be liberated (i.e., the H 2 O 2 will effervesce). II. Oxidase Production Oxidase enzymes play an important role in the operation of the electron transport system during aerobic respiration. Cytochrome oxidase uses O 2 as an electron acceptor during the oxidation of reduced cytochrome A 3 to form either water or hydrogen peroxide. The oxidase test is used to reveal whether a bacterium has cytochrome oxidase in its electron transport chain. In the oxidase test, a particular chemical is applied to bacterial cells. If the test organism possesses cytochrome oxidase, the oxidase will accept electrons from the chemical causing it to change color. If no cytochrome oxidase is present, the chemical will remain colorless. The oxidase test is a useful procedure in the clinical laboratory because some gram-negative pathogens (Neisseria, Pseudomonas, Vibrio) are oxidase positive. Other species in their families are oxidase negative.

108 Bio260 Page 108 Modes II III. Nitrate Reduction Many species of bacteria are able to use nitrate (NO 3 ) instead of oxygen (O 2 ) as the terminal electron acceptor in their electron transport chains. When nitrate accepts electrons, it is reduced to form nitrite (NO 2 ). The reaction requires the enzyme nitrate reductase. NO H e - nitrate reductase NO H 2 O Some bacteria also possess the enzymes necessary to further reduce the nitrite to either nitrogen gas (N 2 ) or ammonia (NH 3 ). The nitrate reduction test is performed by growing bacteria in a culture tube with tryptic nitrate broth (contains 0.5% KNO 3 ). After incubation, the culture is treated by the addition of sulfanilic acid and alphanaphthylamine. These two colorless chemicals react with nitrite ions to produce a complex chemical having a red color. Thus if reduction of nitrate to nitrite has occurred, the medium will immediately turn red, and the test is positive (Fig. 1). However, if a culture does not produce a color change, two possibilities exist: 1) the nitrates were not reduced by the bacteria, or 2) the bacteria possess both nitrate reductase (reducing nitrate to nitrite) and the additional enzymes necessary to reduce nitrite to ammonia or molecular nitrogen gases (thus leaving no nitrite to be detected). Thus, if a culture does not change color in the initial test, a second test must be performed to differentiate between these two possibilities. The second test is called the confirmation test. To perform the confirmation test, a small amount of zinc and hydrochloric acid (HCl) are added to all tubes of media that did not change color during the initial test. Two results are possible (Fig. 1): If nitrates are still present in the tube (the bacteria did not reduce the nitrate to nitrite), the zinc will now reduce the nitrate to nitrite and causing a red color to appear in the tube (remember the initial chemicals added produce red color in the presence of nitrite). This result indicates a negative reductase test, because the bacteria didn t reduce the nitrate, the zinc did. If the bacteria reduced the nitrate to nitrite and then to nitrogen gas or ammonia, there will be no nitrate left in the tube. Thus, the zinc will not have anything to react with and the tube will remain clear. This result indicates a positive reductase test, because the bacteria did reduce the nitrate. Additionally, each test tube contains a small, upside-down glass tube called a Durham tube. If the bacteria reduced the nitrate to nitrogen gas, gas will have collected in this tube and be visible. Note: Nitrate reduction is referred to as denitrification by environmental microbiologists because it leads to the removal of nitrate from the soil.

109 Biol260 P a g e 109 Modes II Add chemicals that detect NO 2 Red color produced Nitrate reductase test is positive Add bacte bacteria reduced NO 3 to NO 2 NO 2 add zinc and HCl NO 3? bacteria did not reduce NO 3 NO 3 no color change confirmation test required NO 2 red color produced nitrate reductase test is negative bacteria reduced NO 3 to N 2 or NH 3 N 2 or NH 3 no color change confirmation test required N 2 or NH 3 no color change nitrate reductase test is positive Figure 1. The nitrate reductase test.

110 Biol260 P a g e 110 Modes II IV. Procedure A. Catalase test 1. Materials per group of four: a. Cultures of E. coli, Bacillus subtilis, Staphylococcus aureus, Lactococcus, and Pseudomonas aeruginosa. b. 1 TSA plate c. H 2 O 2 2. Divide the bottom of the plate into 5 equal sections. Label each section with the names of the species to be used. 3. Streak each section with a different species. 4. Incubate at 35 C for h (no longer). 5. Place a few drops of H 2 O 2 on a small segment at one end of the streak of each organism. If catalase is present, a trail of bubbles will arise from the growth. B. Oxidase Test 1. Materials per group of four: a. Cultures of E. coli, Bacillus subtilis, Staphylococcus aureus, and Pseudomonas aeruginosa. b. 1 TSA plate c. 1 oxidase card d. 2 wooden sticks 2. Divide the bottom of the plate into 4 equal sections. Label each section with the names of the species to be used. 3. Streak each section with a different species. 4. Incubate at 35 C for h (no longer). 5. Using a clean end of the wooden stick, pick up some material from the culture and rub it across one of the windows on the oxidase card. Observe for a change to blue color within 20 seconds. Disregard any color change that occurs after 20 seconds. C. Nitrate Reductase Test 1. Materials per group of four: a. cultures of Pseudomonas aeruginosa, Bacillus subtilis, and Staphylococcus aureus. b. soil sample c. 4 tubes nitrate broth d. sulfanilic acid reagent e. alphanaphthylamine (=Vogues Proskauer Reagent A) f. zinc powder g. 6N HCl 2. Inoculate each species into a tube of nitrate broth. 3. Inoculate a fourth tube with a small amount of soil using a wet inoculating loop. 4. Incubate at 35 C for at least 48 h.

111 Bio260 Page 111 Modes II 5. After incubation, observe each tube for the presence or absence of gas in the Durham tube. Then test each tube by adding 1 ml of the sulfanilic acid reagent followed by 1 ml of the alphanaphthylamine (note:20 drops=1ml). If nitrites are present, the mixture of the two reagents in the medium will produce a red, purple, or maroon color. Even a transitory color is positive. 6. A negative result requires a confirmation test. Add a small amount of powdered zinc and a few drops of HCl to each of the negative tubes. Swirl each tube vigorously and let sit for 10 minutes. Observe for color changes.

112 Bio260 Page 112 Modes II Pre-lab questions: Study Guide 1. What chemical is used to test for catalase? Why? 2. What constitutes a positive test for catalase? 3. What does a positive catalase test tell you about the metabolic pathways possessed by the organism? 4. What does a positive oxidase test tell you about the metabolic pathways possessed by the organism? 5. The oxidase test is used to differentiate among which groups of bacteria? 6. What is the reaction catalyzed by nitrate reductase? 7. In the nitrate reductase test, what is the function of zinc dust? 8. In the nitrate reductase test, what end products are indicated when zinc dust is added and no color change occurs? 9. In the nitrate reductase test, why is the development of a red color when zinc is added a negative result?

113 Bio260 Page 113 Modes II 10. The reduction of nitrate is an example of which form of energy production discussed in lecture? 11. How does nitrate reduction fit into the nitrogen cycle? Post-lab questions: 1. Create data tables in your lab journal and record your data: 7. For the catalase test, record the presence or absence of bubbles. 8. For the oxidase test, record whether there was a color change to blue or whether the color did not change. 9. For the nitrate reductase test, record the results (colors) of both your initial tests and the confirmation test (if a confirmation test was done). 2. Which organisms had the enzyme catalase? How could you tell? Be sure to use evidence to support your claim and your reasoning. 3. Which organisms possessed cytochrome oxidase? How could you tell? Be sure to use evidence to support your claim and your reasoning. 4. Which organisms were capable of reducing nitrate? To what products did they reduce it? How could you tell? Be sure to use evidence to support your claim and your reasoning.

114 Bio260 Page 114 Modes II

115 Bio260 Page 115 Mutation AN OVERVIEW OF MICROBIAL METABOLISM The chemical reactions that occur within cells are referred to as metabolism. Metabolism can be divided into two categories: catabolism, which refers to reactions that break down macromolecules, and anabolism, which refers to reactions that synthesize macromolecules. All metabolic processes involve enzymes, proteins that catalyze reactions. Most enzymes function inside cells and are called endoenzymes. However, bacteria can't do endocytosis, which means they can't bring large polymers into their cells. Instead, many bacteria make enzymes, called exoenzymes, that are secreted from the cell to catalyze reactions outside of the cell (Fig. 1). Exoenzymes break polymers down into monomers that can be transported into the cell via transport proteins. H 2 O substrate Endoenzymes Energy Cellular material Waste exoenzymes exoenzymes released from cell Bacterium Figure 1. Bacterial Enzymes Bacteria can't be identified and classified based on their morphology alone because so many bacteria look similar. Additional factors, such as metabolism or DNA sequences, must be used. Although modern microbiological techniques increasingly rely upon molecular methods of identification, such as direct DNA sequencing or serological methods for identification of specific antigens, classical methods can still provide useful information. In particular, the presence or absence of certain enzymes can help distinguish between groups of bacteria. The types of enzymes a bacterium possesses can be determined by its ability to utilize certain substrates. When a bacterium breaks down a substrate, the products may be detected by a change in ph or the production of a gas. For example, in order for a bacterium to utilize a particular food molecule, it must break it into monomers and then convert those monomers into an intermediate in one of the central metabolic pathways (Fig. 2). When bacteria convert amino acids into intermediates in cellular respiration, they remove an amino group and release it as ammonia, which acts as a base. By contrast, when bacteria break down carbohydrates or lipids, they may produce acids and carbon dioxide gas. To detect these reactions, microbiologists prepare media that contain a particular food molecule plus ph indicators and small tubes for the collection of gas.

116 Bio260 Page 116 Mutation Figure 2. An overview of metabolism (modified from a figure in the Virtual Chembook by Dr. Charles E. Ophardt, Elmhurst College) I. Carbohydrate and Lipid Catabolism Just as they do for you, carbohydrates and lipids are excellent sources of energy and carbon for bacteria. Bacteria use exoenzymes to break polysaccharides into monosaccharides and lipids into glycerol and acetyl-coa. The smaller monomers can then be transported into the cytoplasm and further catabolized through the central metabolic pathways (Fig. 2). If a bacterium can do aerobic respiration, and oxygen is plentiful, then it will feed monosaccharides and acetyl-coa into this pathway, producing carbon dioxide gas and acids as a result. If a bacterium can't do aerobic respiration, or if oxygen isn't available, the bacterium may be able to ferment monosaccharides. Many fermentation pathways produce acids, but some do not. The pathways and carbon sources that are available to each bacterium depends upon the enzymes it has, which of course ultimately depends upon its DNA code. A. Catabolism of Starch Bacteria that have amylases are capable of digesting starch to its component glucose molecules, which can then be oxidized for ATP production. The presence of starch can be detected by the application of Gram s iodine, which produces a blue-black color when it reacts with starch. Thus, media containing will look blue-black after application of iodine. If a species of bacteria possesses

117 Bio260 Page 117 Mutation amylase, the starch medium surrounding a colony/streak will be clear when iodine is dropped on the surface. B. Sugar Tube Fermentations Sugars are the compounds most widely used by fermentative organisms. In a process that does not require oxygen, sugars are oxidized for ATP production. Whether or not a carbohydrate can be fermented by a particular organism depends on the transport enzymes (permeases) and the endoenzymes possessed by the organism. The end products of fermentation vary from one organism to another depending on the pathway involved. However, the end products are usually acids of various types or both acids and gas. In order to detect gas production, small glass tubes called Durham tubes are inverted and placed inside the culture tubes. To test whether a microbe can ferment a particular sugar, media is prepared containing 0.5% of a specific monosaccharide or disaccharide plus meat extracts to provide nitrogen and minerals. Phenol red is included as a ph indicator to detect acid production. Because of the phenol red indicator, all sugar tubes are red in color. It is virtually impossible to distinguish between the various types of sugar broth, so you must immediately label each of these sugar broths upon removing them from their storage rack. Only the storage rack is labeled with the type of sugar in the broth. A positive test for acid production is yellow colored broth. A positive test for acid and gas is yellow colored broth and a bubble in the Durham tube. Note that sugar tubes do not allow us to determine the specific type of acid or gas being produced. If the organisms cannot ferment the sugar, it may utilize the meat extracts for energy instead. Proteins will first be hydrolyzed to amino acids, then amino acids can be catabolized for energy production. In order to access the carbon backbone of an amino acid, a microbe must first remove the amino group from the amino acid. This process is called deamination. If the microbe has adequate amounts of nitrogen, the amino groups will be released as ammonia into the medium. Ammonia (NH 3 ) can accept hydrogen ions (H + ) from the medium, forming the ammonium ion (NH 4 + ). Because hydrogen ions are being removed from the solution, the medium becomes more basic. At a basic ph, phenol red becomes more pink that red. This is called an alkaline reaction and it indicates protein catabolism. II. Protein catabolism Bacteria break down proteins both for energy and to obtain amino acids for the synthesis of bacterial proteins. Large protein molecules are hydrolyzed by exoenzymes called proteases and peptidases. (A peptide is a short protein.) The smaller products of hydrolysis can then be transported into the cell, where they can be further broken down or used in biosynthesis by endoenzymes. For catabolism of amino acids to occur, the amino groups of amino acids must first be removed by deamination and converted into ammonia. If the bacterium that is breaking down amino acids already has an adequate supply of nitrogen, the bacterium will release this ammonia as waste. The

118 Bio260 Page 118 Mutation release of ammonia by bacteria is called ammonification and it results in the medium becoming more basic. The presence of a protein in a nutrient medium will stimulate the bacterium, if it possesses the proper gene, to produce the hydrolytic exoenzyme necessary to hydrolyse the protein. As the protein is broken down, the chemical or physical properties of the medium change. These changes can be detected by chemical or physical means and reveal the presence of the enzymes in the medium surrounding the growth. A. Hydrogen sulfide production Certain species of bacteria possess the ability to produce cysteine desulfurase, which produces hydrogen sulfide from the sulfur-containing amino acid cysteine. The production of H 2 S is the initial step in the catabolism of cysteine, which will eventually be respired for energy. In order for cysteine to be completely catabolized in cellular respiration, the bacteria must first remove the sulfhydryl group from cysteine using cysteine desfurase. The product of the desulfurylation of cysteine is hydrogen sulfide. Common examples of this reaction are the aroma of rotting eggs found in certain spoiled foods and in the intertidal mud-flats around Puget Sound. Hydrogen sulfide production can be demonstrated in/on media containing salts of metals such as iron (e.g., ferrous sulfate). H 2 S reacts with ferrous salts to form a black precipitate, ferrous sulfide. This black precipitate is prevalent in spoiled canned foods and mud flats. Bacteriologists often design special media to gather information about 2 or 3 metabolic reactions using a single inoculation. The Kligler s iron agar slant is such a medium. It contains ferrous sulfate, glucose (0.1%), lactose (1.0%) and phenol red. The slants are inoculated by stabbing into the butt of the slant, then streaking the needle across the top of the slant. When bacteria grow in the base of the slant (stab), they are in an anaerobic environment and may ferment sugar to acids and possibly gas. When bacteria grow on the surface (streak), they are in an aerobic environment and may respire sugar to water and carbon dioxide. Sugar fermentation is evidenced by the conversion of all or portions of the medium from red (ph 8.2) to yellow (ph 6.4). The acid end products of fermentation cause the phenol red to become yellow. Bacteria that are unable to ferment a particular sugar(s) to an acid or will only aerobically respire, will produce no color change in the medium. Rarely, the medium becomes a deeper red color, indicating alkaline products. Kligler s iron agar slants are useful for the identification of the enteric bacteria (Enterobacteriaceae) and to distinguish enterics from other gram-negative bacilli. Thus, 5 separate types of growth patterns can be observed: Red Slant and Yellow Base: Only glucose fermentation has occurred. The organisms degraded glucose, but because of its low concentration (0.1%), only a small amount of acid was produced at the base and was not able to diffuse to the surface. Yellow Slant and Yellow Base:

119 Bio260 Page 119 Mutation Lactose fermentation has occurred. Because there is 10 times more lactose than glucose in the medium, more acid is produced. Enough acid is made so it will diffuse to and change the color of the slant. Red Slant and Red Base: None of the sugar was fermented. Possible alkaline production may have occurred and the red color deepens. Determine this by comparing colors of your tube with a sterile tube of Kligler s iron agar. Yellow Slant and/or Base with Split Agar: Fermentation of sugar plus gas production has occurred. Splitting agar occurs when the agar is pulled (or pushed) away from the base of the test tube by the gas. Blackening of the Agar: H 2 S gas was produced. This caused a ferrous sulfide precipitate to blacken the agar. B. Litmus Milk Reactions Litmus milk serves as an excellent culture medium and is used extensiely for biochemical characterization of microorganisms because of the many different reactions that can result when microorganisms are grown it. Skim milk contains the sugar lactose, the protein casein, vitamins, minerals and water. The end result of the action of bacteria on milk depends primarily on whether the bacterium attacks the carbohydrate or the protein of the skim milk. Some bacteria ferment the lactose, others proteolyze the casein, and still others are able to utilize both. Litmus milk medium contains 10% powdered skim milk and the dye litmus. Litmus, when added to rehydrated skim milk, turns the milk suspension from white to lavender. Litmus serves as both a ph indicator (red at/below ph 4.5; blue at/above ph 8.3, lavender at ph 6.8) and as a reducible dye molecule (i.e., it can accept electrons). If an organism reduces the litmus, the lavender-colored milk turns to its normal color again (usually grey). When litmus is in the reduced state, it can no longer function as a ph indicator. Reduction characteristically begins at the bottom of the tube and progresses upward. Some of the reactions in litmus milk take four or five days to occur. Cultures should be incubated for at least this interval of time. Ideally, cultures should be observed at 24 h intervals for the following possible reactions: Fermentation of lactose If lactose is fermented, the resulting production of organic acids will cause the litmus to turn from lavender to a red or pink color. If enough acid is produced, the ph may be lowered to a point where the milk forms an acid curd. These curds can be of different types depending on the types of bonds formed between the casein molecules in the curd and the rapidity of the curd formation. Curd formation may or may not be accompanied by gas production.

120 Bio260 Page 120 Mutation soft curd: This curd is soft, appearing solid in the tube, but showing some movement when the tube is tilted. Very little whey is typically seen on top of the surface of the curd. (Whey is a somewhat clear, opalescent liquid.) hard curd: These are solid and will remain compact when the tube is tilted. The strong molecular bonds between the casein cause contraction of the curd, and force out a relatively thick layer of whey. The upper surface of the curd forms a depression as a result of the contraction process. stormy curd: If a species produces both acid and gas, a stormy curd may result. In a soft curd, the gas will be visible as bubbles trapped within the curd. A hard curd may be cracked or torn to shreds by the escaping gas. Reduction of litmus If the litmus is reduced by a species, the milk will return to a grey-white color. This reduction is typically seen as a white zone beginning at the bottom of the tube and proceeding upwards. Some organisms bring about complete reduction of the litmus, rendering the tube completely white except for a rim at the surface of the medium. Coagulation of casein Many microbes possess rennetase, an enzyme that coagulates casein without acid production. A rennet curd is typically soft and lilac in color (neutral ph). Proteolysis Some microorganisms possess proteolytic enzymes capable of hydrolyzing the insoluble casein, e.g., caseinase. This process, called peptonization, results in the release of large amounts of peptides and amino acids. Continued incubation results in greater production of these soluble products and creates a clearing of the milk. The transparent liquid supernatent often turns brown. If the organism is utilizing amino acids for energy, deamination, removal of the amino group, may also occur. This results in the release of ammonia (ammonification), causing the medium to turn a purplish-blue color. III. Procedure A. Catabolism of starch 6 1. Materials per group of four: Two starch agar plates Gram s iodine Cultures of each of the following: E. coli and Bacillus subtilis 2. Streak each plate with a different species. 3. Invert and incubate at 37 C until the next lab If you are testing an unknown bacterium, be sure to incubate your starch plate for at least 4 days before adding iodine.

121 Bio260 Page 121 Mutation 4. Place a few drops of iodine onto each streak and observe the agar around the streak for blue-black color indicating the presence of undigested starch. B. Sugar Tube Fermentations Materials per group of four: 2 tubes of phenol red glucose broth 2 tubes of phenol red sucrose broth 2 tubes of phenol red lactose broth Cultures of each of the following: E. coli, Staphylococcus aureus, 2. Inoculate each tube of PR-glucose broth with one of the two species. 3. Inoculate each tube of PR-sucrose broth with one of the two species. 4. Inoculate each tube of PR-lactose broth with one of the two species 5. Incubate all species at 37 C for 48 h. Using an uninoculated tube for comparison, observe for color changes and production of gas. C. Hydrogen Sulfide Production Materials per group of 4: Cultures of Proteus vulgaris and E. coli 2 Kligler iron agar slants 1. Using an inoculating needle and the culture of P. vulgaris, penetrate the butt of a Kligler iron agar slant about halfway through the agar. Carefully withdraw the needle along the original stab line and then streak the culture across the top of the slant. 2. Repeat the procedure with E. coli. 3. Incubate E. coli and P. vulgaris at 37 C. Make observations at 48 h. (Note that in some species hydrogen sulfide production takes longer than 48h. If you were to test an unknown bacterium, you would observe again at 7 days.) D. Litmus milk reactions Materials per group of four: Cultures of E. coli, Pseudomonas aeruginosa, 2 tubes litmus milk 1. Inoculate one tube of litmus milk with E. coli. 2. Repeat procedure for Pseudomonas aeruginosa. 3. Incubate all tubes except Pseudomonas aeruginosa at 37 C for seven days. Pseudomonas aeruginosa should be incubated at 25 C Note: For use on unknown bacteria, we can also make fermentation tubes with mannitol, xylose, fructose, trehalose, sorbitol, galactose, and arabinose. Other sugars are also available in dried form; see Appendix for details. If you wish to test carbohydrate utilization in a pseudomonad, you should ask for the carbohydrate to be prepared in OF medium (pseumonads don t do fermentation). Alternatively, for Pseudomonas you can also use C.O.T. tablets (see appendix for details). 8 When testing Gram positive staphylococci for mannitol fermentation, using mannitol salt agar instead of a tube test often gives better results. See the lab Pure Culture Techniques II for instructions.

122 Bio260 Page 122 Mutation 4. Using an uninoculated control for comparison, record the results and return the tubes to the incubator.

123 Bio260 Page 123 Mutation Study Guide Pre-lab questions: 1. What chemical indicator is used to determine amylose (starch) hydrolysis? How does it reveal whether starch has been digested? 2. Amylase is a hydrolase. What does that mean (you may have to consult your text if you don t remember this from cell biology)? What is the basic function of hydrolases? What specific reaction does amylase catalyze? 3. Define the following terms: fermentation Durham tube ph indicator 4. What indicates a positive fermentation test? 5. Does the sugar tube fermentation test reveal which specific fermentation products a bacterium makes? 6. What does an alkaline reaction indicate? Why does the medium become alkaline? 7. Why is it necessary to label your sugar tubes as soon as you remove them from the rack?

124 Bio260 Page 124 Mutation 8. Of what value is deamination to a microbe? 9. What is ammonification? 10. What causes the black precipitate in a positive H 2 S test? What does it indicate about the metabolism of the organism? 11. Kligler s iron agar is a multitest medium. Explain the meaning of this statement. 12. Explain how Kligler s iron agar allows differentiation between bacteria that can ferment glucose and those that can ferment lactose. 13. Define the following terms: amino acid casein caseinase protein

125 Bio260 Page 125 Mutation peptonization proteolysis 14. What are the names of the two carbon sources found in skim milk? 15. What is the function of the litmus in litmus milk medium? 16. Explain what occurs during litmus reduction. 17. What appearance of litmus milk medium indicates the following reactions? acid production reduction proteolysis alkaline reaction 18. What is the name of the enzyme causing formation of a rennet curd?

126 Bio260 Page 126 Mutation Post-lab questions: 1. Create a data table in your lab journal and record your data. For all tests, the color seen should be recorded. In addition, for the sugar tube fermentations, use the following notation: A=acid production, AG=acid and gas production, NR=no reaction, ALK=alkaline reaction. 2. Which species of bacteria tested possess amylases? 3. Which sugars was each species of bacteria able to ferment? 5. Which species catabolized the proteins in the medium? (please be specific about which species in which medium)

127 Bio260 Page 127 Mutation MUTATION Microorganisms can be controlled by physical means, of which one is ultraviolet radiation. Ultraviolet radiation causes mutation and can lead to faulty protein synthesis. An agent such as UV radiation that causes high rates of mutation is called a mutagen. I. The effect of UV light on DNA The ultraviolet portion of the light spectrum is in the radiation range of 100 nm to 400 nm. Because of the low wavelength and low energy of UV light, the bacteriocidal rate depends on length of exposure and on the wavelength of UV used. The most bacteriocidal wavelengths lie in the 260nm to 270 nm range (Fig. 1), which is the range absorbed by nucleic acids. (These are also the wavelengths most damaging to human cells.) Figure 1. A portion of the electromagnetic spectrum, including visible and ultraviolet light. UV light is absorbed by the DNA of microorganisms and causes adjacent thymine bases on the same DNA strand to covalently bond together, forming what are called thyminethymine dimers (Fig. 2). As the DNA replicates, nucleotides do not complementary base pair with the thymine dimers and this terminates the replication of the DNA strand.

128 Bio260 Page 128 Mutation Figure 2. Creation of thymine dimers by UV light II. DNA Repair Cells have mechanisms to repair the damage caused by UV light. Enzymes called photolyases can use light energy to repair the thymine dimer. Repair can also occur through nucleotide excision repair. Enzymes called nucleases cut the DNA backbone on either side of the thymine dimer and the DNA containing the dimer is removed. DNA polymerase fills in the complementary base pairs, then DNA ligase seals the breaks in the backbone. These types of repair mechanisms do not usually lead to mutations. However, if a cell suffers large amounts of damage by UV light, it may be unable to repair all the damage. Unrepaired DNA may accumulate in the cell and trigger a response called SOS repair. In SOS repair, a protein binds to DNA polymerase allowing it to synthesize new DNA at the damaged sites. Although the DNA is replaced, the altered DNA polymerase does not have good proofreading ability and the new DNA contains many mutations. III. Uses of UV light UV lights are used in various environments to reduce the microbial population. They are used in hospital rooms to control levels of bacteria in the air, by pharmaceutical companies during product packaging, and by the food and dairy industries during food processing. One limitation to the use of UV light is that it has poor penetration, so that only microorganisms on the surface of a material that is exposed are susceptible to destruction. REMEMBER: UV light can also damage eyes, cause burns and cause mutation in cells of the skin, so take care when setting up your lab work.

129 Bio260 Page 129 Mutation IV. Procedure A. Supplies needed: 5 TSA plates Serratia marcescens broth culture Sterile swabs B. First lab period 1) Create a lawn of bacteria (Figure 3) on each TSA plate. First, use a sterile swab to streak the entire agar plate surface. Then, turn plate 90 degrees and swab again at right angles. 2) PUT ON GLASSES AND GLOVES. 3) Place first plate under the UV light at a distance of about 3. Remove lid & expose to light for 3 seconds.. Replace lid. 4) Expose 2 nd plate for 6 seconds. Replace lid 5) Expose 3 rd plate for 15 sec. Replace lid 6) Expose 4 th plate for 1 minute.. Rotate plate ¼ turn every 30 seconds to provide even irradiation. Replace lid. 7) One plate is a control and is not exposed to the UV light. 8) Incubate plates for 48h at room temp, in the dark. (Do NOT place in 35 incubator) Figure 3. Swabbing a plate to create a uniform film of bacteria. 1 st swabbing 2 nd swabbing C. Second lab period: 1) Examine the control plate that was not irradiated with UV light. This plate will be used as your standard for comparison to show how much growth of Serratia was possible in each treatment. This plate will be considered to be covered 100% by bacteria. 2) Compare your other plates to your 100% control and estimate what percentage of the plate is covered for each. In your lab journal, record the %cover found on each plate. 3) Also in your lab journal, write a brief description of the appearance of the Serratia colonies on the different plates.

130 Bio260 Page 130 Mutation Pre-lab Questions: 1) Define the following: Study Guide mutagen thymine dimer 2) Describe how both the wavelength and the length of exposure influence the bacteriocidal effect of UV light. 3) Describe specifically how UV light kills microorganisms. 4) Why is UV light only useful in controlling surface contaminants? 5) Give some examples of how UV light is used to control microorganisms. Post-lab Questions 1. Create a data table and record both the percent cover and a brief description of the colonies of Serratia on each plate. 2. Draw a graph in your lab notebook that shows survival (%cover) as a result of length of UV light exposure. Note: When making a graph, the dependent variable (what you measured) always goes on the Y axis. The independent variable (in this case = time), goes on the X axis. Also, when graphing a continuous function, like change over time, a line graph is used. Bar graphs are used when the independent variable is a non-continuous category (e.g., men vs. women). 3. Using the information from your graphs, write 1-2 sentenceds that describe the effect of duration of exposure of UV light on cultures of Serratia marcescens. 4. Explain how exposure to UV light could result in a lack of pigmentation in S. marcescens. Hint: The red pigment, prodigiosin, produced by Serratia marcescens is the product of a metabolic pathway. Each step in the pathway is catalyzed by an enzyme. Hint #2: Remember what mutation does.

131 Bio260 Page 131 Transformation TRANSFORMATION I. TRANSFORMATION Transformation occurs when cells take up naked DNA from their environment. E.g., when bacteria die and their cells lyse, they may release their DNA. Other bacteria may then take up some of the fragments and acquire new traits, or be transformed. Cells that are able to take up DNA from their surroundings are called competent. In the lab, certain cells can be induced to become competent by alternating extremes of hot and cold in a procedure termed heat-shock. Heat shocking is believed to disrupt the membrane such that large molecules, such as DNA, can enter cells. For humans, the genetic transformation of cells has many applications. Cells of crop plants have been genetically transformed with genes that confer frost or pest resistance. Bacteria have been genetically transformed with human genes so that they will make human proteins, e.g., insulin, that can be harvested for medicinal purposes. Genes that allow bacteria to digest oil or other pollutants may be genetically transformed into cells to create microbes that can help us clean up our environment. And medical researchers continue to work towards the holy grail of cures for genetic diseases gene therapy -- in which a normal, functioning gene could be put into the cells of someone who has defective genes so that the cells could function normally. In this lab, we will use a procedure to transform the common laboratory bacterium, E. coli, with a gene that codes for a green fluorescent protein (GFP). This gene was taken from a jellyfish, Aequorea victoria. If the gene is introduced into E. coli, it will acquire the ability to make this protein under certain circumstances. In the presence of UV light, the protein glows green. II. pglo The GFP gene is contained on a plasmid called the pglo plasmid (Fig. 1), which is made by Bio- Rad (a biotech company). Recall that plasmids are small extrachromosomal circles of DNA that are found in some bacteria. On the pglo plasmid, the GFP gene has been inserted into regulatory DNA normally associated with the arabinose operon in E. coli. Also on the pglo plasmid is a gene for a -lactamase (penicillinase) that confers resistance to ampicillin. Figure 1. The pglo plasmid. Arrows indicate an open reading frame (gene for polypeptide). GFP is the gene for the green fluorescent protein. bla is the gene for the -lactamase (penicillinase). arac is the gene for the repressor protein of the arabinose operon. ori is the origin

132 Bio260 Page 132 Transformation of replication. Not shown are the promoter and operator region of the arabinose operon which would be adjacent to the GFP gene. The bla gene and arac genes have their own promoters. III. Selection In order to determine which cells have been successfully transformed with pglo, we need to have a method to select for these cells. We will use positive (direct) selection which looks directly for cells that have acquired new traits. Once cells have been transformed with the pglo plasmid, they should acquire the ability to make bla, which will enable them to grow in the presence of ampicillin. Untransformed cells should not be able to grow in the presence of ampicillin. IV. Gene Regulation Because it was inserted into the regulatory DNA from the arabinose operon from E.coli, the GFP gene in transformed cells function as an inducible gene, just as if it were a normal gene found in that operon. The arabinose operon (Fig. 2) normally consists of 3 genes, arab, araa and arad, whose products are necessary for the breakdown of the sugar arabinose. These 3 genes are under the control of the arabinose promoter and operator. A separate gene, the arac gene, codes for a repressor protein that is constitutively expressed. When arabinose is not present, the arac protein binds to the operator of the arabinose operon and prevents RNA polymerase from binding to the promoter. When arabinose is present, it will act as an inducer of this operon by binding to arac and changing its conformation such that it will allow RNA polymerase to bind. Transcription and translation of arab, araa, and arad can now occur. Figure 2. The arabinose operon.

133 Bio260 Page 133 Transformation

134 Bio260 Page 134 Transformation When the pglo plasmid was designed, the genes arab, araa and arad were removed, and replaced with the gene for GFP (Fig. 3). Thus, regulation of transcription occurs as it normally would, but the gene products are different (GFP instead of arab, araa and arad). Figure 3. Expression of Green Fluorescent Protein. Another level of regulation also affects this operon. Due to the glucose effect (catabolite repression), E. coli preferentially uses glucose when it s available. If glucose is available, then cyclic AMP (camp) levels inside E.coli will be low. Because camp isn t available, the catabolite activator protein -- that s necessary to fully turn on catabolic operons like the lac operon and the ara operon -- will be inactive. Thus, RNA polymerase won t bind very successfully to the arabinose promoter and low levels of the enzymes, or GFP, will be produced. Only when glucose levels are depleted, and camp levels rise, will CAP become activated, causing high levels of transcription. V. EXPERIMENTAL DESIGN Because this activity illustrates three different phenomena selection, transformation, and gene regulation the design is fairly complex. For each experimental variable we want to test (in other words, each thing we add to our bacterial culture), we need a control population off bacteria that do not receive the experimental variable. This allows us to see the effect of the experimental variable.

135 Bio260 Page 135 Transformation In order to understand the purpose of each treatment, you should first understand the materials with which you ll be working: Luria-Bertani Agar (LB agar) an undefined medium like TSA which is useful ffor growing several types of lab rat bacteria, including E. coli Ampicillin (amp) a semisynthetic penicillin Arabinose (ara) a simple sugar (monosaccharide) pglo (DNA) the pglo plasmid glucose (glu) another monosaccharide Note that the pglo is added to the bacterial cultures, whereas the ampicillin, arabinose, and glucose are added to the agar, where they ll be available to the bacteria as they grow. In order to see the effects of transformation, you ll create two populations of bacteria: one that receives the plasmid (+DNA) and one that doesn t (-DNA). You ll also subdivide each of these populations into conditions in order to see the effects of positive selection and gene regulation. All together, there ll be a total of 5 plates: -DNA/LB -DNA/LB/amp +DNA/LB/amp +DNA/LB/amp/ara +DNA/LB/amp/ara/glu Notice that, as you move down this list of plates, one thing changes from each plate to the next. By changing only one thing at a time, you can see the effect of each variable as it s changed. This is the heart of good experimental design. (If you have a poor experimental design that changes more than one thing at a time, and you see an effect, how would you know what caused the effect?) Thus each plate and the one immediately preceding it in the list serve as an experimental plate and its control. For example, you can compare the DNA/LB plate with the DNA/OB/amp plate. The experimental variable between these two plates is the amp, or ampicillin. Thus, by comparing these two plates, you ll see the effect of ampicillin on untransformed (-DNA) E. coli. In order to fully understand this effect, we need to see the behavior of untransformed E. coli on LB (make sure it grows on this media, that the culture is alive, etc.) and then compare that behavior to the growth with the addition of the ampicillin (do they grow the same, or does ampicillin have an effect?). Continuing down the list, you could then compare the DNA/LB/amp plate with the +DNA/LB/amp plate. What is the experimental variable here? What phenomenon is this pair of plates intended to demonstrate? I will leave you to mull over these questions (and then answer them for the prelab!). VI. TRANSFORMATION EFFICIENCY The efficiency of your transformation can be calculated and compared to a known standard to determine how well your procedure worked. You can also get a sense of how efficient this process is by just comparing the relative growth on the plates of untransformed vs. transformed+selected bacteria. The untransformed plate shows you how many E. coli cells were available to be transformed, and the transformed+selected plate shows you how many actually were.

136 Bio260 Page 136 Transformation Transformation efficiency is calculated by the following formula, which represents the number of cells that were transformed (=total number of cells growing on the LB/amp/ara agar plate) divided by the amount of DNA you spread on the LB/amp/ara agar plate. The number of cells growing on the LB/amp/ara agar plate is determined by counting the number of colonies on that plate. The amount of DNA you spread on the LB/amp/ara agar plate must be calculated from your protocol (see below). Overall equation: Transformation efficiency = total # of cells growing on the LB/amp/ara plate (counted colonies) Amount of DNA spread on the LB/amp/ara agar plate (calculated, see below) Calculating the Amount of DNA spread on the LB/amp/ara agar plate: To determine the amount of DNA spread on the LB/amp/ara plate, you must take the total amount of DNA used (see A below) and multiply it by the fraction that actually got spread on the plate (see B below). (A) X (B) Amount spread on LB/amp/ara plate = (total amount of DNA used) x (fraction spread on plate) part A: Total amount of DNA used = (concentration of DNA) X (volume of DNA) The concentration of the pglo plasmid was 0.03 g/ l. The volume you used was the amount that will fill your loop, which was approximately 10 l. part B: Fraction spread on plate = Volume spread on plate total sample volume in test tube In order to determine the fraction spread on the plate, you need to review your protocol and determine the volume you spread on the plate and the total volume that was in your test tube. For the latter, add up the volumes of everything you added to your tube during the protocol. Expected range of transformation efficiency: Biotechnologists are in general agreement that the transformation protocol that you will use generally has a transformation efficiency of between 8.0 x 10 2 and 7.0 x 10 3 transformants per microgram of DNA. VII. PROCEDURE Materials per group of 4 2 plates of LB/amp 1 plate LB 1 plate LB amp/ara 1 plate LB amp/ara/glu

137 Bio260 Page 137 Transformation 2 micro test tubes 1 foam tube rack ( raft ) with tubes of transformation solution and liquid LB Plasmid DNA (1 vial shared among whole class) 1 beaker to make an ice bath Ice Sterile pipettes Plastic sterile loops Water bath at 42 C(to be shared among whole class) Procedure Follow the procedure on the Transformation Quick Guide (next two pages) with 2 exceptions: 1. You don t have to shine a UV light on the plasmid 2. Add a LB/amp/ara/glu plate to the list in step #10. Inoculate the plate with 100 l of +DNA solution and spread (just as you did for the +DNA amp/ara plate).

138 Bio260 Page 138 Transformation

139 Bio260 Page 139 Transformation

140 Bio260 Page 140 Transformation Study Guide Pre-lab questions: 1. In your own words, give a general (non-science) definition of transformation. In other words, if something experiences a transformation, what does that mean? 2. How will you able to tell whether the E. coli in our experiment were successfully transformed (i.e, list 2 characteristics that you d expect to be exhibited by transformed E. coli but not by regular E. coli). 3. Consider the 2 characteristics you listed in the previous question. If you successfully transform a population of E. coli with pglo, would it normally be possible for a single E. coli cell in that population to show one of these characteristics, but not the other? Explain your answer. 4. The arabinose operon contains genes called arab, araa, and arad. What do these genes encode? 5. If a bacterium possesses an arabinose operon, and if this bacterium is in an environment that contains lots of arabinose (but no glucose), then the arabinose operon would be (circle your choice). Turned on or Turned off 6. If a bacterium possesses an arabinose operon, and if this bacterium is in an environment that contains lots of arabinose and lots of glucose then the arabinose operon would be (circle your choice). Turned on or Turned off

141 Bio260 Page 141 Transformation 7. On the pglo plasmid, arab, araa and arad were replaced by what gene? 8. Consider the gene you named in the previous question. How would the presence of arabinose affect its expression (i.e., would arabinose turn it on or off)? 9. One of the plates in this experiment will be labeled as +DNA LB/amp/ara. a. +DNA indicates that DNA was added to.(circle the correct answer) The E. coli cells or The agar in the plate b. Amp/ara indicates that ampicillin and arabinose were added to. The E. coli cells or The agar in the plate 10. In a scientific experiment, what s the purpose of running controls? 11. Consider the plates listed below. Two of them can be considered as controls for another plate in the list. Circle the two control plates and state what they control for. Plate #1: +DNA LB/Amp/Ara Plate #2 DNA LB/Amp Plate #3 +DNA LB/Amp 12. Consider again the plates listed in the previous question. a. After running the experiment, which two plates would you compare to determine whether transformation was successful?

142 Bio260 Page 142 Transformation b. After running the experiment, which two plates would you compare to confirm the role that arabinose plays in gene expression? 13. a. Consider the E. coli cells that you will inoculate onto the +DNA LB/amp/ara plate. Would you expect every single one of these cells to be able to grow? why or why not? b. Consider the E. coli cells that you will inoculate onto the DNA LB plate. Would you expect every single one of these cells to be able to grow? Why or why not? 14. a. Consider the E. coli cells that might grow on the +DNA LB/amp/ara plate. Would you expect these cells to be able to glow? why or why not? b. Consider the E. coli cells that might grow on the +DNA LB/amp/ara/glu plate. Would you expect these cells to be able to glow? why or why not? 15. If you were to shine a UV light on the solution of plasmid DNA before it has been transformed into E. coli cells, would you expect it to glow? Why or why not? Post-lab questions: 1. Record your observations on each of your five plates. Include how much relative bacterial growth you see, the color of the colonies with and without UV light, and how many colonies are present on each plate. 2. Describe the evidence that indicates whether your attempt at performing a genetic transformation was successful or unsuccessful. Be sure you include a comparison to your control. 3. What two factors must be present in the bacteria s environment for you to see the green color of the colonies? (Hint: one factor is in the plate, and the other factor is in how you look at the

143 Bio260 Page 143 Transformation bacteria). What do you think each of these environmental factors is doing to cause the genetically transformed bacteria to turn green? 4. Compare your untransformed and unselected (-DNA LB) and transformed+selected (+DNA LB/amp) plates. From this information, how efficient is transfomation? Explain. 5. Calculate the transformation efficiency for your procedure. How did you compare to the general standard for this protocol? 6. Compare your results for your transformed plates with arabinose only (+DNA/amp/ara) and with arabinose and glucose (+DNA/amp/ara/glu). Explain why you got the results you did for these two plates.

144 Bio260 Page 144 Pathogenicity PATHOGENICITY Pathogenicity is the ability of an organism to cause disease. In order to cause disease, an organism must be able to colonize the human body, invade our tissues, block our defenses, and obtain nutrients. What is good for the invading organism is typically not good for the host, so as the organism spreads into the body, human cells, tissues, and organs are damaged, leading to the signs and symptoms of disease. Organisms successful at colonizing the human body and that cause disease while doing so are called pathogens. Some pathogens are more dangerous to the human body than others: the degree of pathogenicity of an organism is its virulence; for example, a highly virulent organism is very capable of causing disease. Scientists who study pathogens are very interested in what makes these organisms capable of causing disease. Within a single bacterial genus, there can be some species that are highly virulent and some that rarely cause human disease; sometimes, these differences in pathogenicity even occur among the strains of a single species! Related organisms have many genes in common; thus, scientists who seek to understand pathogenicity try to identify the specific genes, and their resulting proteins, that make a species virulent. The specific characteristics that enable an organism to cause disease are called virulence factors. It is the virulence factors that enable the pathogen to colonize the human body, invade tissues, block our defenses, obtain nutrients, etc. In other words, you can think of a pathogen s virulence factors as its tool kit for invading the human body. In this lab, we will examine the effects of several virulence factors known to be associated with different pathogens. I. Gelatin hydrolysis The production of the proteolytic enzyme gelatinase can often be correlated with the ability of a pathogen to break down connective tissue collagen and spread throughout the body of a host. For example, gelatinase is a virulence factor of Clostridium perfringens,the causative agent of gas gangrene in humans. The classic signs and symptoms of gas gangrene are extensive local tissue destruction, which can be followed by shock and then death. When boiled in water, collagen (which is stringy, insoluble and indigestible) changes into gelatin, a soluble mixture of polypeptides. Gelatin, when cool, exits as a solid gel, but when heated becomes a solution. Certain bacteria are able to hydrolyze gelatin by secreting gelatinase. Hydrolized gelatin is no longer able to gel, and remains liquid even when cooled to 4 C by an ice water bath. This process of rendering gelatin unable to gel is called liquefaction. Gelatin hydrolysis can thus be used to assess the pathogenicity of certain bacteria. II. Lipid Hydrolysis Lipases, enzymes that hydrolyse lipids, have been correlated with the ability of pathogens to cause disease in humans and other species, such as chickens and plants. Bacteria, such as some members of the genus Staphylococcus, which possess lipases are capable of catabolizing lipids such as fats and phospholipids, producing glycerol and fatty acids. Lipids are hydrolyzed by bacteria so that

145 Bio260 Page 145 Pathogenicity their components can be oxidized for ATP production. When lipase-producing bacteria contaminate food products (e.g., butter and grains), these bacteria hydrolyze the lipids, causing food spoilage termed rancidity. Although we do not yet know exactly how lipases contribute to pathogenicity, they might contribute to virulence by enabling the bacteria to persist in the fatty secretions of human skin. Because fatty acid production lowers ph, the inclusion of a ph indicator in a fat containing medium allows detection of lipases. Phenol red is a ph indicator that is red at a ph of 8.5 or above and yellow at a ph of less than 6.9. III. Urea Hydrolysis Like lipases, ureases have been correlated with the ability of pathogens to cause human disease. Ureases break down urea, which is a byproduct of protein catabolism in many animals. Before amino acids can be catabolized, they first must have their amine group removed by deamination. This process produces ammonia. Many animals convert the ammonia to a less toxic product called urea. The ability to produce ureases allows microbes to hydrolyze the urea, producing the end products ammonia, CO 2 and water. Several pathogens are known to produce urease during their invasion of the human body. Urease production has been correlated with successful colonization of the human stomach by the ulcercausing bacterium, Helicobacter pylori. Because one of the byproducts of urea hydrolysis is ammonia, it is thought that H. pylori uses urease to create ammonia as a buffer to the stomach acid. (Recall that ammonia is a base and binds free hydrogen ions, raising the ph of the solution.) Urease is also produced by Proteus mirabilis as it colonizes the upper urinary tract, resulting in a urinary tract infection. The urea-containing medium is a buffered solution of yeast extract and urea. It also contains phenol red as a ph indicator. When urease is produced by a bacterium in this medium, the released ammonia raises the ph. As the ph becomes higher, the phenol red changes from a yellow or orange-red color to a red or cerise (hot pink) color (ph 8.1 or more). IV. Hemolytic Reactions Pathogens that enter the blood stream can be disseminated throughout the human body. Some bacteria that enter the blood stream can lyse blood cells using enzymes called hemolysins, thus obtaining access to the iron and other nutrients provided by these cells. This may allow a bacterium to multiply inside the blood, which can lead to septicemia, shock and death. The ability of bacteria to produce hemolysins can be tested by growing them on blood agar, which is made with red blood cells. Blood agar is initially opaque, but the hemolysis of the blood cells will cause it to become translucent. Blood agar is also a useful growth media for some organisms that require the complex combination of nutrients that are found in blood. It can be used to increase, or enrich, these types of organisms from a mixed culture. (Enrichment media provide special nutrients that encourage the growth of rare organisms in a mixed culture.) A. Hemolytic Reactions

146 Bio260 Page 146 Pathogenicity One way to determine whether pathogens like Streptococcus pyogenes or normal microbiota are present in a culture is by their appearance on blood agar. Some species of bacteria are able to lyse red blood cells and use them as an energy source, which can increase their virulence. The process of lysing red blood cells is called hemolysis. The degree to which a bacterium can lyse red blood cells is distinctive and is characterized in the following manner: Alpha hemolysis: colonies are surrounded by a cloudy colorless or greenish zone of partially lysed erythrocytes Beta hemolysis: colonies are surrounded by a clear, colorless zone of completely lysed erythrocytes Gamma hemolysis: no change in the medium around the colonies. No lysis of erythrocytes occurs. Because bacteria have different hemolytic reactions, blood agar is differential as well as enriching and can be used to aid in species identification (see Table 1). Differential agars help scientists identify, or differentiate, between different species of bacteria. Hemolysis is particularly important in differentiating between species of the genus Streptococcus. B. Microbiota of the Throat Your body is home to a diverse and complex microbiota. Each area of your body has a different collection of normal residents (see Table 1 for some examples), and what is normal for one person may not be normal for another. The use of DNA sequencing to look for microbes that weren't previously cultured is vastly expanding our knowledge of the normal microbiota of the human body, and this is an area of intense, cutting-edge microbiology research. You can probably imagine that this diversity can make it challenging for medical professionals to identify which microbe might be responsible for causing signs and symptoms of disease in a patient!

147 Bio260 Page 147 Pathogenicity Table 1. Some of the most common residents of selected areas of the human body Body area Common Genera Normal Hemolytic reactions Skin Staphylococcus Candida (yeast) Beta and gamma Nasopharynx Throat Micrococci Staphylococcus Streptococcus Streptococcus Neisseria Haemophilus Gamma and alpha If beta, further screening needed Gamma and alpha If beta, further screening needed In order to identify a potential pathogen, the various microbes living in an area of the body must first be separated from each other. Then the characteristics of the organisms can be examined and compared to determine whether pathogenic microbes appear to be present, and whether those microbes exhibit characteristics associated with the normal microbiota of that area, or with a pathogen known to cause a particular syndrome the patient is exhibiting. An organism that is normal in one part of the body may be a potential pathogen if introduced into a different part of the body. E. coli is a normal inhabitant of your intestines, but if it gets into your urinary tract, it can cause a urinary tract infection. Likewise, Staphylococcus aureus, which exhibits beta hemolysis, is considered a normal resident of your skin, but can cause life-threatening infections if introduced into the body during a surgery. S. aureus can also occupy a sort of middle ground: about 30% of people carry S. aureus in their nasopharynx. These "staph carriers" are healthy, but do have the potential to transmit S. aureus to other people. In some cases, a staph carrier could carry MRSA, a strain of S. aureus that's resistant to many antibiotics, including methicillin. Thus, a beta-hemolytic reaction from microbes on your skin is considered perfectly normal, but if you observe a beta-hemolytic reaction from microbes from your nasopharynx or throat, you might want to do additional tests to determine if you're a staph carrier.

148 Bio260 Page 148 Pathogenicity Table 2. Hemolytic Reactions of Common Throat Bacteria Species Hemolytic Reaction Notes Streptococcus Catalase-negative S. mitus Alpha Normal throat microbiota, may cause bacterial endocarditis S. pneumoniae Alpha Normal throat microbiota, may invade lungs and circulatory system to cause middle ear infections, meningitis and pneumonia S. pyogenes Beta Pathogenic. Strep throat, impetigo, scarlet fever, necrotizing fasciitis (Normal resident of about 5-15% of people) S. salivarius gamma Normal mouth microbiota. beta non-pathogenic Lactococcus lactis Staphylococcus S. aureus S. epidermidis beta gamma Catalase-positive Potential pathogen. Various serious infections, toxic shock syndrome. (normal resident of nasopharynx in about 30% of people, may also colonize throat) Non-pathogenic. One type of culture you're probably familiar with is the throat culture: if you've ever had the signs and symptoms of "strep throat," (soreness, redness, and possible pockets of pus in the throat ) then you've probably had your throat swabbed. The swab is used to take a sample of the microbes in your throat and then culture those microbes on blood agar in order to look for evidence of ß- hemolysis, which is one of the characteristics of Streptococcus pyogenes (Group A Streptococcus), the pathogen that causes strep throat. For rapid ID, the swab is also rubbed against a card that is loaded with antibodies against the most common strain of S. pyogenes. If this strain of S. pyogenes is present, the antibodies will stick to the bacteria from the swab, causing a chemical reaction that turns the card blue. If a blue color doesn't appear, however, the blood agar plate is still necessary to check for the less common strains of the pathogen.

149 Bio260 Page 149 Pathogenicity Table 2. Morphological characteristics of common throat bacteria 9 Genus Growth on Blood Agar? Colony Characteristics Gram Stain and Arrangement Streptococcus and Lactococcus Yes Small (less than 1mm) and translucent to opaque Gram + cocci, chains Staphylococcus aureus Neisseria and Branhamella Haemophilus Corynebacterium Yes No (require nutrients from lysed blood cells, can't lyse on own) Depends on species Yes Large colonies (greater than 2mm when well isolated), golden or creamy Intermediate (between 1-2 mm), creamy or light yellow (N. subflava), grey-white and wrinkles (N. sicca), shiny and translucent (B. catarrhalis) Small, translucent Intermediate (1-3 mm), pale yellow to tan, rough or smooth, opaque Gram + cocci, clusters Gram cocci Gram rods Gram + rods, often irregular To give you a peek into the diversity of your own microbiota, and the challenge of recognizing potential pathogens, you're going to do a throat swab on yourself or a lab partner. (If anyone absolutely hates throat swabs, they can do a nasal swab instead.) You will use the streak plate method to separate the microbes of your throat, and then observe them for their hemolytic reactions (Table 2) and colony appearance (Table 3). V. Coagulase The enzyme coagulase can initiate the clotting cascade in the blood, causing soluble fibrinogen to convert to insoluble fibrin. It is an important virulence factor in several species of staphylococci, where it is thought to help those bacteria evade detection by the immune system by allowing them to hide from phagocytes under clots of fibrin. Because fibrin is a host molecule, the phagocytes do not recognize it as foreign, thus enabling the staphylococci to evade detection. Two methods are used to detect the enzyme coagulase: the slide test, which detects coagulase that is bound to the bacterial cells (sometimes referred to as clumping factor ) and the tube test, which detects coagulase that has been released from the bacterial cells into the surrounding medium. The slide test involves mixing bacteria with disks that contain rabbit plasma: if bound coagulase is present on the surface of the bacterial cells, the plasma should agglutinate, or clump. Ninety-nine 1. 9 If you have no symptoms of disease (like a sore throat), then whatever organisms are growing in your throat are probably your normal microbiota and nothing to worry about. The only time I d be concerned is if you do have a sore throat, and you grow beta-hemolytic Streptococcus (small, grayish or white colonies) that are negative for catalase. If you do have a sore throat, and you culture beta-hemolytic Strep, then I d recommend getting swabbed at a doctor s office.

150 Bio260 Page 150 Pathogenicity percent of strains of Staphylococcus aureus produce both forms of coagulase; thus the slide test is useful for this species. However, a negative reaction in a slide test should be confirmed by the tube method since occasional strains fail to produce the bound coagulase. The tube test for coagulase is available in our lab. However, since the test takes 4 hours to complete, we won t perform it as a group. If you want to test your unknown bacterium for this enzyme, please see the protocol section for instructions. VI. Procedure A. Gelatin hydrolysis Materials per group of 4: Slant cultures of Bacillus subtilis and Escherichia coli. 2 tubes of nutrient gelatin deeps Using your straight inoculating needle, pick up a small amount of growth from a culture. 2. Aseptically insert the needle straight down the middle of the gelatin and withdraw it again in one motion. Caution: do not let the tip of the handle touch the surface of the medium. 3. Repeat for the other stock cultures. 4. Incubate all species at room temperature for seven days. 5. Cool tubes for five minutes in ice water. 6. Using an uninoculated tube as a control, observe cultures for growth and presence or absence of liquefaction. (Note that in some species, gelatin liquefaction takes longer than 7 days. If you were to test an unknown bacterium, you would observe tubes weekly for 3-4 weeks. Also, strictly aerobic bacteria may not hydrolyze gelatin in a gelatin deep. For these bacteria, it is preferable to use the film method see Appendix for details.) B. Lipid hydrolysis 1. Materials per group of four: Two phenol red lipase plates, or one split plate of phenol red lipase Cultures of each of the following: E. coli and Staphylococcus 2. Label the plates. 3. Streak each plate or section with a different species. 4. Invert and incubate at 37 C until the next lab. 5. Observe agar for color changes. C. Urea hydrolysis Materials per group of four: Cultures of Proteus vulgaris and E. coli. 2 tubes of urea agar 1. Stab and streak one tube of urea agar with Proteus vulgaris For aerobic bacteria, or in order to receive results more quickly, a gelatin strip test is recommended as an alternative to the gelatin deep. See the protocol section for more details.

151 Bio260 Page 151 Pathogenicity 2. Repeat procedure for E. coli. 3. Incubate all tubes at 37 C for 24 to 48h (or until the next lab period). (Note that if you were testing an unknown bacterium, you would observe again at 7 days.) 4. Observe tubes and record results. Use an uninoculated tube for comparison. 5. Return control tube to supply rack. D. Hemolytic Reactions Materials per group: Procedure: 2 blood agar plates per group Cultures of Staphylococcus aureus and Staphylococcus epidermidis Use the streak plate method to inoculate each species of Staphylococcus onto a separate blood agar plate. Incubate in candle jar at 37 C for 48h then transfer to the refrigerator (5 C) until the next lab period. Observe and describe colony morphology and hemolytic reactions. E. Microbiota of the Throat Materials 1 blood agar plate per person (e.g., = 6 total for a 4-person group) Sterile swab Tongue depressor Procedure: 1. Swab your own throat or a lab partner s throat and streak a plate according the following procedure: a. Ask the person to be swabbed to open their mouth. b. Use a tongue depressor to press the tongue downward toward the floor of the mouth. c. Insert a sterile swab in the pharynx as far back as possible and roll it gently over the tonsil area. The area to be swabbed is between the golden arches (glossopalatine arches, see Fig. 1). Do not hit the tongue or the sides of the mouth. d. Roll the swab in one area of the blood agar plate near the rim e. Use your loop to streak for isolation from your original swab line. (T-streak beginning with the original swab line, Fig. 2.) 2. Incubate all plates in a candle jar at 37 C for 48 h, then transfer to the refrigerator (5 C) until the next lab period. 3. Observe and describe colony morphology and hemolytic reactions.

152 Bio260 Page 152 Pathogenicity Figure 1. Performing a throat swab. swab line Figure 2. T-streaking from a swab line.

153 Bio260 Page 153 Pathogenicity Pre-lab questions: 1. Define the following: Virulence factor Study Guide Pathogenicity 2. If a species liquifies gelatin, what does that tell you about the species? Why? 3. What is produced by the action of lipase? How is this reaction observed in the lipase test? 4. What is produced by the action of urease? How is this detected by the urease test? 5. Describe the difference between alpha, beta, and gamma hemolysis. 6. Explain why blood agar is considered to be both enriching and differential. Your answer should include an explanation of both terms. 7. How does coagulase function? What makes it a virulence factor? Post lab questions:

154 Bio260 Page 154 Pathogenicity 1. Create a data table in your lab journal and record your data for your gelatin deeps. For each species, indicate whether there was growth and the amount of liquefaction, if any. For each species indicate whether the species possesses gelatinase and how you could tell 2. Record your data for the lipase test. Which species of bacteria tested possess lipases? How could you tell? 3. Record data (color) for urea hydrolysis in your lab journal. Indicate which species possess urease and how you could tell. 4. Describe the appearance of the colonies of the two species Staphylococcus grown on blood agar, including a description of the amount of clearing of the blood. Based upon this observation, state your conclusion regarding the type of hemolysis performed by each species. 5. Describe the appearance of the colonies that grew from the swab of your throat. Use their appearance (Table 3) and hemolytic reactions (Table 2) to speculate on the possible identities of these organisms. Based on your results, do you think your cultured just normal microbiota, or could you have some potential pathogens? Explain, using evidence from your results to support your reasoning. 6. Staphylococcus aureus is a successful human pathogen that can colonize many different environments in the body, causing a wide array of diseases from localized infections (abscesses), skin rashes, food poisoning, septicemia and toxic shock. Propose an explanation for why S. aureus is such a successful pathogen. In your answer, include support from the data you gathered during this lab.

155 Bio260 Page 155 Pathogenicity 7.

156 Biol260 P a g e 156 Epidemiology EPIDEMIOLOGY 11 Epidemiology is the science of tracking and controlling disease. Some of the key factors of interest to epidemiologists are the etiologic (causative) agent of the disease, the reservoir of the disease, and the mode of transmission of the disease. For infectious disease, the etiologic agent is the infectious agent; often, this is a virus or a bacterium. The reservoir of the disease is the place where the disease exists in nature; this could be a place in the environment, a non-human animal, or the human population. The mode of transmission is how the disease is passed from the reservoir to humans. By identifying these factors, epidemiologists can make recommendations for the control of disease. When epidemiologists become aware that an epidemic is occurring in other words, the number of cases of a disease has risen above the normal or expected levels they seek to track down the causes of the epidemic so they can stop its progress. They may conduct interviews with patients to determine what risk factors are associated with the disease eating at a particular restaurant, coming into contact with unusual animals, traveling to another country, having unprotected sex, etc. Epidemiologists may also take environmental samples and attempt to match microbes in the samples to those infecting people. Some epidemics, called point source (or common source) epidemics, result when a group of people are all infected at the same time, for example at a picnic. During point source epidemics, the number of affected people rises rapidly then decreases to zero (Figure 1). If the disease can be transmitted from person to person, a propagated (or host-to-host) epidemic may result (Figure 1). During propagated epidemics, one person or a small number of people are initially infected and then they pass it on to others, so that the numbers of affected people rises more slowly and may continue for long periods of time. AIDS, for example, is a propagated epidemic that probably started in early 20 th century. Epidemiologists can sometimes track a propagated epidemic all the way back to the original person who was infected, called the index case. In order for epidemiologists to track infectious diseases, they must be able to identify the infectious agent that causes the disease. The process of identifying bacteria used to rely solely upon classical bacteriological techniques like staining and metabolic characteristics. Increasingly, however, epidemiologists and other professionals are turning to molecular methods of identification that target specific molecules of bacteria. Molecular methods are rapid and highly specific, and can identify specific strains of bacteria known to be pathogenic (for example, molecular methods can distinguish E. coli O157:H7 from other strains of E. coli). Molecular methods are also very useful for the identification of viruses, which cannot be grown outside the host cell. Molecular methods may involve sequencing of DNA molecules or the recognition of specific molecules, called antigens, in the pathogen. Because there is a highly specific relationship between antibodies and antigens, antibodies are very useful for the identification of pathogens This lab was adapted from the Biotechnology Explorer: ELISA Immuno Explorer Kit Instruction Manual. BioRad.

157 Bio260 Page 157 Epidemiology Figure 1: Point source vs. Propagated Epidemic. Serology Antibodies are defensive proteins made by the human immune system. They seek out and bind very specifically to foreign antigens, marking these antigens for destruction by the immune system. In the lab, antibodies to a known antigen can be combined with samples that may contain the antigen: if the antigen is present, the antibodies will bind to it, telling the researcher that the target antigen is present in the sample. This is like going fishing for a very specific kind of fish: if you had a fish hook that could only catch the one specific kind of fish that you were after, and you went fishing in a river and caught a fish, you would automatically know that the fish was the specific one you were after. In order to go fishing for certain antigens in a sample, you need to have very specific fish hooks (antibodies) you need to catch them. These antibodies can be obtained from serum, the fluid portion of the blood. In order to generate the specific fish hooks (antibodies) needed for the lab, scientists inject samples of the known fish (antigen) into a non-human animal, allow the animal to have an immune response, and then obtain antibody-containing serum from the animal. The antibodies are purified from the serum and then sold or given to researchers who need them. When researchers go fishing in the lab, the antibody-antigen reaction (binding) can be visualized in a number of ways: by clumping, as in a blood test, by fluorescence, or by a color change. We will use a test called an ELISA (enzyme-linked immunosorbent assay) that gives a color change when antigen is detected, much like that of a home-pregnancy test. A. ELISA You are about to perform an experiment in which you will share simulated "body fluids" with your classmates. After sharing, you will perform an enzyme-linked immunosorbent assay or ELISA

158 Bio260 Page 158 Epidemiology to determine if you have been exposed to a contagious "disease". The ELISA uses antibodies to detect the presence of a disease agent, (for example, viruses, bacteria, or parasites) in your blood or other body fluid. You will then track the disease back to its source. When you are exposed to a disease agent, your body mounts an immune response. Molecules that cause your body to mount an immune response are called antigens, and may include components of infectious agents like bacteria, viruses, and fungi. Within days, millions of antibodies - proteins that recognize the antigen and bind very tightly to it - are circulating in your bloodstream. Like magic bullets, antibodies seek out and attach themselves to their target antigens, flagging the invaders for destruction by other cells of the immune system. Over 100 years ago, biologists found that animals' immune systems respond to invasion by "foreign entities", or antigens. Today, antibodies have become vital scientific tools, used in biotechnology research and to diagnose and treat disease. The number of different antibodies circulating s cin the blood has been estimated to be between 10 6 and 10 11, so there is usually an antibody ready to deal with any antigen. In fact, antibodies make up to 15% of your total blood serum protein. Antibodies are proteins called immunoglobins (Ig). The body makes several different types of antibodies (e.g., IgG, IgM), but each individual antibodies is very specific; each antibody recognizes only a single antigen (Fig. 1). Figure 2. Antigen-antibody reaction. A) Structure of IgG bound to the HIV capsid protein p24 as determined by X-ray crystallography (Harris et al., 1998, Momany et al. 1996). These structures can be downloaded from the Protein Data Bank ( Berman et al. 2000) using the PDB identification codes 1IGY and 1AFV and manipulated using free online software such as Rasmol and Protein Explorer. B) A commonly used representation of an antibody bound to an antigen. B. How Are Antibodies Made and Used? As mentioned above, scientists have learned to use the immune response of animals to make antibodies that can be used as tools to detect and diagnose diseases. The study of the immune system is called "immunology". Animals such as chickens, goats, rabbits, and sheep can be injected with an antigen and, after a period of time, their serum will contain antibodies that specifically recognize that antigen. If the antigen was a disease agent, the antibodies can be used to

159 Bio260 Page 159 Epidemiology develop diagnostic tests for the disease. In an immunoassay, the antibodies used to recognize antigens like disease agents are called primary antibodies; primary antibodies confer specificity to the assay. Other kinds of antibody tools, called secondary antibodies, are made in the same way. In an immunoassay, secondary antibodies recognize and bind to the primary antibodies, which are antibodies from another species. Secondary antibodies are prepared by injecting antibodies made in one species into another species. It turns out that antibodies from different species are different enough from each other that they will be recognized as foreign proteins and provoke an immune response. For example, to make a secondary antibody that will recognize a human primary antibody, human antibodies can be injected into an animal like a rabbit. After the rabbit mounts an immune response, the rabbit serum will contain antibodies that recognize and bind to human antibodies. In order to provide a visible color reaction, the secondary antibodies used in this experiment are conjugated (bound) to the enzyme horseradish peroxidase (HRP) which produces a blue color in the presence of its substrate, TMB. These antibody and enzyme tools are the basis for the ELISA. C. How is ELISA Used in the Real World? With its rapid test results, the ELISA has had a major impact on many aspects of medicine and agriculture. ELISA is used for such diverse purposes as pregnancy tests, disease detection in people, animals, and plants, detecting illegal drug use, testing indoor air quality, and determining if food is labeled accurately. For new and emerging diseases like severe acute respiratory syndrome (SARS), one of the highest priorities of the US Centers for Disease Control (CDC) and the World Health Organization (WHO) has been to develop an ELISA that can quickly and easily verify whether patients have been exposed to the virus. Some tests give positive or negative results in a matter of minutes. For example, home pregnancy dipstick tests are based on very similar principles to ELISA. They detect levels of human chorionic gonadotropin (hcg), a hormone that appears in the blood and urine of pregnant women within days of fertilization. The wick area of the dipstick is coated with anti-hcg antibody labeled with a pink compound (step 1). When the strip is dipped in urine, if hcg is present it will bind to the pink antibody, and the pink hcg-antibody complex will migrate up the strip via capillary action (step 2). When the pink complex reaches the first test zone, a narrow strip containing an unlabeled fixed anti-hcg antibody, the complex will bind and concentrate there, making a pink stripe (step 3). The dipsticks have a built-in control zone containing an unlabeled fixed secondary antibody that binds unbound pink complex (present in both positive and negative results) in the second stripe (step 4). Thus, every valid test will give a second pink stripe, but only a positive pregnancy test will give

160 Bio260 Page 160 Epidemiology two pink stripes. D. Why Do We Need Controls? Positive and negative controls are critical to any diagnostic test. Control samples are necessary to be sure your ELISA is working correctly. A positive control is a sample known to be positive for the disease agent, and a negative control is a sample that does not contain the disease agent. E. Overview of This Lab You will be provided the tools and an experimental protocol to perform an ELISA. You will be given a simulated "body fluid" sample that you will share with your classmates. One or two of the samples in the class have been "infected". You will also be provided with positive and negative control samples. Then you and your fellow students will assay your samples for the presence of the "disease agent" to track the spread of the disease through your class population. The type of ELISA you will do is called an indirect ELISA. In an indirect ELISA, primary antibody is used to bind to the antigens in the patient sample. Then, secondary antibody that recognizes the primary antibody is used to bind to the primary antibodies. For example, if you were screening for HIV, your primary antibody would recognize HIV antigens. If the primary antibody was made in mice, it would be mouse anti-hiv antibody. Then the secondary antibody, which might be made in goats, would recognize mouse antibodies. The secondary antibody has the attached enzyme that generates the visible color when the test is complete. The advantage of indirect ELISAs is that they re very sensitive. If only a small amount of antigen is present and you only used primary antibody, you might not see the color signal. But by using the secondary antibodies, the secondary antibodies can cluster onto the primary antibodies, bumping up the numbers and leading to a deeper color. To give you a general idea of how the lab works, an overview of the procedure is shown in Figure 3 below. The detailed procedure that you should follow when performing the lab follows later in the lab (in the section "Procedure").

161 Bio260 Page 161 Epidemiology Figure 4. Overview of this lab.

162 Bio260 Page 162 Epidemiology Disease scenario Poof! You re back in high school! You re sexually active, but not promiscuous. Over the past 18 months, you ve had three different sexual partners. A rumor starts going around school that a girl you know has genital warts, which is caused by human papilloma virus (HPV). You wonder how the girl got genital warts and whether you could get it too. If you re a girl, you re also worried because you ve heard that genital warts is linked to increased risk of cervical cancer and you didn t get vaccinated against the virus. Name of pathogen Type of organism Infectious agent Method of spread Incubation Symptoms Human Papilloma Virus (HPV) Virus Virus HPV is passed on through genital contact, most often during vaginal and anal sex. HPV may also be passed on during oral sex and genital-to-genital contact. HPV can be passed on between straight and same-sex partners even when the infected partner has no signs or symptoms. (source: The time from infection until you have any signs (e.g. a wart or abnormal Pap smear) is both long and variable. It may be anywhere from a few weeks to more than 1 year. In addition, any changes that do occur may not be noticed for additional months or years. Thus, it is often extremely difficult or impossible to figure out who infected whom. (source: Most people with HPV do not develop symptoms or health problems from it. In 90% of cases, the body s immune system clears HPV naturally within two years. But sometimes, certain types of HPV can cause genital warts in males and females. Rarely, these types can also cause warts in the throat -- a condition called recurrent respiratory papillomatosis or RRP. Other HPV types can cause cervical cancer. These types can also cause other, less common but serious cancers, including cancers of the vulva, vagina, penis, anus, and head and neck (tongue, tonsils and throat). Diagnosis The types of HPV that can cause genital warts are not the same as the types that can cause cancer. There is no way to know which people who get HPV will go on to develop cancer or other health problems. (source: In Women - Diagnosed either by a Pap test which suggests HPV and is then confirmed by a second test, or by the presence of visible warts. In Men - May only be diagnosed if warts can be seen. A vinegar solution is sometimes applied to the skin to help visualize flat warts.

163 Bio260 Page 163 Epidemiology Treatment Source: Most people "cure" themselves - usually without ever knowing that they were infected. This would be the usual treatment for those women found to have HPV on routine testing or with mildly abnormal Pap smears. There are several treatment options for treating HPV/warts. These range from prescription creams (effective but expensive), to burning the warts with acid or by laser, freezing them with liquid nitrogen, or surgical removal. Treatment by any of theses means often, but not always, leads to a cure. Except for laser and surgical therapy, all of these treatment options are available at RHS. Prevalence Some women will need to go for a test called colposcopy to take a better look at the cervix. During this test, treatment to the cervix is often done. Source: HPV (the virus). Approximately 20 million Americans are currently infected with HPV. Another 6 million people become newly infected each year. HPV is so common that at least 50% of sexually active men and women get it at some point in their lives. Genital warts. About 1% of sexually active adults in the U.S. have genital warts at any one time. Cervical cancer. Each year, about 12,000 women get cervical cancer in the U.S. Other cancers that can be caused by HPV are less common than cervical cancer. Each year in the U.S., there are about: 3,700 women who get vulvar cancer 1,000 women who get vaginal cancer 1,000 men who get penile cancer 2,700 women and 1,700 men who get anal cancer 2,300 women and 9,000 men who get head and neck cancers. [Note: although HPV is associated with some of head and neck cancers, most of these cancers are related to smoking and heavy drinking.] Certain populations are at higher risk for some HPV-related health problems. This includes gay and bisexual men, and people with weak immune systems (including those who have HIV/AIDS).

164 Bio260 Page 164 Epidemiology RRP is very rare. It is estimated that less than 2,000 children get RRP every year in the U.S. Source: Prevention There are several ways that people can lower their chances of getting HPV: Vaccines can protect males and females against some of the most common types of HPV. These vaccines are given in three shots. It is important to get all three doses to get the best protection. The vaccines are most effective when given before a person's first sexual contact, when he or she could be exposed to HPV. o o Girls and women: Two vaccines (Cervarix and Gardasil) are available to protect females against the types of HPV that cause most cervical cancers. One of these vaccines (Gardasil) also protects against most genital warts. Both vaccines are recommended for 11 and 12 year-old girls, and for females 13 through 26 years of age, who did not get any or all of the shots when they were younger. These vaccines can also be given to girls as young as 9 years of age. It is recommended that females get the same vaccine brand for all three doses, whenever possible. Boys and men: One available vaccine (Gardasil) protects males against most genital warts. This vaccine is available for boys and men, 9 through 26 years of age. For those who choose to be sexually active, condoms may lower the risk of HPV. To be most effective, they should be used with every sex act, from start to finish. Condoms may also lower the risk of developing HPV-related diseases, such as genital warts and cervical cancer. But HPV can infect areas that are not covered by a condom - so condoms may not fully protect against HPV. Source:

165 Bio260 Page 165 Epidemiology I am a researcher who is developing a new serological test for HPV. We re going to test my new HPV ELISA on you and your group of high school friends. Your task is to perform an ELISA to determine the spread of HPV within your circle of high school friends, so that prevention methods can be enacted to stop the spread of this virus. To determine which students have been exposed, perform an ELISA to detect the HPV virus in samples of their body fluid. Procedure A. Materials per group of 4 Items Contents Number What your samples are simulating: Yellow tubes Student samples (0.75 ml) 4 (1 per student) Sample derived from patient s genital secretions Violet tube (+) Positive control (0.5 1 Heat-inactivated viral antigen ml) Blue tube (-) Negative control (0.5 1 HPV-negative human sample ml) Green tube (PA) Primary antibody (1.5 ml) 1 Anti-HPV-CoV antibody from mouse Orange tube (SA) Secondary antibody (1.5 ml) 1 Anti-mouse immunoglobin antibody conjugated to HRP Brown tube (SUB) Enzyme substrate (1.5 1 ml) 12-well microplate 2 strips 50 l fixed-volume 1 micropipette or l adjustable micropipette Yellow tips Disposable plastic 5 transfer pipets ml wash buffer in Phosphate buffered 1 beaker saline with 0.05% Tween 20 Large stack of paper 2 towels Black marking pen 1

166 Bio260 Page 166 Epidemiology B. Part 1. Share body fluids: recreate your sexual history over the past 18 months by sharing with 3 partners. It s very important that we all do this together (no pun intended), so wait for your instructor to cue each sharing event. 1. Label a yellow tube with your initials. This is your "body fluid" sample that will be shared randomly with your classmates. 2. Label a plastic transfer pipet with your initials; you will use this to mix your sample with your fellow students. 3. When you are told to do so, for each sharing event, you ll find another student and use a pipet to transfer all 750 l of your sample into the tube of the other student (Figure 5). (It doesn't matter whose tube is used to mix both samples.) Gently mix the samples by pipetting the mixture up and down. Then take back half of the shared sample (about 750 l) to your own tube. Write down the name of that student next to "Sharing Partner #1" on the data table below. 4. When told to do so, repeat the sharing protocol two more times with 2 other students so that you have shared your sample with 3 other students total (Fig. 6). Make sure that you record their names in the order in which you shared. Discard your transfer pipets after this step. You may proceed directly to the next step or store your samples overnight at 4 C, as directed by your instructor. Sharing Partner #1 Sharing Partner #2 Sharing Partner #3 Student C Student D

167 Bio260 Page 167 Epidemiology Figure 6. Sharing body fluids. C. Part 2. Perform ELISA: Detection of infected students 1. Label the outside wall of each well of your 12-well strip. Two students may share a strip of 12 wells. On each strip, label the first three wells with a "+" for the positive controls and the next three wells with a "-" for the negative controls. On the remaining wells write your and your partner's initials. For example, Florence Nightingale and Alexander Fleming would label their shared strip like this (Figure 7): Figure 7. Labeling your wells 2. Bind the antigen to the wells: a. Use a pipet to transfer 50 l of the positive control (+) from the violet tube into the three "+" wells. b. Use a fresh pipet tip to transfer 50 l of the negative control (-) from the blue tube into the three "-" wells. c. Use a fresh pipet tip for each sample and transfer 50 l of each of your team's samples into the appropriately initialed three wells. Figure 8. Adding sample to the wells 3. Wait 5 minutes while all the proteins in the samples bind to the plastic wells. 4. Wash the unbound sample out of the wells: a. Tip the microplate strip upside down onto the paper towels so that the samples drain out, then gently tap the strip a few times upside down on the paper towels. Make sure to avoid samples splashing back into wells.

168 Bio260 Page 168 Epidemiology Figure 9. Emptying the wells. b. Discard the paper towel. c. Use a fresh transfer pipet filled with wash buffer from the beaker to fill each well with wash buffer taking care not to spill over into neighboring wells. The same transfer pipet will be used for all washing steps. Figure 10. Adding wash buffer d. Tip the microplate strip upside down onto the paper towels so that the wash buffer drains out, then gently tap the strip a few times upside down on the paper towels. Figure 10. Emptying the wells. e. Discard the top 2-3 paper towels. 5. Repeat wash step Use a fresh pipet tip to transfer 50 l of primary antibody (PA) from the green tube into all 12 wells of the microplate strip.

169 Bio260 Page 169 Epidemiology Figure 11. Adding primary antibody. 7. Wait 5 minutes for the primary antibody to bind. 8. Wash the unbound primary antibody out of the wells by repeating wash step 4 two times. Figure 12. Washing out unbound antibody. 9. Use a fresh pipet tip to transfer 50 l of secondary antibody (SA) from the orange tube into all 12 wells of the microplate strip. Figure 13. Adding secondary antibody. 10. Wait 5 minutes for the secondary antibody to bind. 11. Wash the unbound secondary antibody out of the wells by repeating wash step 4 three times.

170 Bio260 Page 170 Epidemiology Figure 14. Washing out unbound antibody. The secondary antibody is attached to an enzyme (HRP) that chemically changes the enzyme substrate, turning it from a colorless solution to a blue solution. Predict which wells of your experiment should turn blue and which should remain colorless and which wells you are not sure about. Write down your prediction in your lab manual. 12. Use a fresh pipet tip to transfer 50 l of enzyme substrate (SUB) from the brown tube into all 12 wells of the micropipette strip. Figure 15. Adding substrate. 13. Wait 5 minutes. Observe and record your results in your lab notebook. 14. To figure out the probable index case, the class will follow the following procedure: a. Anyone who tested positive will stand up. b. People who tested positive will look for their sharing partners. If one of their sharing partners tested negative, then the positive person will sit down. c. The people who are still standing at the end are the most probable index case.

171 Bio260 Page 171 Epidemiology 15. Record the class data in the table below. Number of people in class: Number of people infected: % of class infected: Names of people who were most probably the index case: 16: (optional) To map the spread of HPV through the class, write the names of the index cases on the board. Draw a line between them in one color ink. Then using a second color, draw a map showing transmission during the second round (index cases to their 2 nd partners). Use a 3 rd color ink to show transmission during the third round (everyone from round 2 to their partners in round 3). Copy this map into your lab notebook.

172 Bio260 Page 172 Epidemiology Pre-lab questions 1. How do antibodies protect us from disease? Study Guide 2. Why is rapid detection of disease exposure important? 3. What is the function of the primary antibody in an ELISA? 4. What is the function of the secondary antibody in an ELISA? 5. What is the function of the enzyme in an ELISA? 6. Why do you need to assay positive and negative control samples as well as your experimental sample?

173 Bio260 Page 173 Epidemiology 7. What antibody-based tests can you buy at your local pharmacy? 8. What is our current understanding of the etiologic agent, reservoir, and mode of transmission HPV? 9. What type of epidemic is represented by our high school scenario? Explain. 10. Could you identify the causative agent of HPV using the classical techniques that we commonly use in our lab? Why or why not? Post-lab questions 1. Create a data table in your lab notebook that represents all 12 of your wells (use the same labels that you wrote on the wells). Record the colors for each well (blue vs. no change), then indicate if the wells were + (blue) or - (no change). 2. Indicate whether you were infected with the disease and how you can tell. (Include comparison to controls.)

174 Bio260 Page 174 Epidemiology 3. Which students in were the index case? How could you tell? 4. Why did you need to wash the wells after every step of the ELISA? What would happen if you forgot to wash? 5. If a student tested positive for disease exposure, but did not have direct contact with one of the original infected students, what conclusions could you reach about the transmissibility of this disease in the population? Explain. 6. If your sample gave a negative result for a disease-causing agent in a real disease outbreak, would this definitely mean you did not have the disease? What reasons could there be for a negative result when you actually do have a disease? 7. Read the short article High School Romances Untangled that follows this lab. Based on the data in the article and what you ve learned in this lab, what recommendations would you make for the control of HPV in high school populations?:

175 Bio260 Page 175 Epidemiology High-school romances untangled Relationships linked in surprisingly long chains American Journal of Sociology By Robert Roy Britt Senior writer Updated: 5:32 p.m. ET Jan. 24, 2005 Accessed from on 8/6/10 In this chart, pink circles (light) represent female students at a high school, and blue circles (dark) represent male students. Connecting lines show romantic relationships in the six months preceding interviews. In addition to this network, there were about 100 other interconnections, with 63 of those between two students who were not romantically linked to anyone else. A study of sexual and romantic relations at a high school found students connected by long chains, rather than in a tight network with a core group of a promiscuous few. Sharing of partners was rare, but many students were indirectly linked through one partner to another and another. The unexpected result could help shape strategies for combating sexually transmitted diseases among young people. "We went into this study believing we would find a core model, with a small group of people who are sexually active," said James Moody, a professor of sociology at Ohio State University. "We were surprised to find a very different kind of network."

176 Bio260 Page 176 Epidemiology A virtually unknowable chain In the most striking chain, 52 percent of the romantically involved students were connected in a manner of student A having relations with B, and B having relations with C, and so on down the line over the 18 months of the study. Students couldn't possibly know of all the connections, the scientists conclude. "Many of the students only had one partner," Moody said. "They certainly weren t being promiscuous. But they couldn t see all the way down the chain." The study was detailed in a recent issue of the American Journal of Sociology. Peter Bearman of Columbia University and Katherine Stovel of the University of Washington participated in the research. The work was based on the National Longitudinal Study of Adolescent Health, a 1995 survey of students at an unidentified Midwestern high school. The students were mostly white, in the only public school in a mid-sized city more than an hour away from a metropolis. Complex rules for teen dating Of about 1,000 students at the school, 832 were interviewed and asked to identify their sexual and romantic partners over the previous 18 months. Just more than half reported having sexual intercourse, a rate comparable to the national average, the researchers say. Of all the pairings, 63 involved two students who had not partnered with anyone else. The research reveals a semantically complex rule that seems to guide adolescent sexual conduct. Here goes: A girl is loath to date her old boyfriend's new girlfriend's old boyfriend. Adults don't generally adhere to any similar rule, so core populations of sexually active adults tend to be prime spreaders of disease. But with adolescents, the study suggests, "there aren t any hubs to target, so you have to focus on broad-based interventions," Moody said.

177 Bio260 Page 177 Epidemiology

178 Bio260 Page 178 Water Safety THE SAFETY OF WATER SUPPLIES The safety of urban and suburban water supplies is generally achieved through chlorination or filtration. These treatments effectively kill or remove most disease-causing bacteria and protists. However, water treatment barriers against contamination may not exist for well water, recreational waters such as lakes and streams, and water from which shellfish are harvested. Because transmission of microbial diseases may occur via these sources (Table 1), they must be monitored for the presence of pathogens. Microorganism Virus rotaviruses Norwalk viruses Bacteria Campylobacter jejuni Legionella pneumophila Salmonella Vibrio cholera Protists Cryptosporidium parvum Giardia lamblia Table 1. Some Microbial Pathogens That Occur in Water Disease acute viral gastroenteritis acute viral gastroenteritis gastroenteritis Legionnaire s disease salmonellosis (gastroenteritis), typhoid cholera cryptosporidiosis (diarrheal disease) giardiasis (diarrheal disease) A wide variety of viral, bacterial, and protozoan diseases may result from the contamination of water with human fecal wastes. Thus, water is generally monitored for the possibility of fecal contamination. Fecal contamination can result in the presence of pathogenic enteric (intestinal) bacteria. Historically, the presence of human pathogens was tested for by identifying whether certain indicator organisms are present in the water. Indicator organisms are chosen because they are found in all types of water, survive relatively well outside the gut, are present whenever enteric bacteria are present, are easily identifiable, and are not themselves pathogenic to humans. Escherichia coli meets these criteria and has been used an as indicator organism whose presence in a water supply is taken as evidence of sewage pollution. The Multiple-Tube Fermentation Test tests for the presence of coliform bacteria, which includes E. coli and a group of closely related organisms. This test occurs in 3 parts: 1) the presumptive test, 2) the confirmed test, and 3) the completed test.

179 Bio260 Page 179 Water Safety I. Presumptive Test The coliform group includes E. coli, Enterobacter aerogenes, and Klebsiella pneumoniae. Coliform bacteria are defined as facultatively anaerobic, gram-negative, nonsporing, rod-shaped bacteria that ferment lactose with gas formation within 48 h at 35 C. Therefore, if acid and gas are produced when the water being tested is inoculated into lactose broth, it is presumptive evidence of sewage pollution. The most probable number method is then used to estimate the numbers of coliform bacteria present per 100 ml of the water sample (Table 2). Standards for water safety have been established based on this method (Table 3). II. Confirmed Test Because bacteria other than coliforms may ferment lactose and thus give a positive presumptive test (see Figure 1 for a diagram showing the relationship of coliform bacteria to other lactose fermenting bacteria), the presumptive test is followed by the confirmed test. Lactose broth tubes that were positive for gas production are used to inoculate brilliant green lactose bile broth. Brilliant green lactose bile broth, which includes lactose and 2% bile, inhibits Gram-positive bacteria. Growth and gas production in brilliant green lactose bile broth thus confirms the likely presence of coliform bacteria (Gram-negative and lactose fermenting). Positive tubes from the presumptive test are also used to inoculate EMB plates, which are selective for gram negative bacteria and differential for lactose fermenters. Recall that on EMB, the colonies of lactose fermenters develop dark centers, whereas non-lactose fermenters remain relatively clear. Colonies of E. coli appear buttonlike with dark centers and are often surrounded by a green metallic sheen. III. The Completed Test Under some conditions, a completed test may be conducted, particularly if the confirmed test yields ambiguous results. In the completed test, colonies from the EMB plates are again inoculated into a lactose broth to confirm lactose fermentation. The bacteria are also gram stained to confirm that they are gram negative rods. IV. Further testing of water supplies The presumptive and confirmed tests indicates the number of total coliform bacteria that exist in the water supply being tested. However, coliform bacteria are commonly found in the soil and their presence in water may not necessarily indicate sewage pollution (e.g., many dug wells test positive for coliforms after heavy rains because of the presence of soil bacteria in the water). Thus, the Multiple-Tube Fermentation Test may be followed up with tests that are more specific to the identification of E. coli and other enteric coliforms (see Fig. 1), e.g., the IMViC tests may be performed on a positive sample in order to identify the contaminant. Additionally, many water quality control agencies now use tests that are more specific to the detection of fecal coliforms, coliforms that are derived from the intestine of warm-blooded animals.

180 Bio260 Page 180 Water Safety Figure 1. The relationship between lactose fermenters, coliform bacteria, and fecal coliforms. Many types of bacteria can ferment lactose. A subset of these are coliform bacteria: facultatively anaerobic, nonsporing, rod-shaped bacteria that ferment lactose with gas production within 48h at 35 C (the confirmed test uses bile and/or eosin methylene blue to restrict the growth of Gram positive bacteria, while also revealing lactose fermentation). Within the coliform group, some bacteria are fecal coliforms bacteria that live in the intestines of warm-blooded animals. The confirmed test may reveal the presence of the fecal coliform E. coli by its appearance on EMB. If E. coli is present, then the water is contaminated with feces. Because many fecal coliforms cause disease in people, fecal contamination makes the water unsafe for drinking and may make it unsafe for swimming and the harvesting of shellfish.

181 Bio260 Page 181 Water Safety V. Procedure A. Presumptive test Materials per group of students: water sample lactose broth a) 5 large test tubes containing 10 ml double-strength lactose broth and inverted gas tubes b) 2 test tubes containing 10 ml single-strength lactose broth and inverted gas tubes Sterile pipettes, 0.1 ml, 1.0 ml, and 10 ml 1. Using a 10 ml pipette, transfer 10 ml portions of the water sample to each of the five tubes containing double-strength lactose broth 2. Place 0.1 ml of the water sample into one of the single-strength lactose broth tubes. 3. Place 1.0 ml of the water sample into the other single-strength lactose broth tubes. 4. Incubate at 35 C for 48 h. 5. Examine tubes for gas production. Report as positive any tubes in which 10% or more of the volume of the gas tube is occupied by gas. Gas in all tubes, including those receiving 1.0 and 0.1 ml water indicates gross contamination. On the other hand, a sample showing only one positive 10 ml tube would be classed as questionable. 6. Use the most probable number method to determine the number of coliforms per 100 ml water (the coliform index). B. Confirmed Test (for lab groups that had a positive presumptive test) Materials per group of students: Poured plates of sterile eosin-methylene blue (EMB) agar tubes of brilliant green lactose bile broth with inverted gas tubes 1. Select a positive presumptive tube, preferably the highest dilution showing gas (0.1 or 1.0 ml if these are positive). If you had no positive tubes, you don't have to do this step. 2. Flame your loop and then insert it into the positive tube, which should be slanted to avoid picking up any scum or surface membrane. 3. Do a pure culture streak on the EMB plate. 4. After streaking the EMB plate, inoculate a loopful of the same tube or another positive tube of the series into a tube of the brilliant green lactose bile broth. 5. Incubate both the plate and the broth at 35 C for 48 h. 6. Examine the EMB plate for the presence of colonies. Based on the colony characteristics, identify whether the bacteria can ferment lactose, or whether they appear to be E. coli, etc. 7. Examine the broth for the presence of gas.

182 Bio260 Page 182 Water Safety Table 2. MPN Index and 95% confidence limits for various combinations of positive and negative results when five 10 ml portions, one 1 ml portion and one 0.1 ml portion are used (from the American Public health Association) Number of Tubes giving Positive Reaction Out of MPN Index per 100 ml 95% Confidence Limits 5 of 10 ml 1 of 1 ml 1 of 0.1 ml Lower Upper Each Each Each < Table 3. Standards for Water Quality (source James Fester, RI Dept. of Environmental Management) Water Use Drinking Swimming fresh water seawater Harvesting of shellfish Acceptable Levels of Total Coliforms <1 per 100 ml median value of 1000 per 100 ml 20% of samples not to exceed 2000 per 100 ml median value 700 per 100 ml median value of 70 per 100 ml no more than 10% of samples to exceed 230 per 100 ml

183 Bio260 Page 183 Water Safety Study Guide Pre-lab questions: 1. If you cannot be sure that a positive test indicates sewage pollution, what is the practical value of the presumptive test? 2. What organisms other than E. coli produce acid and gas in lactose broth? 3. Why is the confirmed test made on positive presumptive tubes? What information does it provide? 4. What types of disease might be transmitted by drinking (or other contact with) polluted water? 5. What types of water-borne diseases could not be detected by the usual microbiological procedures? 6. What are coliforms? Why does their presence in water indicate possible contamination? 7. What bacteria other than enteric bacteria produce a positive coliform test yet have no public health significance? 8. In addition to the Multiple-Tube Fermentation Test, what types of tests are done on water samples? Why are these tests necessary?

184 Bio260 Page 184 Water Safety Post-lab questions: 1. Record your results for your presumptive test. 2. What is the MPN derived from your presumptive test? What is the error range with 95% confidence? 3. Record the results for your confirmed test. If your sample didn't require a confirmed test, explain why. 4. Describe the appearance of the colonies on EMB. (If your sample didn't require an EMB plate, borrow one from another lab group and make a note of their water source.) What do the appearance of the colonies tell you about the metabolism of the organism? 5. Is the sample you tested safe for swimming? drinking? Explain.

185 Bio260 Page 185 Water Safety

186 Bio260 Page 186 IMViC IMVIC REACTIONS Food or water that is contaminated by certain members of the enteric (intestinal) bacteria can cause serious disease. Many of these bacteria belong to the family Enterobacteriaceae, a group of short, gram-negative nonspore-forming bacilli. Examples include the pathogens Salmonella and Shigella, the occasional pathogens Klebsiella and Proteus, and the normal intestinal bacteria Enterobacter and E. coli. These bacteria are very similar physiologically and can be difficult to distinguish. The differentiation and identification of these enteric bacteria can be accomplished by using a series of four metabolic tests collectively called the IMViC Reactions. The acronym IMViC stands for Indole, Methyl Red, Voges-Proskauer, and Citrate (the i just helps in pronunciation). I. Indole production Nearly all proteins contain tryptophan, a large and complex amino acid. Tryptophan has a purine-like ring structure covalently bonded to an aminated pyruvate. Because some bacteria contain the enzyme tryptophanase, they are able to hydrolyze tryptophan into indole, pyruvic acid and ammonia. Bacteria with tryptophanase utilize the pyruvic acid and ammonia to satisfy their nutritional needs. Indole is not used and accumulates in the medium. The presence of indole can be detected by the addition of Kovac s reagent, which reacts with indole to produce a bright red oily compound. Bacteria producing a red layer are indole positive.. Tryptophan indole + pyruvic acid + ammonia MR-VP All enteric bacteria oxidize glucose to obtain energy; however, the end products of this oxidation vary depending on the catabolic pathways present in the bacteria. The methyl red and Voges-Proskauer tests are physiologically related and both use the same medium, MR-VP broth. This medium contains peptone, glucose, and a phosphate buffer. The methyl red test depends upon the ability of an organism to produce acid from glucose in sufficient quantity to cause the medium to become acidic and to hold this low ph for 5 days. Enteric bacteria such as E. coli that oxidize glucose by mixed acid fermentation produce a variety of acidic end products such as lactic, acetic, and formic acids. This mixture of acids lowers the ph of the medium to 4.4 or less. When added to the medium after 5 days, the ph indicator methyl red will appear red in color, indicating a positive MR test. Other bacteria convert acidic fermentation products into neutral products such as butanediol or ethanol. Because acidic fermentation products are converted to neutral products, the ph of the medium is not acidic, and methyl red is colored yellow, indicating a negative MR test.

187 Bio260 Page 187 IMViC Enteric bacteria such as Enterobacter and Klebsiella that perform butanediol fermentation oxidize glucose by the following pathway: Glucose pyruvate acetolactate acetoin (acetylmethyl carbinol) butanediol Although there is no test for the presence of butanediol, two bacteriologists named Voges and Proskauer developed the VP test for the presence of acetoin, a precursor to butanediol. In this test, acetoin turns pink to red in the presence of 40% KOH and a 5% solution of alphanaphthol in absolute ethanol. A pink color indicates a positive VP test. Best results for this test are obtained if the cultures are 3-5 days old. III. Citrate utilization The last IMViC test determines whether an organism can grow using citrate as a sole source of carbon. The medium used for this test is Simmon s citrate agar. In this defined medium, sodium citrate (sodium salt of citric acid) is the only source of carbon. Nitrogen is supplied by ammonium salts (rather than from an undefined mixture of amino acids). Simmon s citrate agar also contains the ph indicator bromthymol blue, which is yellow at ph 6.0 or less and blue at ph 7.6 or more. The ph of the medium is initially adjusted to about 6.8, so the medium appears blue. Bacteria possessing citrase can convert citrate to pyruvate and CO 2. The excess sodium reacts with CO 2 and water to form sodium carbonate. This raises the ph of the medium and changes the indicator to a blue color. Growth and a blue color indicate a positive test. No growth and a green color indicate a negative test. IV. Procedure A. Materials (per group of students) Day One (Inoculation) h slant cultures of Escherichia coli and Enterobacter aerogenes. 2 tubes 1% tryptone broth 2 tubes MR-VP broth 2 Simmons citrate agar slants Day Two (24-48 h post inoculation) Kovak's Reagent Day Three (5-7 days post inoculation) 4 clean test tubes Methyl Red reagent Voges-Proskauer reagents A and B

188 Bio260 Page 188 IMViC B. Indole Test 1. Inoculate one tube of tryptone broth with a small amount of E. coli. 2. Repeat the procedure with the culture of Enterobacter aerogenes. 3. Incubate all tubes at 35 C for hours (no longer). 4. After incubation, compare each of the inoculated tubes with the control tube. 5. Examine each tube for growth. Add 1 dropper full of Kovac s indole reagent to each tube. Aerate and observe for red color. C. Methyl Red and Voges-Proskauer Tests 1. Inoculate one tube of MR-VP broth with E. coli. 2. Repeat the procedure with the culture of Enterobacter aerogenes. 3. Incubate all tubes at 35 C for at least 5 days. 4. Examine each tube for growth. Shake lightly. 5. For methyl red test: Transfer 1 ml of inoculated broth to a clean test tube, then add 4-5 drops of methyl red indicator. 6. For Voges-Proskauer: Transfer 1 ml of broth to a clean test tube. Add the contents of one ampule of VP reagent A (about 15 drops). Shake lightly for 30 sec. Add 5 drops of reagent B. Aerate vigorously for 30 sec. Let tube sit for 10 minutes, aerating frequently. 7. Record results. E. Citrate Utilization 1. Using an inoculating needle, take a small amount of inoculum from the culture of E. coli. 2. Inoculate the slant of Simmon s citrate agar by stabbing and streaking the agar in the following manner: 1) stab the needle into the butt of the agar, then 2) as you withdraw the needle from the agar, streak the culture across the top of the slant. 3. Repeat the procedure with the culture of Enterobacter aerogenes. 4. Incubate all tubes at 35 C for at least 48 h. 5. Examine tubes for growth and the presence of blue color. (Note that if you were testing an unknown organism, you would check again in 7 days.) 6. Record results.

189 Bio260 Page 189 IMViC Study Guide Pre-lab questions: 1. What are enteric bacteria and what is their importance in the medical field? 2. Why do Enterobacter and E. coli give different results for both the Methyl-Red and Voges-Proskauer tests? What does this indicate about their metabolism of glucose? 3. Why is the test for tryptophan hydrolysis called the indole test? 4. Why is nitrogen provided by ammonium salts in Simmon s citrate agar and not by amino acids as in most media? Post lab questions: 1. Create a data table and record your data in your lab journal. 2. Did each species give the expected results? 3. What did your test results tell you about the metabolism of each of these organisms?

190 Bio260 Page 190 Kitchen HOW CLEAN IS YOUR KITCHEN? Microbes are everywhere, even in places where we try to get rid of them. Although many harmless bacteria exist in our kitchens and are digested by us every day, occasionally people become ill when a pathogenic microbe is introduced into their food. How clean is your kitchen? Is E. coli swimming in the sink? Or is your floor clean enough to eat off of? How effective are your cleansers against your microbial tenants? Most of what people do when they clean their homes is degerming, the physical removal of microbes from a surface. When you rub and scrub, you re wiping away the dirt and some of the microbes, reducing their numbers. The disinfectants you buy to help you clean your house have specific ingredients to help you actually kill some microbes, lowering their number more. If you run your dishes through a dishwasher, you can sanitize them (usually a specific setting on the machine), which reduces the number of microbes even more to levels safe for human consumption. You don t actually sterilize your home, which would kill all the microbes, even bacterial endospores probably a good thing as chemicals that sterilize aren t usually very good for you either (like formaldehyde). To get the most out of disinfectants, you need to use them properly. First of all, some products, like bleach and Lysol spray, are strictly disinfectants, while other products are combined with cleaning agents and are disinfectant cleaners. Disinfectants have to actually come into contact with microbes in order to kill them. If there s dirt or other organic matter (blood, urine, food crumbs) on the surface, the organic matter will soak up the disinfectant and you won t get good killing. So, if you re using a straight disinfectant, you need to clean the surface before you apply the disinfectant. Disinfectant cleaners contain disinfectants plus cleaning agents so you can use them all in one shot. The key is to read the label and use the product according to the directions. Lysol disinfectant spray, for example, says it kills 99.9% of germs, and also advertises that it kills viruses, bacteria, molds, & mildew. If you read the details on the back of the can, however, you find that you have to spray it on a clean surface and leave it for 10 minutes to get the full effect. You ll also find a more detailed list of exactly which viruses, bacteria and fungi it can actually kill and a microbiologist would notice that all the viruses listed are enveloped viruses and none of the bacteria form endospores. Enveloped viruses are easy to kill because you just need to disrupt their envelope, which you can also do with soap and water. And, as you know, endospores are very hard to kill and chemicals that can kill them wouldn t be very good for you to use in your house. The point to remember from all this is that if you take the time to read the labels on your disinfectants, you ll find out more about what they actually do and how you re supposed to use them (and maybe if you really want to use them at all). Disinfectant labels also typically list both the active ingredients in this case, the ingredients that actually kill microbes and the inactive or inert ingredients the ingredients that smell nice, help clean (if it s a disinfectant cleaner), and make everything mix together. Here s a short list of some of the common chemicals that people use in the home and what they do: Soaps and detergents break up lipids (like grease), helping you dislodge microbes from the surface of your dishes, counters, and hands. Because they break up lipids, they also disrupt

191 Bio260 Page 191 Kitchen plasma membranes which destroys enveloped ( lipophilic ) viruses, including HIV and influenza. Bleach contains chemicals that form a free radical called hypochloride (HOCl - ). Free radicals steal electrons from molecules, including those that make up the cells of microbes, causing chain reactions of destruction that damage and kill cells. Acids and bases denature proteins and are effective disinfectants if the solution is strong enough. Lemon juice and vinegar are both acids, and sodium hydroxide is a base (found in many toilet bowl cleaners and Mr. Clean. Quaternary ammonium compounds contain positively charged ions (cations). Because of their positive charge, they stick to negatively charged bacteria, damaging their membranes and causing cells to lyse. Quats are stable and long-lasting and typically make good disinfectant cleaners. You can recognize quats on labels by looking for names like "alkyl dimethyl benzyl ammonium chloride" or "benzalkonium chloride". Alcohols can be effective disinfectants because they also disrupt lipids, destroying enveloped viruses and killing some bacteria. They re the active ingredient in hand sanitizers and are found in some cleaning products. The trick with alcohols, though, is that the concentration has to be right for maximum effectiveness and the type of alcohol makes a big difference. Ethanol and isopropyl alcohol are the two alcohols that are most commonly used in household products, and 70% solutions of either of these alcohols are commonly used as lab disinfectants. (The alcohols that are most effective at killing cells are pretty stinky so don t get used much, even in labs.) Some hand sanitizers contain so little alcohol and so much perfume and other ingredients that they aren t very effective. Pine oil contains several alcohols, including some of the stinky, effective ones, which is why pine oil is a good disinfectant if the concentration is high enough. The cleaner Pine-sol contains a combination of pine oil, alcohols, and quats. Phenols are ring shaped compounds that come from plants. They re very effective disinfectants that can disrupt plasma membranes and even denature proteins, but they aren t used much anymore because most of them are dangerous to people. (The father of disinfection, Joseph Lister, first used phenols as a spray during surgery. Even though the phenols damaged tissues, survival after surgery went way up because of the decrease in post-operative infections like gangrene.) Listerene, named for Lister, still contains phenolics. Triclosan is a phenolic that s the active ingredient of most anti-bacterial soaps and is also being used as an anti-bacterial agent in plastics like children s toys and cutting boards. Most microbiologists are pretty frustrated by the widespread use of triclosan, for several reasons: 1) Using it in soap is redundant -- soap by itself works great; 2) The concentrations in plastics may not be sufficient to achieve good killing; and 3) the widespread use is applying a selection pressure for triclosan-resistant bacteria, so that when we really might need to use it, it won t work! The way I see it, it s a marketing ploy that plays upon people s fears of germs in order to sell products, when the ironic result is that it s making people less safe in the long run. One last word of caution -- disinfectants have a broad range of activity and can be dangerous to people, which is why you re supposed to keep them away from children and why you sometimes should wear rubber gloves when cleaning. Again, read the label for the safety information, or look up a specific compound at the Household Products Database ( If you find that your cleaners are more toxic

192 Bio260 Page 192 Kitchen than you re comfortable with, you can check out green alternatives in the grocery store or search online for instructions to make your own. Or, you could just be like me and live in peace with your microbes. II. Procedure A. Part 1. Sampling your kitchen. 1. Materials per each student 2 TSA plates 2 sterile swabs 1. Take 2 plates and two sterile swabs home. 2. Decide on two areas of your kitchen from which to take samples. Label your plates. 3. Swab each of your target areas with a fresh swab and then do pure culture streaks (T-streak) on your plates. 4. Bring your plates back in to the next lab period and place them in the 25 C incubator (also bring in a sample of one of your cleansers for part 2). 5. For each area sampled, how many different types of growth did you see? Record the numbers of different colony types and describe their morphology. B. Part 2. Testing your cleanser 1. Materials per each student Bring in small sample of one of the cleansers you use in your kitchen. 1 TSA plate 1 sterile swab 4 sterile paper filter disks 3 other test chemicals, either cleansers from lab mates or disinfectants from the lab supplies 2. Choose one type of bacteria that grew on your kitchen 3. Using the method outlined in the Control lab, seed a plate with a lawn of this bacterium. 4. Quarter your plate, and label each quadrant with the name of the cleansers you will test. 5. Soak a paper filter disk in your cleanser, then lay it on one quadrant of the plate. 6. Repeat for the other 3 cleansers. 7. Incubate at 25 C until the next lab period. 8. Measure the zone of inhibition for each cleanser tested.

193 Bio260 Page 193 Kitchen Pre-lab questions: 1. Define the following: Disinfect Study Guide Degerm Sanitize Sterilize 2. Which ad slogan would indicate the strongest disinfectant? Explain your answer. Kills influenza! Destroys bacterial endospores! Removes bacteria from surfaces! 3. Choose 1 cleaner from your house and read the label. What s the active ingredient? How does it work? What are the product directions? The safety warnings? Post-lab questions: 1. For each of your original kitchen plates, record the numbers of different colony types and describe their morphology. 2. On the samples from the kitchen, which kitchen area showed the most diversity? Why do you think that might be so? 3. Make a data table showing the effectiveness of cleansers against your kitchen microbe. 4. Which cleanser was most effective against the microbe from your kitchen? Did you see any difference in the effectiveness of your own cleansers vs. those of your classmates on the microbe from your kitchen? Why might this be so? Try to think of at least two different reasons. (Hint: think about this both from the perspective of the cleanser, and also from the perspective of the bacterium.)

194 Bio260 Page 194 Control CONTROL OF MICROBIAL GROWTH The control of microbial growth is built into the normal routines of many cultures: many people wash their hands frequently, separate their wastes from their drinking water, and clean their homes with bleach, ammonia, and lysol. In the health professions, the control of microbes becomes especially important, as health care workers seek to prevent transmission of disease and infection. Control of microbes refers to the reduction in numbers or activity of the total microbial flora. Control can be achieved by removal, inhibition, or killing of microbial organisms. Treatments that actually kill microbes have the suffix -cide a bacteriocide is something that kills bacteria (a germicide kills microbes, fungicides kill fungi, etc.). Treatments that inhibit growth and multiplication have the suffix -static a bacteriostatic agent would inhibit growth only as long as it was present. In this lab, we will examine the effects of the physical removal of microbes by washing and the effects of various chemical agents on microbial growth. I. Comparison of the germicidal effect of common disinfectants A disinfectant is a chemical that destroys harmful microorganisms on inanimate surfaces. Chemical compounds used as disinfectants vary in their ability to kill microorganisms or to inhibit their growth. Also, microorganisms differ in sensitivity to various disinfectants. A compound that might be active against a gram-positive organism might be much less effective against a gram-negative organism. The filter paper method may be used to evaluate the efficacy of a chemical agent. In this method, disks of filter paper are soaked in the chemical and placed on an inoculated agar plate. If the chemical is effective against the bacterium, then a clear zone indicating inhibited growth will be visible around the disk after incubation. This clear zone is called the zone of inhibition. The results obtained by this method depend not only on the toxicity of the chemical, but also on its ability to diffuse through the medium. Other factors that affect the results of the filter paper method are the amount and distribution of the inoculum, the incubation period, the depth of the agar, the concentration of the chemical in the disk, and the growth rate of the bacterium. II. Sensitivity of bacteria to antibiotics Antibiotics are compounds produced by microbes that interfere with the growth of other organisms. Some antibiotics are specifically inhibitory only for those bacteria with certain characteristics (e.g., gram positive bacteria); these antibiotics have a narrow spectrum of microbial activity. Other antibiotics are effective against wide range of bacteria and are referred to as broad-spectrum antibiotics. It is a common practice in many hospital laboratories to test organisms isolated from infections against a number of different antibiotics and to use the most effective one in treating the disease. The filter paper method, standardized according to a precise protocol called the Kirby-Bauer method, is commonly employed to do this. When using the Kirby-Bauer method, the diameter of the zone of inhibition is used to determine whether the organism is resistant, intermediate, or

195 Bio260 Page 195 Control susceptible to the antibiotic. For our purposes, an organism will be determined resistant if growth occurs right up to the boundary of the disk. If there is a clear zone of inhibition around the disk, the organism will be considered susceptible. IV. Procedure A. Comparison of the germicidal effect of common disinfectants Materials per group of four: Broth cultures of E. coli (Gram -), and Staphylococcus aureus (Gram +) 4 TSA plates Disinfectants of various kinds Sterile swabs Sterile filter-paper disks about 5 mm. in diameter 1. For each species, label two plates with the name of the organism. 2. Then, divide each plate into quarters and label each quarter with the name of a disinfectant. 3. Inoculate the two plates for each species as follows: Insert a sterile swab into a broth culture and streak it carefully over the surface of a TSA plate. Turn the plate 90 degrees and streak again over the entire surface to ensure a uniform film of bacteria (Fig. 1). 4. Choose a disinfectant to test and prepare a filter paper disk as follows: Using sterile technique, pick up a filter paper disk with a pair of forceps. Wet the disk by touching its edge to the surface of the disinfectant. Allow the disk to take up the disinfectant until it is completely wet but not dripping. Drop the disk onto the surface of the plate inoculated with E. coli and press gently. Prepare one more disk of this disinfectant and place one each onto the plates inoculated with S. aureus Figure 1. Swabbing a plate to create a uniform film of bacteria. 1 st swabbing 2 nd swabbing

196 Bio260 Page 196 Control 5. Choose seven more disinfectants to test and repeat the procedure in #2. Four filter paper disks should be placed on each plate. Thus, when you are finished, you should have 2 plates for each species and each plate should have four different disinfectant disks on it (Fig. 2). You will have tested a total of 8 disinfectants against each species. Note: In order to prevent the transfer of one disinfectant to another, use a separate pair of forceps for each disinfectant. Plate inoculated with E. coli and tested with disinfectants 1-4 Plate inoculated with E. coli and tested with disinfectants 5-8 Figure 2. Filter paper method. 6. Incubate all plates at 35 C for 24 to 48 h, then examine the plates and record the diameter of the zones of inhibition (measure in millimeters). B. Sensitivity of bacteria to antibiotics Materials per group of 4: h broth cultures of Staphylococcus aureus (Gram +) and Escherichia coli (Gram -) 4 TSA plates Sterile swabs Commercial antibiotic sensitivity disks (Table 1) 1. For each species, label two plates with the name of the species. Then quarter each plate and label each quadrant with the name of an antibiotic (Table 1). 2. Inoculate 2 plates with each species as you did for the disinfectant protocol (#B1-3 above). You should again end up with 2 inoculated plates for each organism. 3. Using sterile technique, place one antibiotic disk on the agar in the center of each quadrant. Press gently on the surface of each disk with the forceps. Four disks can be placed on each plate, so that 8 antibiotics may be tested against each organism. 4. Incubate at 35 C for 24 to 48 hours. 5. Observe and measure the diameter of the zone of inhibition.

197 Bio260 Page 197 Control Table 1. Properties of Selected Antibiotics Antibiotic Spectrum of Activity Zone Diameter Interpretive Symbo Standards (mm) 12 l R I S E Erythromycin Narrow (Gram+, mycoplasmas) TE Tetracyclin Broad (Gram+, Gram-, rickettsias and chlamydias) S Streptomycin Broad (Gram+, Gram-, mycobacteria) NB Novobiocin Narrow (Gram +) N Neomycin Broad (Gram+, Gram-, mycobacteria) AM Ampicillin Borad (Gram+, some Gram-) K Kanamycin Broad(Gram+, Gram-, mycobacteria) P Penicillin Narrow (Gram+) R=resistant, I=intermediate, S=susceptible. Standards given are those appropriate for the test organisms we re using in this lab. If working with an unknown bacterium, you should double check the standards (see your instructor or the lab tech to get a copy of the complete standards).

198 Bio260 Page 198 Control Pre-lab questions: 1. Define each of the following disinfectant Study Guide antibiotic zone of inhibition 2. What factors affect the filter paper method for testing disinfectants and antibiotics? 3. Many of the disinfectants tested will produce zones of inhibition around the colonies. In some cases, a sample taken from under a disk with a definite zone will grow when placed in thioglycollate broth, in other cases it will not grow. How would you explain these two different effects? 4. On a test plate inoculated with an organism such as a staphylococcus recently isolated from an infection, a few colonies may appear within a clear zone of inhibition. Why would these colonies be present? What would their growth indicate about the probably effectiveness of the antibiotic in controlling the infection? Post-lab questions: 1. Record your data for the handwashing experiment in your lab journal. Include the number and appearance of the colonies in quadrant. 2. Which quadrant had the most colonies? 3. Did the colonies in each quadrant look the same? Which colonies do you think represented transient flora? normal flora? Why do you think so? 4. Why do surgeons need to scrub their hands intensively before a surgery? 5. Create a data table for the disinfectants in your lab journal. For each disinfectant, record the diameter of the zone of inhibition in millimeters for each species. 6. What relationship, if any, did you observe between gram-staining characteristics of the bacteria and their susceptibility to action of disinfectants? (i.e, compare your overall results for E. coli and S. aureus)

199 Bio260 Page 199 Control 7. Create a data table for the antibiotics in your lab journal. For each antibiotic, record the diameter of the zone of inhibition in millimeters for each species, then make a conclusion regarding their susceptibility to the antibiotic (see Table 1). 8. According to your data, which antibiotics were broad spectrum? How could you tell? 9. According to your data,which antibiotics were narrow spectrum? How could you tell? 10. Did your data for any of the antibiotics not match your expectations (compare your results to Table 1). If so, why might you have gotten different results?

200

201 INDEPENDENT PROJECTS

202 Bio260 Page 202 Pure Culture Project

203 Bio260 Page 203 Pure Culture Project PURE CULTURE PROJECT The ability to isolate a single species of bacteria from a mixed culture is essential to both microbiology and medicine. In microbiology, bacteria are isolated into a pure culture in order to determine characteristics like which food sources they utilize, which environments they can grow in, and which useful products they might make. In medicine, the isolation of pathogens into pure culture allows them to be tested for the presence of antigens useful to their identification or for their susceptibility to antibiotics. From a wild population of mixed species, you will isolate a bacterium into pure culture. Your grade on this project will be based on your ability to master the streak plate technique, your success in identifying a pure culture, and your written record of your work. I. FIRST LAB PERIOD: CULTURING BACTERIA FROM NATURE As part of the Where do microorganisms occur? lab, inoculate several petri dishes with samples. II. SECOND LAB PERIOD: BEGIN ISOLATION OF A SPECIES INTO PURE CULTURE As part of the Where do microorganisms occur? lab, examine your plates from last time and record your results. Then, as part of the "Pure Culture Techniques I" lab, choose three different species that you will attempt to isolate. All three species should look different from each other and they should come from different environmental sources. Please choose at least one species from a plate that clearly contains more than one species of bacteria so that you can see how the streak plate method works. Do one pure culture streak for each species you choose. III. THIRD AND SUBSEQUENT LAB PERIODS (UNTIL PURE CULTURE DEADLINE As part of the "Pure Culture Techniques I" lab, critique the results of your pure culture streaks from last time. Next, choose one of your three streaks to continue working on. Keep the others as backup in case your selected organism dies. Continue pure culture streaking until you you feel that you've mastered the streak plate method and you have obtained a pure culture. If necessary, you may also use special media (see the lab "Pure Culture Techniques II"). Start a new record in your lab journal. Every time you examine a plate or make a new plate, you should include a dated comment in your journal. Part of your grade on this project will be on the quality of your written documentation. IV. DETERMINATION OF PURE CULTURE It can be difficult both to obtain a pure culture and to know when your culture is pure. Your best indicators of a pure culture are as follows: 1) You prepared the plate from an isolated colony and

204 Bio260 Page 204 Pure Culture Project 2) You only have one type of colony morphology on your plate. This means that when you examine your streaks and colonies, you only see one type of growth. Careful observation on a dissecting microscope is highly recommended. For extra insurance, you can also do a Gram stain from an isolated colony on a plate that meets criteria #2. If you have a contaminant it might be present at very low numbers, therefore you must scan the smear thoroughly and carefully look for a different cell type. Note that Gram stains must be performed on cultures that are not older than 24 h. As lab only meets twice a week, you will need to plan to come into lab to set up a culture the day before you wish to do a Gram stain. V. GRADING By the pure culture deadline, you must turn in a fresh pure culture streak (not incubated) of your organism. Label the plate with your name and the temperature at which I should grow the streak. Please also turn in your record of your work on this project from your lab journal. Your plate will be graded on your streaking technique, including whether you achieve isolated colonies, and the purity of the culture. Your journal pages will be graded on whether they contain the proper elements of lab journal entries as described in the Lab Journal section of this manual. Goals and Points possible Streak technique (8 pts) Observed pattern is consistent with norms Density of growth decreases with each section Cross-overs between sections are appropriate and intentional Spacing between cross-overs in final section is sufficient to allow for isolation Colony Isolation (4 pts) Several well-isolated colonies present on plate Purity (8 pts) All colonies on plate have same size, color, texture, shape, elevation If necessary, re-streaking by instructor yields one type of growth If necessary, Gram-staining by instructor yields one cell type Record (5 pts) Dated entry for each day that project was worked on Work on project was timely and consistent Detailed observations recorded Notes for improvement included as necessary

205 Bio260 Page 205 Gram Stain Practical GRAM STAIN PRACTICAL Gram staining is one of the most widely used classical technique for the identification of bacteria. Even with the increasing use of molecular methods, Gram-staining remains and important skill in medical microbiology (see Fig. 1). Figure 1. A medical requisition form for a clinical laboratory As part of your grade for this course, you will be asked to demonstrate your proficiency at this classical staining technique. I. Procedure Materials: A fresh (24h or less) culture of your unknown bacterium. slide crystal violet Gram's iodine safranin 1. Prepare a smear of your unknown bacterium. Follow the protocol for smear preparation given in the Smear Preparation and Simple Stain lab (only the smear preparation part, not the simple stain part). 2. Apply Crystal violet for 1-2 minutes. 3. Wash off the excess stain by holding the slide under a stream of water. Do not tilt the slide until it is under the water. 4. Flood the slide with Gram's iodine and allow it to react for 1 minute or longer. 5. Rinse as instep No.3. Shake the excess water off or blot lightly, but not to dryness.

206 Bio260 Page 206 Gram Stain Practical 6. Holding the slide at an angle, carefully add the decolorizing solution (acetone-alcohol) one drop at a time. As soon as color stops coming off the slide, after about 8-10 seconds, rinse with water to stop the decolorizing action. 7. Flood the slide with safranin and allow it to react for seconds. 8. Drain the excess stain from the slide and thoroughly wash it. 9. Carefully blot the stained slide using a paper towel. Do not rub. 10. Examine with the oil immersion objective. In the unknown section of your lab journal, make a drawing of your unknown bacterium, noting color, morphology, and arrangement of cells. 11. You can use KOH to confirm your staining reaction, and you can make as many slides as you want in order to perfect your technique before the due date for this assignment. 12. When you're ready to turn in your slide, put slide labels (you can put one on each end of the slide) with the following information. your name your unknown # your conclusion re:gram reaction your conclusion re: morphology and arrangement of your unknown Note: You don't have to turn in paperwork with your slide. All the information should be on the slide labels. II. GRADING Goals and Points possible Smear Density (4 pts) Smear should be dense enough that the cells can be found easily The majority of the smear should be spaced enough that the morphology and arrangement of the cells is clearly visible (white space around cells, not a solid wall of cells) A few dense areas of the smear is acceptible Smear Cleanliness (2 pts) Smear contains just bacterial cells without fibers from paper or chunks of agar Color, Stain, Clarity (6 pts) Color matches expectation for the organism Stain is deep enough for color to be seen clearly (not too pale) Cells are clearly visible, not deformed Interpretation (8 pts) Conclusion for Gram reaction matches expectation for the organism Conclusion for morphology matches expectation for the organism Conclusion for arrangement matches expectation for the organism

207 Bio260 Page 207 Unknown Project UNKNOWN PROJECT During the quarter, you will receive a pure culture of an unknown bacterium 13. Using the classical bacteriological techniques learned in the laboratory, you will characterize and identify the bacterium to species level. The results of your investigation are to be reported in standard scientific format. The purpose of this exercise is to determine how well you have mastered the laboratory techniques learned in microbiology, and to give you experience in scientific investigation and reporting. Note: As you proceed through this project, you may write portions of your report as you go, rather than leaving the whole report for the end of the term (when time is usually at a premium). For example, you can write your introduction during the first week of the project. Your materials and methods can be written as you proceed through each test. I. BACKGROUND INFORMATION A. Identification of bacteria There are many reasons why it is important to be able to identify bacteria. Because different types of bacteria respond to different antibiotics, effective treatment of bacterial infections often depends upon rapid identification of the infecting bacterium. Also, in cases of food or water contamination, the identification of the contaminating organism can help identify the source of the contamination. Complex communities of microbes exist in the natural world and affect the health of ecosystems. Understanding these communities, including who is part of them and what the roles of each microorganism are, is essential to understanding how ecosystems function on the microscopic level. Finally, in order for researchers in science and medicine around the world to share their discoveries with each other, there must be a common system of identification and naming of bacteria for everyone to use. Despite its importance, the precise identification and naming of bacteria has many challenges. You have probably already experienced the fact that different types of bacteria may look very similar to each other, and that there aren t a lot of features you can see with just a light microscope. The power of the light microscope can be enhanced by staining tests that reveal certain structural details of bacteria. In addition, microbiologists have long relied upon biochemical characteristics to identify bacteria. Essentially, this involves doing tests that reveal the presence or absence of particular enzymes. The use of staining reactions, biochemical tests, and descriptions of growth characteristics of bacterial are all part of the classical methods of bacterial identification. More recently, as our ability to study cells on the molecular level have increased, scientists in microbiology and medicine are turning to molecular methods of bacterial identification With instructor's permission, you may choose to identify the organism that you isolated as part of your pure culture project instead of one of the lab stock unknowns.

208 Bio260 Page 208 Unknown Project These methods involve identifying and comparing specific molecules, such as the proteins found in bacterial flagella or pili. Comparison of proteins can be done by studying how proteins behave during electrophoresis or by whether highly specific proteins, called antibodies, can stick to the proteins. Many rapid identification tests that result in a quick color change use this serological method, for example rapid Streptococcus ID kits or home pregnancy tests (testing for HCG not a bacterium, but the same method). Scientists can also use DNA and RNA molecules directly for identification. Often, they extract a particular piece of DNA or RNA and determine the sequence of bases within that piece (e.g., CCGGAA ). The sequence of bases from a particular piece of DNA from one bacterium can be compared to that of a different bacterium in order to determine how similar they are. This technique can also be used to determine the causative agent of a disease: a piece of nucleic acid is obtained from the pathogen inside the sick person and compared to a database of sequences of known pathogens in order to find a match. In the future, it is likely that more and more identification will be done by this method. Companies such as Amgen in Seattle are working on developing computer chips that will contain small snippets of DNA sequences from known pathogens. Someday, samples from sick people may be processed and allowed to interact with these chips inside a computer so that the computer can identify the matching sequence and quickly identify the bacteria or viruses that are present in the sample! B. Classification and naming of bacteria When you identify a bacterium, you match it up with a particular name, but you might still wonder where that name came from and what information it provides. The person who discovers a new organism has the right to name it, then that name is reviewed and approved or rejected by a scientific panel. When scientists give a name to an organism, they usually pick a name that reflects a characteristic of the organism or, sometimes, that honors a famous scientist. (Escherichia coli was named for scientist Theodore von Escherich, who discovered the bacterium in 1885.) Also, scientists assign names in way that reflects the relatedness of that organism to other organisms. Some scientists specialize in studying the relatedness of organisms, trying to determine which organisms are mostly closely related and who evolved from whom. The branch of science that deals with these types of questions is called systematics. Based on evolutionary relatedness, all life on Earth has been classified into categories. (The smaller categories nest within the larger categories sort of like a set of Russian Matryoshka dolls, except that each larger doll would have multiple dolls of the next size inside.) The biggest category is called a domain, and there are three domains of life: Bacteria, Eucarya, and Archaea. Within each of these domains, there is a subcategory called kingdom. Within kingdoms, there are phyla. Within phyla, there are classes. Within classes, there are orders. Within orders, there are families. Within families, there are genera. And within genera, there are species. Thus, the taxonomic hierarchy is as follows: Domain, kingdom, phylum, class, order, family, genus, and species. (Notice that the plural and singular forms of these categories are both given in this paragraph.) An easy way for you to remember the hierarchy is by the mnemonic Dumb Kids Playing Chase On Freeways Get Squished.

209 Bio260 Page 209 Unknown Project So, the scientific name of an organism doesn't just give us something to call it, it also places it into an evolutionary hierarchy that reflects relatedness between species. Once you know the name of an organism, you can access all of the scientific information that is known about it. You can also access information about the group it belongs to, in other words, about its close relatives. Two organisms that belong to the same genus would be expected to share a great many characteristics in common, and have many more common characteristics than two organisms that are within the same two domains. For example, an amoeba and a lion are both in the domain Eucarya, whereas a lion and a panther are both in the same genus. Obviously, lions and panthers have a lot more in common than lions and amoebae! Every organism that has been discovered so far on Earth has been studied, placed into the category that is most similar to it, and given a scientific name. Scientists use a system of binomial nomenclature, where the proper scientific name of an organism consists of two names; in this case, the genus and species to which the organism has been assigned. Thus, the proper scientific name for humans is Homo sapiens. A lion is Panthera leo. Escherichia coli, abbreviated E. coli, is a common bacterium that lives in your intestines. Notice that in each of these names, the genus is capitalized while the species name (specific epithet) is lower case. Also, the names are italicized (you can underline instead). This specific format identifies the name as the proper scientific name of the organism. You should always use this format because there are times when it is absolutely essential to avoid confusion. For example, any group of spherical bacteria that are found in clusters may be called staphylococcus. However, only Staphylococcus aureus is the name of a specific pathogen, with certain properties and causing certain diseases. Likewise, a member of the genus Bacillus is a large, spore-forming, Grampositive rod. However, there are many bacteria that are bacilli including E. coli, which is a medium-sized, non-spore-forming, Gram-negative rod. In these two examples, you can see how important it is to write a scientific name properly so that everyone is clear on your meaning. Bacteria present many special problems in terms of their naming and classification. We have already mentioned the problems caused by not having many physical characteristics that can be measured. Deciding which category bacteria belong to is also problematic. In larger organisms, particularly in plants and animals, the dividing line to determine whether two organisms were part of the same species is often whether or not they can mate and produce fully functional offspring. This criterion cannot be used in bacteria, however, because there is no sexual reproduction in bacteria. Thus, bacterial species are more difficult to define. In addition, bacteria have a fairly high rate of genetic change, and it is sometimes hard to draw the lines between different groups of similar bacteria that are all along a continuum of change. For example, if two populations of bacteria differ only due to the acquisition of a plasmid, but the plasmid confers several new traits to one population, are the bacteria the same species, or not? Microbiologists have traditionally dealt with situation by calling the two populations the same species, but labeling them as different strains of that species. A strain is a population of bacteria that is descended from the division of a single cell (in other words, very closely related). Species in bacteria are defined as a group that has very similar characteristics (classical) or very high similarities in their nucleic acid sequence (molecular). As noted above, species are designated by the genus plus specific epithet. Strains of bacteria are usually indicated by letters and numbers that appear after the scientific name. For example, E. coli O157:H7 is a particularly dangerous strain of E. coli.

210 Bio260 Page 210 Unknown Project II. INITIAL PROCEDURES A. Best growing temperature When you receive your pure culture, you will need to determine the best growing temperature for your bacterium. To do this, you should streak two plates and place one in the 37 C incubator and one in the 25 C incubator, then examine your plates to determine which temperature generated the best growth. In order to see subtle differences, you should look at these plates as soon as possible (within 48 hours). All subsequent tests should be incubated at your organism s preferred temperature. B. Check for purity We purchase our stock cultures from a general biology supply company because they re relatively inexpensive. Unfortunately, we ve occasionally had issues with the cultures being contaminated. So, one of the first things you should do is perform a pure culture streak and check your culture (you need to get isolation on this plate, so if you don t get it the first time, do it again). If you have any issues, consult with your instructor or the lab tech to resolve them. To conserve media, you can combine this pure culture streak with your temperature check, by streaking for isolation with the plates you put at different temperatures. C. Make a reserve culture Once you receive your slant culture from the instructor, you should immediately inoculate a second slant. The two slants (one you are given and one that you make) are designated as your working and reserve stocks. After growth has occurred in your second slant, place your original slant at the 25 degrees Celcius (working stock) and the other in the refrigerator (reserve stock). Your reserve stock should remain untouched until you run out of material in your working stock or until 21 days from inoculation, whichever comes first. At that time, use your reserve stock as inoculum to create a new reserve stock. The old reserve stock now becomes your working stock. If you contaminate your pure cultures during the course of your project, and you do not have your own reserve stock, you must purchase a pure culture of an unknown bacterium from your instructor for 5 pts. (If you have a problem and need to get your reserve stock out, there is no penalty. The reserve is considered your stock to be used in situations just such as this.) D. Perform a Gram stain As soon as possible, but no later than the due date on your lab syllabus, you will also need to turn in a Gram stain of your unknown. You should prepare a Gram stain and turn in the slide labeled with the following information: your name, the # of your unknown, Gram staining reaction (Gram positive or negative), morphology and arrangement. This slide will be graded for the quality of your smear preparation (density, cleanliness) and Gram staining technique (color, clarity, even staining) as well as your interpretation of the Gram stain (gram stain, morphology and arrangement). You can find additional details under Gram Stain Practical in this manual.

211 Bio260 Page 211 Unknown Project E. Morphological Description Early in your project, you should also set up the necessary cultures to observe the growth characteristics of your organism in different types of media: an isolated colony on a plate, a broth culture, and a single streak culture. The characteristics to look for and the language that microbiologists use to describe these characteristics is presented in detail in the Culture Characteristics Lab in this manual. You will need to write a paragraph describing the growth characteristics of your unknown in the results section of your report. Note: If you find that cellular arrangement is an important characteristic for the group to which your organism belongs, you should note that arrangement is best seen on a slide made from a broth culture. III. IDENTIFICATION OF YOUR UNKNOWN The identification of your unknown should be done using a planned procedure, according to the guidelines in this lab manual and Bergey s Manual. (In other words, you should not immediately do every test you know on your unknown different types of bacteria will require different tests.) Once you know the morphological and Gram staining characteristics of your unknown, use the key in Table 1 to determine which characteristic of your bacterium you need to determine first. If you do not already know how to do a test for this characteristic, look in the index of the lab packet to find the appropriate test and read about it. Fill out a media request slip for the test medium you need. Inoculate your medium, grow your organism, then obtain and interpret your test result. Based on the result, decide which test to perform next, and repeat the entire procedure. Basically, bacterial identification is a process of elimination. As you plan your tests, keep track of your plan and the organisms you are eliminating (at first by major group, then by Genus, then by Species) by constructing a flow chart. You will need to include a flow chart in your final paper that illustrates the path you took to identify your bacterium. Examples of typical flow charts are given in Figures 1 and 2. Notice how each test leads to a decision, and each decision eliminates a taxonomic group. These flow charts are given to you as examples of how to construct your flow chart. They are not intended to indicate the path you should follow in your identification. Flow charts are written by different groups of researchers working with particular groups of organisms. The flow charts shown here to not necessarily correspond well to our culture collection or our available tests. Thus, you must plan your own path, using Table 1, Bergey s Manual, and the index to this lab manual (contains a list of all available tests). 1. REQUESTING MATERIALS FOR TESTS Please note that media and technician time are very expensive. Therefore, it is important that you do not perform unnecessary tests on your unknown. You should only carry out tests that help you to eliminate various species. You will be graded on the organization of your tests, and can lose points for the following: a) unnecessary repeats of tests (if you are not sure if you need to repeat something, ask your instructor)

212 Bio260 Page 212 Unknown Project b) unnecessary tests that would not help you to narrow your choices (e.g., doing what your lab partners are doing, even though it s not the right test for your organism) c) tests not done in sequence (e.g, doing everything you know how to do all at once, even though the results from one test would make the next unnecessary) Note: you may occasionally do a test, then realize it wasn t necessary later. That is OK, as long as you realize it and say so in your report. You can order media for tests from your instructor or the laboratory technician. To request a test, fill out a slip of paper with the following information: your name, current date, materials requested, The date by which you d like to have the materials, and the group to which your unknown belongs (whatever you know at that point). Test request slips are available in the lab. By indicating the group for your unknown, your instructor and lab technician can spot possible problems with your identification procedure and give you advice. Do not assume you will receive materials immediately upon request. Often, media must be prepared specially for individual students. Whenever possible, plan ahead and ask for materials at least one lab period in advance of when you need them. You should be aware that we do not have the materials for all tests listed in Bergey s and you may occasionally have to substitute a test that is different from your first choice. The tests that are available to you are listed in the index to your lab packet. Finally, you are to request materials and cultures only from your instructor or the laboratory technician. Any materials/cultures/advice received from other sources will be penalized in your final grade. For most tests, growth must occur in order for the test to be valid. Always check for growth in any test you do. If you fail to get growth, consult your instructor as to whether you should repeat the test. It is important to remember that the various charts with biochemical and physical characteristics (including those in Bergey's Manual) are not infallible. Bacteria mutate easily, resulting in slightly different characteristics for different strains. Thus, you are more likely to get a correct identification if you use a double elimination rule: in other words, only eliminate an organism from consideration after two test results indicate that it's not a match for your unknown. Once you think you know the identity of your unknown, be sure to read about it in Bergey's Manual to make sure that it seems like a good fit for the information presented there. If you read about additional characteristics that are common for the organism you think you have, you can perform additional tests for these characteristics to confirm your identification. Reminder: As you are performing tests, be sure to record everything in your lab journal. Failure to chronologically document your tests and submit a record with your report will result in a 25 pt deduction on your final report. Many students like to keep their record of their unknown investigation together at the back of their laboratory notebook.

213 Bio260 Page 213 Unknown Project 2. USING BERGEY S MANUAL Bergey s Manual of Systematic Bacteriology is a huge compendium of information for microbiologists who study Bacteria and Archaea basically, it summarizes everything that was known at the time of publication about each taxon. Bergey s (as it is affectionately called) is compiled from contributions of many different scientists who were chosen because of their expertise with a particular group. A new edition of Bergey s was recently released. The new Volume I covers The Archaea, and will not be useful to you in this lab. The new Volume II covers the Proteobacteria, a group of Gram-negative rod-shaped bacteria that many of you will study for your unknown bacteria. The new Volume III covers the order Firmicutes, which includes the Gram positive bacteria that many of you will study for your unknown. Volume IV includess a diverse set of bacteria that you are unlikely to encounter in our lab, including the spirochetes and Chlamydia. Volume V covers the Actinobacteria, a group of non-sporing Gram-positive rods that often have a filamentous growth form. After you have done an initial Gram stain on your unknown bacterium and completed your initial tests according to Table 1, you will know which volume you need. The books are located in the stockroom and can be checked out to you by your instructor or the instructional technician. They are for use in Shuksan only, to be returned to your instructor or the tech by the end of the day. Each of these volumes costs around $ you are responsible for the return of a volume signed out to you. How to use Bergey s: 1. Use the index to find the section you need (based on your initial identification results; see Table 1). The bolded page indicates the main page for your group. 2. Look over the written information for your group and find the tables that are used for identification. Most sections have the key characteristics that are used in species identification compiled into one large table. a. The species are listed across the top of the table b. Useful characteristics are listed down the left edge. If you read through these characteristics, you should recognize some of them as things we ve tested for in lab. c. When you look across the table, you will see symbols or percentages indicating whether that species usually exhibits or doesn t exhibit that characteristic. A (+) means % of strains are positive for that characteristic. A (-) means only 0-10% of strains are positive for that characteristic. A (d) means 11-89% of strains are positive for that characteristic; in other words, there s high strain variability. For the Enterobacteriaceae, exact percentages are listed rather than +/-/d. ND means not determined for that species. There are legends at the bottom of the tables and elsewhere in the book that list the meanings of these symbols. Read these carefully. When you begin your eliminations, it is advisable to only eliminate organisms based on a clear + or - result. For the Enterobacteriaceae eliminate based on , or When you find the main table for your group, you ll probably want to make a photocopy (or two) of these pages so that you are free to mark them with a pen and start eliminating various species.

214 Bio260 Page 214 Unknown Project Your instructor may have posted scanned pages of some of the tables on Canvas for you to print out. The books are also available in the reference section of our library and other college libraries. PLEASE DO NOT MARK THE LAB COPIES OF THE BOOKS!!! IV. AM I DONE YET? Well, you ve worked through the tests you can do. Hopefully, this process has led you to a particular genus and species. But what if it hasn t? You may come up with more than one possibility. In either situation, go to the page that describes those particular species and read the descriptions. Does one match your unknown more closely? Or if you have more than one possibility, is there any characteristic listed in the descriptions that might separate them? You may have to review all your data. If Bergey s lists key characteristics for your organism that you did not test, it is often advisable to perform an additional test or two to confirm your results. If your identification conflicts with the description in Bergey s, or if two tests give conflicting results, consult with your instructor or the tech for additional assistance. For some organisms, we may not have the necessary test to distinguish between two very closely related species. In this case, you will end your report stating which two species it could be, what test you would do to distinguish between them, and how that test s result would enable you to make a final ID. Your grade for identification is based on the process you went through. If you reasonably cannot make a species identification, your grade will not be penalized. V. A FEW LAST WORDS OF CAUTION AND ADVICE Remember that this is an individual project. It is expected that you will need a fair amount of help at the beginning, but it is also expected that you will begin to work independently after a couple of weeks. While it is fine to discuss things with your lab partners, it is not acceptable to either constantly ask them what you should do next or to tell someone in your group how to do their project. If this kind of inappropriate behavior is observed, your project will be docked points. Keep in mind that everyone stresses over this project for the first couple of weeks and when they first open Bergey s. Most people are confused about the process at first. It s challenging, but most people do get the hang of it after a little bit, and many actually find it FUN! So hang in there, get used to using Bergey s Manual, and ask for help from your instructor or the tech promptly when you need it.

215 Bio260 Page 215 Unknown Project Table 1. A Dichotomous Key to Selected Taxa of Bacteria Note: No key to bacteria is perfect. Bacteria are highly variable and, while certain characteristics are usually true for a particular genus, there can always be exceptions. The most comprehensive source for information is Bergey s Manual of Systematic Bacteriology. Once you have used the key below to arrive at a taxon (Genus or Family as the case may be), you should use Bergey s Manual to confirm your identification and to continue the identification to the species level. Gram Positive Rods 1a.Catalase negative..lactobacillus 1b. Catalase positive (go to 2) 2a. Produces Endospores.Bacillus 2b. Does not produce endospores.(go to 3) 3a. Acid Fast..Mycobacterium 3b. Not acid fast.. (go to 4) 4a. No acid from glucose Brevibacterium 4b. Acid from glucose....corynebacterium Gram Negative Cocci 1a. Fastidious (requires special growth factors and conditions)..pathogenic Neisseria (N. meningitidis or N. gonorrhoeae) 1b. Not fastidious (will grow on TSA)... go to 2 2a. No nitrate reduction... non-pathogenic Neisseria 2b. Nitrate reduction... go to 3 3a. Negative for DNAse.. non-pathogenic Neisseria 3b. Positive for DNAse... Moraxella (Branhamella)

216 Bio260 Page 216 Unknown Project Gram Positive Cocci 1a. Catalase Negative..(go to 2) 1b. Catalase Positive.(go to 3) 2a. Non-motile.....(go to 5) 2b. Motile...Vagococcus 3a. Aerobic (go to 4) 3b. Facultative Staphylococcus 4a. Non-motile...(go to 11) 4b. Motile..Planococcus 5a. Gas from glucose fermentation.. Leuconostoc 5b. No gas from glucose fermentation (go to 6) 6a. No growth at 10 C.(go to 7) 6b. Growth at 10 C.(go to 10) 7a. PYR+...(Go to 8) 7b.PYR- (Go to 9) a hemolytic..group A Streptococcus 8b. -hemolytic..aerococcus 9a. Hydrolysis esculin in presence of bile.pediococcus 9b. No hydrolysis of esculin in presence of bile.streptococcus (not GroupA) 10a. Good growth at 45 C.Enterococcus 10b. No growth or weak growth at 45 C..Lactococcus 11a. Ferments glucose...kocuria, Kytococcus, Nesterenkonia, or Rothia 11b. Doesn't ferment glucose...micrococcus, Citricoccus, Dermacoccus or Kytococcus

217 Bio260 Page 217 Unknown Project Gram Negative Rods 1a. Aerobic..(go to 2) 1b. Facultative (go to 7) 2a. Oxidase negative.acetobacteraceae 2b. Oxidase positive..(go to 3) 3a. Rods greater than 2.0 um diameter Azotobacteraceae 3b. Rods less than 2.0 um diameter Pseudomonadaceae (go to 4) 4a. Fastidious (requires media with special growth factors to grow)..(go to 5) 4b. Not fastidious (grows on TSA)..(go to 6) 5a. formation of flocs with dendritic outgrowths..zoogloea 5b. no formation of flocs with dendritic outgrowths Xanthomonas 6a. Growth at ph 3.6 Frateuria 6b. No growth at ph 3.6.Pseudomonas 7a. Oxidase negative.enterobacteriaceae 7b. Oxidase positive.(go to 8) 8a. Motile.Vibrionaceae 8b. Non-motile Pasteurellaceae

218 Bio260 Page 218 Unknown Project VI. Formal Report of Results General Style Guidelines (points will be deducted from your report if it does not meet the following criteria) All reports should be typed and single spaced, with an extra space between paragraphs. Traditional scientific reports do not allow any personal pronouns (I, We). For example, it was not acceptable to say I used a mortar and pestle to mash up some avocado with distilled water. Instead a scientist would traditionally say The avocado was mashed with some distilled water in a mortar and pestle. However, in recent years, scientific writing has become a little more flexible, probably because all that passive writing tends to put the reader to sleep. Therefore, I will allow some use of personal pronouns in your Introduction and Conclusion. It is OK to say, I decided or I wondered, etc. It is also OK to use a little style to liven things up. Your materials and methods should be written traditionally and in the past tense. Each section should have a section header (Introduction, Materials and Methods, etc.) There should be no spelling errors. Grammar should be correct. Scientific names should be written in proper format (described earlier in this handout so no excuses!) No plagiarism from lab packet, text, Bergey s ManuaI, or classmates (everything written in your own words and proper references if necessary) Pages should be numbered at the bottom of the page Report covers are unnecessary and discouraged; please include a simple title page with title, your name, and unknown number The report should be approximately 5-10 pages in length (not counting figures and tables) We are going to use a modified scientific paper format for our reports. It incorporates some of the same things scientists are required to include in their published papers, but also has modifications for our particular exercise. Your paper should have the following components (in order): Title page: Your title should be a single sentence. EXAMPLE: Identification of An Unknown Bacteria from a Compost Heap. You should also include your name and the number of your unknown on the title page. Introduction: Normally in a scientific paper, this section summarizes what is currently known about the topic under investigation. The author usually tries to make the work sound interesting and important. For your reports, you should simply state the purpose of your study in a few sentences and try to make it sound interesting. You should also state why your investigation is important, i.e., why is the ability to identify unknown bacteria important to you? Your instructor? The world in general? (In other words, what was your purpose and why should somebody care about your project?)

219 Bio260 Page 219 Unknown Project Materials and Methods: This section should contain a detailed description of how each test was performed. (In other words, what did you do?) In scientific papers, this section is intended to provide all the information necessary so that another scientist could repeat your procedure and either confirm or refute your results. Thus, your description should include amounts of reagents, descriptions of your procedures, etc. You may assume the reader knows basic techniques such as how to prepare a smear, inoculate a broth, how to do a pure culture streak, etc, and do not need to describe these techniques. However, you should give times for staining protocols. This section should be written in paragraph form in the past tense (it is a description of what you did, not a how-to) and materials should not be listed separately. For example, 5 ml of starch solution was placed in a test tube and then 3 drops of IKI solution were added. In order to accurately describe how you did things, you need to keep track of your tests, including incubation times and temperatures, in your lab notebook. Also, although it may seem to make sense to say what the result of a procedure was after you describe the procedure, all results should be placed in the results section. This section should be written in your own words, not copied from the lab packet. (For example, the lab packet may say incubate for 48 to 72 hours" but you should say exactly how long you incubated something.) Results: In a single paragraph, describe the physical characteristics of your unknown. This should include both the growth characteristics in different types of media (see "Culture Characteristics" lab), as well as the characteristics on a slide (morphology, arrangement, and color in a gram stain). Also include any morphological characteristics you directly observed such as capsules or spores. Then, construct a table that clearly and concisely shows the results for the metabolic tests done on your unknown. You must include the date each test was set up (Table 2), and the results, not conclusions, should be reported. (In other words, what did you actually see?) Table 2. Example results table. Date of test Test performed Result 9/23/99 Gram stain purple rods 9/25/99 Nitrate reductase Red color upon addition of 1 st reagent Discussion: In this section, you will discuss the significance of your results. (In other words, what does it all mean?) The major questions you asked and decisions you made should be presented in carefully constructed paragraphs (each paragraph should have a topic sentence that is then supported by the rest of the paragraph). Note that this is not a verbal restatement of your results, i.e., in your results section, you should have reported your observation for the test, in your discussion you give your conclusion (positive/negative, present/absent) as well as the significance of each test result. For example, compare the following:

220 Bio260 Page 220 Unknown Project The catalase test bubbled so it was positive. (Repeats results and doesn t give significance.) Then I did the catalase test and it was positive. (Better, but still doesn t give significance.) A positive catalase test indicated that the unknown makes the enzyme catalase which converts H 2 O 2, one of the toxic byproducts of oxygen metabolism, to the more harmless products, H 2 O and O 2. This enzyme helps the unknown bacterium survive in environments with high oxygen concentrations. (Best because it s not repetitive and gives significance.) Note: Your statement of the significance of each test must be written in your own words. Please don t just copy the lab packet. Your discussion should also reveal how you eliminated all possible groups, from your initial Gram stain all the way down to the species level. To accompany your discussion, you should create a chart that shows the eliminations beginning with the taxon you arrived at in Table 1 and continuing down to the species level. You can use whatever format makes the most sense to you, as long as your chart or table includes the names of all eliminated taxa and shows which test(s) led to their elimination. Figures 1 and 2 provide examples of traditional flow charts. Towards the end of your discussion, you should write a paragraph discussing the importance of your unknown bacterium. After you know it's identity, you can research its importance in Bergey s, your text or in other sources (web sources OK, but must be reliable scientific sources such as.edu and.gov sites. Because Wikipedia is open source, it s not considered a valid scientific source). Depending on your species, this may mean discussing the family, genus or species of your bacterium. The defining characteristics of the group in general and your species in particular should be included, as should their significance to humans and common habitats. Information you gathered from Bergey s or other sources should be cited (see references below for proper format). Finally, your discussion should also include a paragraph that discusses any sources of error or possible future directions for your project. If you had difficulties or even made any mistakes during your project, this is the place to talk about them. Remember that I don't necessarily take points off for mistakes, especially if you recognize and learn from them. Remember: For every test you ran, you should include Conclusion (e.g., positive or negative) Significance (what does the test tell you about the structure, metabolism, or pathogenicity of your unknown?) Eliminations (in your flow chart)

221 Bio260 Page 221 Unknown Project Figure 1. A flow chart for identification of Gram-positive bacteria (used with permission from Dr. John Heritage, University of Leeds, from Note: This flow chart is provided as an example of a flow chart; it s not intended for you to use to ID your known. It s perfectly valid and you can use it, but I may not have every test listed.

222 Bio260 Page 222 Unknown Project Figure 2. A flow chart for identification of Gram-negative bacteria (used with permission from Dr. John Heritage, University of Leeds, from Note: This flow chart is provided as an example of a flow chart; it s not intended for you to use to ID your known. It s perfectly valid and you can use it, but I may not have every test listed.

223 Bio260 Page 223 Unknown Project References: This is an alphabetical list of sources used throughout your report. This can include books, manuals, web sources, or personal communications. Please use APA format. Several examples are listed below, and you can get more details at References that do not include a date or source are not acceptable. Proper citation within the text of your report (In-text citation): If you paraphrase or quote a source in the text of your article, you should include a reference to that source within the text. Sources are cited by the last name of the author and the date. For example, S. aureus is commonly found on human skin (Staley, 1989). If there are two authors, both last names are given, for example (Smith & Jones, 2013). If there are more than two, only the first author is given, followed by the latin et al., which means and others. For example, Gram negative bacteria are generally resistant to penicillin (Tortora et al., 2000). Proper citation of references at the end of your report: The alphabetical list of all sources used should appear at the end of the report. All sources used must be listed at the end of the report and all sources listed at the end should be cited within the body of the report. Examples using APA format: For a journal article: Meier, J.L, Folse, D.S., & Smith, J.H. (1983) Leprosy in wild armadillos (Dasypus novemcinctus) on the Texas Gulf Coast: Lab Investigation, 49, 281. If the source is a book or text: Black, Jacquelyn G. (1993) Microbiology: Principles and Applications, 2 nd edition. Englewood Cliffs, NJ: Prentice-Hall. Kratz, R. F. (2013) Microbiology Laboratory Exercises. Everett, WA: Everett Community College. Garrity, G. M., et al.. (Eds.) (2005). Bergey s Manual of Systematic Bacteriology,2 nd edition, volume 2B. New York: Springer. De Vos, P., et al.. (Eds.). (2009). Bergey s Manual of Systematic Bacteriology 2 nd edition, volume 3: The Firmicutes. New York: Springer. If the source is a website: CDC. (2006) Identification of the Gram-positive, catalase-negative cocci genera. In: Identification of other Streptococcus Species: Streptococcus General Methods (Section II). Retrieved from:

224 Bio260 Page 224 Unknown Project If you received verbal information from your instructor or the lab tech: In the body of the report where you use the information, cite the person who gave you the information as follows: (first initial and last name, personal communication, date). For example, (R. Kratz, personal communication, September 12, 2013). It is not necessary to include a reference in your reference list at the end of your report. VII. GRADING The following criteria will be used to evaluate your project and your report. Please note that the process of identification is only part of the project; writing a good report also represents a significant part of the points assigned. These guidelines are presented to give you a clear definition of my expectations so that you may achieve as good a grade as possible. Basic Formatting and Conventions: Paper will not be accepted if it doesn't meet these basic criteria: Separate title page with title, unknown number, and student name Paper organized into separate sections according to scientific reporting standards: Introduction, Materials & Methods, Results, Conclusions & References Each section contains correct type of information Proper formatting of all scientific names Complete sentences with few spelling errors Grammar good enough that paper is easy to read and understand (based on instructor opinion) No plagiarism. (My rule of thumb: If you can pull a piece of information out of your own head, or you find it in three different sources, you don't need to include a reference. Anything you look up, or read and paraphrase, needs a reference.) Grading Criteria: Introduction (5 pts) Engages the reader Includes purpose of project Includes importance/relevance of project Materials and Methods (15 pts) All tests described according to student actual protocol in past tense All materials included as part of description of methods Includes details such as staining times, age of culture used for tests, and incubation temperatures Actual incubation times given in hours or days (not dates) No results or conclusions given Lab packet not directly quoted

225 Bio260 Page 225 Unknown Project Results (20 pts) Includes a description of the physical characteristics of the unknown in different types of media Includes a description of the physical characteristics of the unknown in a Gram stain (and in different staining protocols if performed) Includes a table that documents the results (observations) of all metabolic tests in chronological order No conclusions stated Discussion (25 pts) Conclusions for all tests from the beginning of the project included Significance of all tests from the beginning of the project included Includes a paragraph discussing the significance of the unknown organism to humans Materials & Methods, and Results not repeated. Lab packet not directly quoted Identification Process (not a separate section) (25 pts) The characteristics of the organism chosen to match the unknown do in fact match the characteristics of the unknown. In other words, the identity is possible given the information stated in Bergey's and the characteristics identified by the student Discussion includes a flow chart or table that documents the elimination of each taxon from the moment the student began using Bergey's Manual. The chart or table shows which test(s) was used to eliminate each taxon. Unknown is identified down to the species level All tests run are discussed in the discussion, even tests that proved to be "unnecessary" or mistakes. (You can include these types of tests in your error paragraph -- see instructions above on Discussion section) Tests were run at a steady, appropriate pace. No significant lags of time when work wasn't conducted, and no massive shotgunning of large batches of tests at once Thorough notes from lab journal included with report. Notes are dated and include details about observations and any deviations from instructions in lab packet. (If lab notes aren't included with report, the report will receive a 0 for identification.) References (10 pts) All references used listed at back of report in APA format References cited in body of the report where they were used following APA format Punctuality and Submission of Report Report is due at the beginning of the lab period (within 10 minutes of the start of the lab) on the date listed on the lab syllabus. Late reports will be docked 10% from the total possible for each day they are late. If reports are turned in after the beginning of the lab period on the day on which they are due, they will be considered 1 day late. Except in very special circumstances and by permission from your instructor, electronic copies of papers are not acceptable. Papers will not be considered as turned in until you turn in a complete paper copy to your instructor.

226 Bio260 Page 226 Unknown Project Study Guide Pre-lab questions: 1. What is the proper way to write the scientific name of an organism? Why is important to use this format? 2. What is the taxonomic hierarchy? How is it used? 3. Why is it important to be able to identify bacteria? 4. What is the difference between the classical and molecular methods used for bacterial identification? 5. Why is it difficult to define bacterial species? How are they defined? 6. What are the first four things you should do once you receive your unknown bacterium?

227 Bio260 Page 227 ComGen COMGEN OVERVIEW 14 ComGen Lab # Pre-lab Post-Lab Lab 1 -- do in class If you have a laptop, load FinchTV and bring Clicker Q's laptop to class Lab 2 -- Pipette practice Lab 3 -- Practice Gel Read articles on Wheat Take-All and Micro pipettors (links on Canvas) Take prelab quiz Visit links on gel electrophoresis to learn about how this technique works Write an outline of a protocol for how you think you will do gel electrophoresis in your lab notebook (this will be graded as part of this lab) Take prelab quiz Answer and turn in pipette worksheet Create a reference table in your lab notebook. Turn in copy of table along with your worksheet. Draw your practice gel in your lab notebook Estimate the sizes of your bands by comparing them to the marker DNA Lab 4 -- Set up culture Visit links on DNA sequencing, transformation, and making a genomic library (posted on Canvas) in order to understand the background of this project. Write a rough draft of your understanding of our project (1-2 paragraphs). Included in this should be your introduction to this lab utilizing the background of what has been done for you to get to the point of starting this culture today. (This will become the introduction for your poster.) Take the prelab quiz For all ComGen labs, use the links I've posted in Canvas rather than the ones written in the prelabs. Turn in your prelab work, drawing, and estimate for grading. Record the number of the clone you chose and the identifying information from the plate in your lab book. Calculate the amount of kanamycin that was added to the LB broth for you. The kanamycin started at a concentration of 30mg/ml and is currently at a concentration of 30ug/ml.

228 Bio260 Page 228 ComGen Lab 5, part 1: Spin down cells Lab 5 part 2: Plasmid Purification Lab 6: Checking DNA quality Write an outline for the protocol you think you will use to spin down the cells in your culture. (This outline will be graded as part of this lab) Take the prelab quiz Visit the links about spin kits and alkaline lysis (on Canvas) in order to learn about this protocol. Prepare an outline of the protocol we will use (like the overview protocol from Quiagen that I posted on Canvas). Annotate your outline to indicate what each buffer is doing (you will need to visit the links to figure this out). Take the prelab quiz. Revisit your outline and notes from the practice gel session. We will be using a very similar protocol as we did during that session. Are there any things you learned during the first session that you want to make a note of for this session? Read the pre-lab and take the pre-lab quiz Turn in your background paragraph along with your calculation for grading. Sketch the appearance of your pellet in the microcentrifuge tube Turn in your prelab work and the sketch of your pellet for grading. Turn in your prelab work for grading. Draw or photograph your gel. (if you photograph, paste a photo in your lab book) Measure the distances from the wells to your band and to your marker DNA. Use theprotocol you practiced for the prelab to determine the size of your plasmid. (You do need to make the graph. If you want to get the most accurate estimate, calculate the equation for the line

229 Bio260 Page 229 ComGen Lab 7: Set up for sequencing reaction Lab 8: Clean up from sequencing reaction Lab 9: Bioinformatics Visit the links on PCR and cycle sequencing and read the information on our specific protocol (the plasmid, the primers, Big Dye). Draw our plasmid in your lab notebook and record the sequences of our primers. Write an outline of a protocol for doing PCR. This outline will be graded as part of this lab. Take the prelab quiz. Visit the links on sequencing clean up and look at the protocol for using the Big Dye Xterminator kit Write a purpose statement for today's lab (1-2 sentences about why we're doing it.) Write an outline of the protocol we will use. Take the prelab quiz. If you haven't already, click on the link and take the BLAST tutorial Take the prelab quiz and use that. But, it's also OK to just draw your best fit line, then use the line itself to get a good estimate of your plasmid size) Turn in your prelab work for grading. Turn in your prelab work for grading. Complete the BLAST analysis of your sequence Answer the questions in the prelab in your lab notebook Answer questions 1-11 in your lab notebook and include this information on your poster. You don't have to do the open reading frame activity.

230 Bio260 Page 230 ComGen COMGEN Lab 1: Sequence Data Analysis Objectives: Analyze a small sequence from the ComGen project. Begin to become familiar with sequence analysis using BLAST. Before lab: 1. Since it is the first day of class, no pre-reading is necessary. 2. For background and tutorials on how to do your BLAST analysis and what this all means, view the Lab 9 Bioinformatics. In lab: Analyze your sequence data to determine the genetic sequence. Work with the BLAST analysis to determine what the best matches to your sequence are. Answer the questions below. BLAST stands for Basic Local Alignment Search Tool. It allows you to compare your sequence to all known sequences and find other sequences that are the same or similar (we call that alignment). An online computer program does the comparison and gives you the results you see here. The higher the alignment score, the greater the degree to which the sequences match. Determine your alignment score on the color-coded diagram. If you have good alignment, determine what genetic sequence your stretch of DNA matches on the table that follows your alignment diagram. 1. Write out your sequence. 2. Did you have difficulty identifying any of the nucleotides? Explain. 3. Why are we using colors to identify nucleotides? What is the sequencer actually recording? 4. What level of alignment did you get from your sequence? 5. What is the most likely identity of your sequence match and what organisms is it from? How did you determine this? 6. What is the accession number for your match? What does this tell you? 7. Give the names of organisms and/or proteins that give significant E-values. Note that the E-value is a statistical value that tells you the likelihood of your sample not matching the listed sequence. E-values less than 0.01 are desirable. 8. What would you do next with your sequence data?

231 Bio260 Page 231 ComGen Lab 2: Introduction to ComGen and Molecular Biology Techniques Objectives: Implement use of standard molecular biology lab equipment (pipetters). Understand safety measures in a molecular biology laboratory. Begin your laboratory notebook. Describe the significance of Pseudomonas fluorescens. Describe the National Science Foundation project we are involved with. Before lab: 3. Read through the instructions for keeping a lab notebook. Set up your lab notebook. Bring it to lab with the following things completed: Table of contents First lab titled First lab introduction/background written 4. Read this article on Wheat Take-All and the role of Pseudomonas: 5. Read the following site s description of the pipetters so that you are prepared to use them during lab: In lab: Practice using each of the sizes of pipetters. Make sure that you know which tip works best with each pipette. You should know what 1ul, 10ul, 100ul and 1000ul looks like in a tip before and after dispensing. This will ensure that you are pipetting accurately. This is crucial to the success of your experiments. How can you make sure that you are pipetting the correct amount? How can you make sure that you are consistently doing it correctly?

232 Bio260 Page 232 ComGen Objectives Lab 3: Making and Running Gels Demonstrate the ability to make and run electrophoresis gels. Demonstrate an understanding of electrophoresis and running different percentage gels. Before Lab Familiarize yourself with the features of gel electrophoresis. There are several resources at this web site that may help you. Write your background on what gels are and what they are used for. What allows them to do what they do? What materials go into the gel? How can you see what is in the gel? Write a protocol for pouring and running an electrophoresis gel. The resources above should give you the information that you need to write this procedure. Be sure to note the percentage of your gel. o Questions to consider: What difference does the percentage of agarose in the gel make? Why do we add stain? What stain should we use? What does it do? What is a 1kb ladder? What does it do? What running buffer will you use? What does it do? In Lab Pour an agarose gel. Add stain to the gel. After the gel is set, load a 1kb ladder and a DNA sample then run the gel. Image the gel when it is done with a camera or drawing.

233 Bio260 Page 233 ComGen Lab 4: Introduction to Pseudomonas fluorescens project and Begin Culture Objectives 1. Execute the beginning of a bacterial culture 2. Understand the overall picture of the project that we are doing in lab this quarter Before Lab: 1. View this animation for a basic introduction to the project we will undertake this quarter: 2. Make sure that you understand DNA sequencing as illustrated in this animation 3. View the documents here for more information on sequencing: In particular, look at the Steps in Genome Sequencing link to see an overview of our project. 4. The sequencing library for this genome was made for us. What we have are individual plasmids with pieces of the genome in them. These plasmids have been transformed into bacteria. This is the culture that you will begin in lab today. For an overview of the transformation procedure to make these cultures, see this link: 5. Write a rough draft of your understanding of our project to be refined in lab. Included in this should be your introduction to this lab utilizing the background of what has been done for you to get to the point of starting this culture today. 6. We will culture E. coli in LB broth. Find information on what LB stands for, what LB broth is, what is in it and why it is good for bacterial growth (a good place to start is here Our LB broth will contain Kanamycin. Find information on what Kanamycin is and why it is important for our experiment. 8. Find information on how to inoculate a broth with E. coli. Many videos are available on YouTube (such as 9. Write a protocol for starting a bacterial culture using the information and links above. In lab: 1. Follow the protocol you brought to class, with any modifications based on the discussion in class. 2. For each step involving a container, preloosen all lids before transferring solutions. 3. Calculate the amount of kanamycin that was added to the LB broth (this has already been done). The kanamycin started at a concentration of 30mg/ml and is currently at a concentration of 30ug/ml. Include this calculation in your materials or methods section. 4. A representative of your group may need to come back to spin down your culture and store in the freezer.

234 Bio260 Page 234 ComGen Lab 5: Plasmid Purification Objectives: To spin down E. coli cells prior to alkaline lysis. To execute alkaline lysis DNA isolation of a plasmid containing a piece of Pseudomonas fluorescens DNA Before Lab: Write out a protocol for spinning down your culture. This is a simple procedure where you will use a centrifuge to spin your bacterial cells to the bottom so that you can discard the broth. Note that you will need to transfer the cells from 3ml of broth into one 1.5ml tube. How will you do this? Leave room to add details during lab. We are using a Qiagen Miniprep kit to isolate our plasmid DNA. For information on the procedure we will follow, look at the Qiaprep Miniprep Handbook: (if this link is not working properly, copy and paste it into a web browser). We will be using the QiaPrep spin procedure in a microfuge (found on page 22 and 23, with a visual partial explanation on page 21). Use this information to introduce this lab in your lab notebook. The handout also gives some background information starting on page 11. Note that you will need this procedure for the lab. For more information about plasmid minipreps and what you will find in each solution, look here: here: here: here N.pdf and here: Prepare the protocol for your lab notebook. Make sure that you indicate what the chemicals are for each step of the procedure and indicate what they are doing to the cell to get the DNA out. This information should be included either in your background information or in your methods section. In Lab: Spin down your culture using your protocol. Additional notes: o Check the turbidity of your broth culture. If it is not turbid, discard the culture and start a new inoculation. o Transfer all of your culture to a 1.5ml tube. o When discarding supernatant, be careful to not disturb the pellet. It is ok to leave a small amount of supernatant. Prepare your DNA following the instructions in the Qiagen handout. Again, write out a detailed protocol as you conduct the lab that goes beyond the information on the handout.

235 Bio260 Page 235 ComGen Objectives Lab 6: Check DNA Quality and Quantity To look at the DNA that was made, and determine if there is enough to PCR. To determine the size of our genomic insert into the plasmid. Before Lab Have a final copy of the procedure for pouring and running a gel for your lab notebook. Bring a camera so that you can record your gel for posterity. In Lab Pour and run the gel to check your DNA compared to a size standard. o Note on procedures: Add loading dye to your samples before loading the gel, add 2ul loading dye to 5ul plasmid DNA. Mix on parafilm. Compare 7ul 1kB ladder to 5ul DNA with 2ul Loading dye. If the DNA is not at least as dark as the most comparable 1kB ladder band, this means that the quantity of DNA is low. You will need to redo your DNA prep.

236 Bio260 Page 236 ComGen After lab: Include an analysis of your DNA size compared to the DNA ladder that you used. o How to calculate your DNA size, an example: Below is an example of a completed gel electrophoresis. The molecular mass ruler (MMR) is a sample of DNA fragments of known length (measured in base pairs). The next step would be to calculate the exact number of base pairs for the DNA fragments in all of your samples, based on the lengths of the molecular mass ruler (MMR). On the gel below, write the band sizes next to the bands for the molecular mass ruler. Here are the band sizes (measured in base pairs): 5000, 2000, 850, 400, 100. Now, write the approximate band size on top of each band in column 1 only. You will need to look up the sizes of the mass ruler that you actually used. M The real procedure for calculating band lengths is a bit more precise! This is important if the results could put someone in jail! The procedure involves using a ruler to measure the actual distance to each of the bands in the MMR. The following is a hypothetical data set for the MMR in your example above. The data set was used to create a graph of distance traveled versus the number of base pairs. We then created a line of best fit. Using the equation of the line, calculated the EXACT number of base pairs in the 3 bands in column 4 (see above gel). You will need a ruler to measure the distance to the bands in centimeters. Write the exact number of base pairs next to the bands in the drawing above.

237 Bio260 Page 237 ComGen Molecular Mass Ruler Data set. This is an example.generate your own. Base Pairs Distance traveled (cm)

238 Bio260 Page 238 ComGen Lab 7: Sequence Reaction Setup Objectives: Amplify the DNA fragment using BigDye Terminator nucleotides to prepare the sample for sequencing. Before Lab: Read the section of your text on PCR reactions so that you understand what you ll be doing in the lab. Take a look at this link for more information on general PCR used in forensics - *Important Note* - you will not be running normal PCR. The purpose of this lab is to run a sequencing reaction. This will amplify your DNA fragment into many different sized strands to be read by the sequencer. Review the following links from Lab 4 to make sure you understand what you will be doing: o ex.html o o This is specific information on the plasmid that our DNA library was cloned into o click on the description tab and scroll to the bottom of the page to the plasmid illustrations (we are using the psmart HCKan). Make sure that you have the primer sequences for your lab book. See this reference: o scroll to the bottom to view the SL1 and SR2 sequences. Make sure that you understand using the BigDye Terminator reagents in PCR to prepare the sequencing reaction. Use the procedures and reagents listed in chapter 3 of the manufacturers handbook on BigDye Terminator Reactions. Note that we are conducting the reaction in microcentrifuge tubes and we do not have large DNA templates. ments/cms_ pdf You may need to copy and past this link into your browser for it to work. Begin to write a protocol for the sequencing reaction using the information above. Include what each step and reagent is and does in the tube. The Big Dye terminator contains all of the materials needed to run the sequencing reaction except for primers.

239 Bio260 Page 239 ComGen In Lab: Follow the procedures in your protocol with any modifications discussed at the start of class. o Note that we will use different amounts of the reagents than suggested in the BigDye Terminator handbook: 2ul of 5X buffer 1ul of your plasmid sample 1ul of SL1 OR SR2 in the appropriate tube 2ul of 5X Big Dye Terminator Add enough ddh 2 O to bring the reaction mixture up to 10ul o Label 2 PCR tubes with your initials, the clone letter and number, the date, and SL1 or SR2. Labels should be made on colored masking tape that is applied to the tube. Labels should not be written on the tube itself because they will disappear in the thermocycler. The tape should only be on the top 1/3 of the tube. Label the tape width-wise; the tape width fits perfectly around the tubes. o Centrifuge tubes for 10-15s. o Place tubes in the thermocycler. When pipetting such small quantities, deposit the reagents on the sides of the tube to visually verify that the reagent has been deposited.

240 Bio260 Page 240 ComGen Lab 8: Sequencing Reaction Cleanup Objectives: Clean up the sequencing reaction so that it is sequencing quality. Before Lab: Now that the sequence reaction is completed, you need to clean up your product before sequencing. Start writing your introduction, including what molecules are in your PCR tubes that should be removed before sequencing. How will these molecules interfere with the sequencer? Find a procedure to clean up PCR or sequencing reactions. You need to bring a sheet to lab with your procedure and a summary of how it cleans up the DNA. There are many companies that sell these things but you could check Qiagen, Applied Biosystems, Bio- Rad, Edge Bio. If it is a kit, you need to print the instructions for the kit. For your procedure, include what each step and reagent is and does. In Lab: Cleanup your sequencing reaction using the procedures discussed in class. Your DNA is now ready to be sequenced. You will need to add them to the sequencer box in the order shown by your instructor.

241 Bio260 Page 241 ComGen Lab 9: Bioinformatics Lab Objective To analyze the DNA sequences that you receive Before Lab Go to this web site and click the green arrow to progress through the tutorial on doing BLAST. Use one of the test sequences at this web site to practice running a BLAST: If you are going to do this on your computer, you will need to download a free version of the sequence software FinchTV (for PC) or 4 Peaks (for Mac) When we get your sequence file, we will upload it into FinchTV (or 4 Peaks) and directly from there we can link your sequence into the BLAST bioinformatics tool. (In Finch go to Edit and then BLAST your sequence). Complete the What is an Open Reading Frame activity at the end of this handout. Before or During Lab BLAST your sequence. Run 3 different BLASTs for each sequence: nucleotide BLAST, translated query to protein BLASTx and translated query to translated database tblastx. Using data from each of your 3 BLASTs, answer the questions below about the BLASTed sequence. Questions Be sure to include the source of the information along with your answer. In this case, the source will be the database or web page that provided the information. 1. How long is the sequence that was used to search the database? o This sequence is called the "query" sequence because you used it to ask a question (or query) of the database. 2. What is the most likely identity of this sequence? Is it a gene or a part of a complete genome? What data support this conclusion? o Refer to the slide in the BLAST tutorial that discusses the E value. 3. What organism was the most likely source of the sequence? o Refer to the BLAST tutorial to find an overview of the GenBank nucleotide record. If more than one organism matches, look at the E values to determine the most likely match. 4. How is this organism classified? o Refer to the taxonomy database. The BLAST tutorial shows how to find the link. 5. What is the accession number for the best-matching sequence? 6. Estimate the number of sequences with an E value less than o Refer to the blast results.

242 Bio260 Page 242 ComGen 7. If possible, give the names of three different organisms with significant E values. If an organism is represented, then write down the name of that organism. o Refer to the BLAST tutorial slide on E values for a description. 8. Look at the first matching sequence; determine the length of the alignment and the fraction of nucleotides that match your sequence. Draw a picture to represent the alignment between the two sequences and include the starting and ending map positions for the both sequences. 9. Is this sequence expressed? How do you know? o Gene expression includes the processes of transcription (making RNA) and translation (making a protein). Determine if either of these molecules is described in the sequence record. Also view your results of the BLASTx and tblastx to find if the sequence is expressed. 10. Is anything known about factors that cause your sequence to be expressed? o The title of the submission is a good place to start. PubMed records and the Entrez Gene database are also helpful. In some cases, however, you will probably need to look at other sources of information, such as the UniGene database and the Gene database. If your BLAST results show boxes with U's or G's those are links to the UniGene and Gene databases respectively. 11. Use GenBank, PubMed, Gene, and UniGene records to find the possible function of the protein that is specified by your DNA sequence. Describe what the protein does, where it is located in the cell and any other information you find. What is an Open Reading Frame? To get a better idea of how the translated blasts (BLASTx and tblastx) work, follow the procedures below to investigate open reading frames. 1. Pick one of your sequences. Select a 70 base section that has good clean sequence. 2. Paste that sequence into a word document. For example: 5 catccgcgcatggcattggctaaacggatgattcaaaacacccaagtcaatgaacggtatctggtcttgc 3 3 gtaggcgcgtaccgtaaccgatttgcctactaagttttgtgggttcagttacttgccatagaccagaacg 5 3. On the next line type in the complementary sequence (see red sequence above). 4. Now start translating this sequence. Yes I know you do not normally translate DNA but when you don t know where the genes are this is how to find out. The question is which strand do you translate and where do you start? As we don t know the answers to those questions we cover all the possibilities. 5. Pick the top strand, start translating at the 5 end using the three letter codons listed in the genetic code table below (what do you do about the Us in the codon table?), start at the first base and keep going until you reach the end; then start at the second base and continue until the end and then start with the third base and continue till the end. 6. Now do the same thing with the second strand.

243 Bio260 Page 243 ComGen Do not worry about one or two extra bases (why did I say one or two extra bases and not three?) at the end of each sequence. 7. Translate the open reading frames into polypeptides. Stop codons are show by a *. Amino acids coded for by each codon is shown by a single letter code (see the codes below). 8. The end your sequence should look like this but completed all the way to the end: 5 catccgcgcatggcattggctaaacggatgattcaaaacacccaagtcaatgaacggtatctggtcttgc 3 3 gtaggcgcgtaccgtaaccgatttgcctactaagttttgtgggttcagttacttgccatagaccagaacg 5 +1 cat ccg cgc atg gca ttg gct aaa cgg atg att caa aac acc caa gtc aat gaa cgg tat ctg gtc ttg c H P R +2 c atc cgc gca tgg cat tgg cta aac gga tga ttc aaa aca ccc aag tca atg aac ggt atc tgg tct tgc I R A +3 ca tcc gcg cat ggc att ggc taa acg gat gat tca aaa cac cca agt caa tga acg gta tct ggt ctt gc S A L -3 gt agg cgc gta ccg taa ccg att tgc cta cta agt ttt gtg ggt tca gtt act tgc cat aga cca gaa cg R T K -2 gta ggc gcg tac cgt aac cga ttt gcc tac taa gtt ttg tgg gtt cag tta ctt gcc ata gac cag aac g E R N -1 g tag gcg cgt acc gta acc gat ttg cct act aag ttt tgt ggg ttc agt tac ttg cca tag acc aga acg * 9. Did you get a full set of amino acids with no *s in all 6 open reading frames? 10. What if you get more than one ORF? 11. Look at your BLASTx and tblastx results which of these ORFs were similar to proteins (real or predicted) in the database? 12. Do we have to consider introns?

244 Bio260 Page 244 ComGen Symbol Name 3-Letter 1-Letter Alanine Ala A Arginine (arginine) Arg R Asparagine Asn N Aspartic acid (AsparDic Asp D acid) Cysteine Cys C Glutamic Acid (GluEtamic Glu E acid) Glutamine (Qtamine) Gln Q Glycine Gly G Histidine His H Isoleucine Ile I Leucine Leu L Lysine (likesine) Lys K Methionine Met M Phenylalanine Phe F (Fenylalanine) Proline Pro P Serine Ser S Threonine Thr T Tryptophan (twytophan) Trp W Tyrosine (tyrosine) Tyr Y Valine Val V Unknown or "other" X