Expression Level of pmra Gene in Streptococcus pneumoniae and Its Association with Fluoroquinolone Resistance

Transcription

1 Original Article Vol. 24 No. 1 Expression of pmra gene in Streptococcus pneumoniae:- Kumari N, et al. 19 Expression Level of pmra Gene in Streptococcus pneumoniae and Its Association with Fluoroquinolone Resistance Navindra Kumari, B.Sc.*, Geetha Subramaniam, Ph.D*, Parasakthi Navaratnam, MBBS**, Shamala Devi Sekaran, Ph.D.* ABSTRACT Invasive pneumococcal diseases including pneumonia, bacteremia, and meningitis, are major causes of significant morbidity and mortality. Fluoroquinolone resistance in Streptococcus pneumoniae has been detected in the neighbouring countries such as Korea, Taiwan, and Hong Kong but has yet to be reported among Malaysian isolates. The aim of this study was to measure the level of expression of the pmra gene in S. pneumoniae isolates in Malaysia and the association of this gene with fluoroquinolone resistance. Polymerase chain reaction amplification and sequencing of the pmra gene was carried out. There was no significant correlation found between expression of the pmra gene in S. pneumoniae isolates and susceptibility levels of fluoroquinolones. (J Infect Dis Antimicrob Agents 2007;24:19-28.) INTRODUCTION Streptococcus pneumoniae is an important bacterial pathogen, and is a major cause of otitis media, pneumonia, sinusitis, meningitis, and septicemia. It is frequently associated with significant morbidity and mortality. 1 The drug of choice for treatment of pneumococcal infections was mainly penicillin until the 1980s. There have been increasing reports of penicillin resistance among S. pneumoniae strains, and reports of therapeutic failures with treatment with penicillin and also with other beta-lactams. The development of multidrug resistance in S. pneumoniae has prompted the need for alternative therapies in the management of pneumococcal infections. 2,3 This led to an increasing usage of the new fluoroquinolones against S. pneumoniae (sparfloxacin, levofloxacin, gatifloxacin, and moxifloxacin). However, the broad usage of fluoroquinolones has been followed by the emergence *Department of Medical Microbiology, Faculty of Medicine, University of Malaya, Kuala Lumpur, Malaysia. **School of Medicine and Health Sciences, Monash University Malaysia, No. 20 & 22, Jalan PJS 11/5, Bandar Sunway, Petaling Jaya. Received for publication: December 19, Reprint request: Shamala Devi Sekaran, M.D., Department of Medical Microbiology, Faculty of Medicine, University of Malaya, Kuala Lumpur, Malaysia. shamalamy@yahoo.com Keywords: pmra, efflux pump, Streptococcus pneumoniae, antibiotic resistance, fluoroquinolone resistance 19

2 20 J INFECT DIS ANTIMICROB AGENTS Jan.-Apr of resistance to fluoroquinolones, which is mainly due to point mutations in genes encoding the subunits of the drugs target enzymes, DNA gyrase (gyra and gyrb genes) and topoisomerase IV (parc and pare genes) termed the quinolone resistance-determining region (QRDR). 3-6 Another mechanism associated with fluoroquinolone resistance in S. pneumoniae is the altered efflux mechanism. This mechanism causes a smaller increase in the MIC of norfloxacin, and the addition of efflux pump inhibitors has been shown to decrease the MIC of fluoroquinolones of a particular strain. 7-9 This suggests the presence of an active efflux pump in S. pneumoniae. A putative efflux pump for fluoroquinolones encoded by the pmra gene has been previously described. 10 The pump mediated low-level resistance to norfloxacin, ethidium bromide, and acriflavine. In this study, we determined the level of expression of the pmra gene in S. pneumoniae strains with reduced susceptibility to ciprofloxacin, compared to standard fluoroquinolone-resistant strains. The strains used in this study were the clinical isolates in Malaysia. Although fluoroquinolone resistance has not been reported in Malaysia, nevertheless it is a potential threat. Recent reports of resistance in other neighbouring countries may herald the emergence of fluoroquinolone resistance in Malaysia. Therefore, in this study we describe the effect of different expression levels of the pmra gene in association with fluoroquinolone resistance, hence leading to a better understanding of the mechanisms involved in the development of fluoroquinolone resistance. MATERIALS AND METHODS Bacterial strains One hundred pneumococcal isolates were obtained from clinical samples processed in Microbiology Laboratory of the University Malaya Medical Centre, Malaysia, from March 1999 to December The isolates were obtained from invasive and noninvasive sites of both paediatric and adult patients, and stored in brain heart infusion broth supplemented with 10 percent glycerol at -80C. Each stock culture was kept in triplicate to avoid multiple passaging. The source of the isolates included blood, nasopharyngeal secretions, tracheal secretions, sputum, and bronchoalveolar lavage. The fluoroquinolone-resistant strains were obtained from Professor Jae Hoon Song from Samsung Medical Centre, Sungkyunkwan University, Korea, and were used as the reference strains in this study. Strain identification Identification of the strains was confirmed by susceptibility to ethylhydrocupreine disc (optochin), whereby all the 100 strains showed a diameter measurement of 14 mm. 11 The strains were shown to be positive by bile solubility testing, and were also catalase negative. Susceptibility testing Antibiotic susceptibility of the strains was tested on Mueller Hinton Agar (Oxoid) plates containing 5 percent sheep blood (Oxoid), incubated at 37C with 5 percent CO 2, using the agar dilution method described by the Clinical and Laboratory Standards Institute. The antimicrobial agents used were penicillin, cefotaxime, ceftriaxone, and erythromycin and the powder forms were obtained from Sigma Aldrich (Sigma Chemical Co., St. Louis, Mo., USA). S. pneumoniae ATCC was used as the control. Strains were also tested against ciprofloxacin (Bayer, Q.F., Barcelona, Spain), moxifloxacin (Bayer, Q.F, Barcelona, Spain), gatifloxacin (Bristol-Myers Squibb, New Jersey, USA), and levofloxacin (Daiichi, Japan). The criteria for resistance to ciprofloxacin was determined as 2 g/ml.

3 Vol. 24 No. 1 Expression of pmra gene in Streptococcus pneumoniae:- Kumari N, et al. 21 DNA extraction Genomic DNA was extracted from pure bacterial cultures using a method previously described. 12 Bacterial colonies suspended in 15 ml of dh 2 O containing 50 mg/ml lysostaphin (Sigma Chemical, Co., St. Louis, Mo) were incubated at 37C for 10 minutes. This was followed by addition of 10 g/ml proteinase K and 0.1 mm Tris HCL ph 7.5 and incubated at 37C for another 10 minutes. Subsequently, the suspension was boiled for 5 minutes and finally centrifuged at 13,000 rpm for 2 minutes. The supernatant obtained acts as the template in the polymerase chain reaction (PCR) reaction for detecting the genes encoding the QRDRs. RNA extraction RNA was extracted from the bacterial culture at the mid-log phase using the hot acid phenol method as described previously. 13 Ten ml of bacterial culture was centrifuged at 4,000 rpm for 10 minutes and the pellet was harvested. The pellet was then treated by boiling with hot acid phenol for 10 minutes. The mixture was then immediately cooled on ice before being centrifuged at 8,000 rpm for 20 minutes. The supernatant was then treated with acid phenol/chloroform (1:1) and centrifuged at 8,000 rpm for 20 minutes. Chloroform was then added to the supernatant and centrifuged again at 8,000 rpm for 15 minutes. Subsequently, the supernatant was precipitated with 0.3 M sodium acetate and isoproponal (1 volume) and incubated on ice for 20 minutes. The mixture was then centrifuged at 8,000 rpm for 15 minutes and the pellet was washed with 70 percent ethanol. Finally, the pellet obtained was air dried and resuspended in RNase-free water. The RNA obtained was stored at -80C till further use. PCR amplification of the gene encoding the efflux pump, pmra Primers were designed to flank the pmra gene 21 using the primer3 software. The primer sequences are as below: pmra (Forward): 5 GACAAATACGGCCGAAAA CCCATGATG-3 pmra (Reverse): 5 TGTTGGAATAGCCTTTTCCT TGGCTAC-3 The optimal PCR condition for a 50 ml reaction included 1X PCR buffer, 1.5 mm MgCl2, 0.2 mm dntp mix, 2U Taq polymerase (Fermentas) and 20 pmol of each primer. The PCR cycling parameters were as follows: an initial denaturation step at 95C for 2 minutes, then 15 cycles of amplification were performed: first denaturation at 94C for 15 seconds, followed by annealing temperature at 52C for 30 seconds, an extension temperature at 72C for 15 seconds, and finally completed with an extension at 72C for 2 minutes. The amplification reaction was performed in an Eppendorf Gradient Mastercycler. The PCR product was electrophoresed on a 2 percent TAE agarose gel for 1 hour at 70V and the bands were analyzed using a UV transilluminator. PCR DNA sequencing PCR products were purified using the PCR Purification Kit (Qiagen) and PCR DNA sequencing was carried out using an automated DNA sequencer (an ABI Prism 377 DNA sequencer, Perkin Elmer ABI). Expresssion of the pmra gene using reverse transcriptase (RT) real-time PCR Real-time PCR was used to measure the expression level of the pmra gene. The optimal PCR condition for a 25 ml reaction included iq SYBR Green I RT-PCR reaction supermix (BioRad Laboratories) containing optimized PCR buffer, hot start itaq DNA polymerase, dntp mix, SYBR Green I dye, iscript reverse transcriptase (BioRad Laboratories) and

4 22 J INFECT DIS ANTIMICROB AGENTS Jan.-Apr primers ranging from pmol. The samples underwent cdna synthesis step at 50C for 20 minutes and an initial denaturation step at 95C for 5 minutes followed by 35 amplification cycles, each comprising: denaturation (94C for 30 seconds), annealing (55C for 30 seconds), and extension (72C for 50 seconds). A final extension step was also incorporated (72C for 10 minutes), before a melting curve was recorded. The temperature transition rates were programmed at 0.5C/second and the fluorescence was measured at the end of the annealing period of each cycle to monitor the progress of amplification. After completion, the melting curve was recorded. Fluorescence was measured continuously during the slow temperature rise to monitor dissociation. The amplification reaction was performed in an icycler thermacycler (Biorad, Laboratories). The analysis of results was carried out using the available software (Genex). RESULTS AND DISCUSSION Antimicrobial susceptibility The pneumococcal strains were assigned as fluoroquinolone-susceptible strains or fluoroquinolone reduced-susceptibility strains based on their MIC values against ciprofloxacin, which was used as a marker of resistance in this study. Of the 100 strains tested to ciprofloxacin, 8 strains had an MIC value of 4.0 g/ml, 48 strains had an MIC value of 2.0 g/ ml, 38 strains had an MIC value of 1.0 g/ml, and 6 strains had an MIC value of 0.5 g/ml. Ninty-three percent of all these strains were susceptible to moxifloxacin, with 6 percent of the strains exhibiting intermediate susceptibility. Ninty-five percent of the strains were susceptible to levofloxacin, with only 5 percent having intermediate susceptibility. Eightyeight percent and 12 percent of the strains were susceptible and intermediately susceptible to gatifloxacin, respectively. Expression of pmra RT PCR was used to identify the mrna expression levels of the pmra gene in the 56 strains with reduced susceptibility to ciprofloxacin. The pmra gene was amplified in parallel with the bacterial 16S rrna gene for each strain. The levels of mrna detected were normalized against the bacterial 16S rrna gene of the same strain, in comparison to nine other reference strains which were known to be fluoroquinolone resistant. The CT values as a result of the real-time amplification of the strains are shown in Table 1. Of the 56 strains with reduced susceptibility to ciprofloxacin, 38 had expression of the pmra gene and 18 had no expression of the pmra gene (data not shown). Of the 38 strains expressing the pmra gene, 26 strains had overexpression, whereas 12 strains had low level expression (Figure 1). Note that the mrna expression level for 5 strains (1, 31, 58, 91, and 99) was so low that they are not clearly seen in Figure 1. However, these are better shown quantilatively in Tables 2 and 3. Table 2 shows overexpression of the pmra gene in 26 strains, and Table 3 shows low-level expression in 12 strains. Strains with an expression value of 1.0 were considered over expressed, whereas those with an expression value of <1.0 were considered to represent low-level expression. In Table 2, it can be seen that strains 9, 40, 68, 87, 95, and 98 (in bold) showed a very high expression of the pmra gene, measuring of , 23.57, 10.26, 9.57, 31.1, and 9.57 mrna copies, respectively. Strains 9 and 40 were susceptible to other fluoroquinolones (levofloxacin, moxifloxacin, and gatifloxacin), whereas strain 68 was susceptible to moxifloxacin but intermediately susceptible to levofloxacin and gatifloxacin. This shows poor correlation of the expression of the pmra gene with the susceptibility levels to fluoroquinolones.

5 Vol. 24 No. 1 Expression of pmra gene in Streptococcus pneumoniae:- Kumari N, et al. 23 Table 1. Ct values of real-time PCR amplification for both pmra and 16S rrna genes and the ratio of pmra to 16S RNA. Strains Ct Value (16S rrna) Ct value (pmra) Ratio (pmra: 16S rrna)

6 24 J INFECT DIS ANTIMICROB AGENTS Jan.-Apr Table 2. Antibiotic susceptibility profiles of strains with overexpression of the pmra gene. Strains Pen Ery Cro Ctx Cip Lvx Mox Gat Expression level (mrna copies) < < < < < > > < < < < > > > > <0.032 < > < < < Pen: penicillin, Ery: erythromycin, Cro: ceftriaxone, Ctx: cefotaxime, Cip: ciprofloxacin, Lvx: levofloxacin, Mox: moxifloxacin, and Gat: gatifloxacin The MIC breakpoints for all antibiotics are as follows: pencillin [susceptible (s): 0.06, intermediately (I): , and resistant (R): 2.0 μg/ml], erythromycin (S: 0.25, I: 0.5-1, and R: 2.0 μg/ml), ceftriaxone and cefotaxime (S: 0.5, I: 1.0, and R: 2.0 μg/ml), levofloxacin (S: 2.0, I: 4.0, and R: 8.0 μg/ml), and moxifloxacin and gatifloxacin (S: 1.0, I: 2.0, and R: 4.0 μg/ml).

7 Vol. 24 No. 1 Expression of pmra gene in Streptococcus pneumoniae:- Kumari N, et al. 25 mrna copies Expression of pmra gene S. pneumoniae strains Figure 1. Expression levels of the pmra gene. Table 3. Antibiotic susceptibility profiles of strains with low-level expression of the pmra gene. Strains Pen Ery Cro Ctx Cip Lvx Mox Gat Expression level (mrna copies) < < < > < < > < Pen: penicillin, Ery: erythromycin, Cro: ceftriaxone, Ctx: cefotaxime, Cip: ciprofloxacin, Lvx: levafloxacin, Mox: moxifloxacin, and Gat: gatifloxacin. 25

8 26 J INFECT DIS ANTIMICROB AGENTS Jan.-Apr Analyses of the DNA sequences of the genes encoding the QRDRs, gyra, gyrb, parc, and pare, from 8 representative S. pneumoniae Malaysian strains revealed 2 strains (98 and 99) with mutation in the gyra gene at codon Ser81 (unpublished data). One hundred isolates were screened for the presence of gyra, gyrb, pare, and parc genes using PCR. Both fluoroquinolone-susceptible and -reduced-susceptible strains showed the amplification of these genes. Eight representative strains were chosen and sequenced to determine the mutation sites within the QRDR of these four genes. Sequencing of representative strains with various MIC levels to ciprofloxacin, levofloxacin, moxifloxacin, and gatifloxacin identified the mutations within the gyra and parc genes. There were no mutations detected within the gyrb and pare genes (Table 4). Only two strains that were sequenced identified to have point mutations at position Ser81, which has been previously reported to confer fluoroquinolone resistance. Strains 64 (MIC to ciprofloxacin of 0.5 g/ml), 10 (MIC to ciprofloxacin of 2.0 g/ml), 91 (MIC of ciprofloxacin of 1.0 g/ml), and 1 (MIC of ciprofloxacin 1.0 g/ml) showed no mutation within the gyra gene, while strains 96, 97, 98, and 99 with MIC to ciprofloxacin of 4.0 g/ml) had multiple mutation sites, some of which were silent with no amino acid substitutions. However, strains 98 and 99 had a point mutation at position Ser81 with an amino acid substitution of serine to phenylalanine. Other hot spots identified within the gyra gene of strain 96 were the substitution of amino acid sequences at position 99 (methionine to isoleucine), 170 (threonine to proline), 214 (aspartic acid to aspara gyne) and 224 (lysine to asparagyne). Strain 97 had amino acid changes at position 201 (valine to methionine) and 202 (threonine to proline). Sequencing of the parc gene showed multiple mutation sites in these strains with mutation site Asn38Ser being common in all the strains. Strain 10 had two additional mutations within the parc gene which were Ala115Val and Arg124Ile, while strain 1 had the same additional mutation at position Arg124Ile. However, in this study, the pmra gene was expressed in strain 98, but low-level expression was detected in strain 99. The antibiotic susceptibility profiles of these two strains were similar, and this example shows no correlation seen between the level of expression of the pmra gene and mutation in the gyr gene at position Ser81. This would suggest that there could be an interplay of other efflux pumps simultaneously in the development of antibiotic resistance in S. pneumoniae. A previous study 14 has suggested that overexpression of the pmra gene does not contribute to fluoroquinolone resistance other than norfloxacin. Therefore, this suggests that newer fluoroquinolones such as ciprofloxacin, levofloxacin, gatifloxacin, and moxifloxacin might not be substrates for the pmra efflux. Hence, the correlation of pmra gene expression and fluoroquinolone susceptibility could not be drawn definitely. In order to elucidate the role of pmra gene, the MIC levels should be monitored with an addition of an efflux pump inhibitor, reserpine. Further extensive studies on several other putative efflux pump genes found in the S. pneumoniae genome could be beneficial for a better understanding of the role of efflux pumps in the development of antibiotic resistance in S. pneumoniae. As a conclusion, a further study with more number of isolates would be useful to monitor the development of fluoroquinolone resistance in Malaysia. ACKNOWLEDGEMENT This work was supported by Intensive Priority Research Area (IRPA) grant provided by the Ministry of Science and Technology, Malaysia: We would like to thank Professor Jae Hoon Song from

9 Vol. 24 No. 1 Expression of pmra gene in Streptococcus pneumoniae:- Kumari N, et al. 27 Table 4. DNA sequence analysis of the genes encoding the quinolone resistance-determining region (QRDR) in the eight representative isolates. Nucleotide and amino acid changes encoded by mutations in the gyra, gyrb, parc, and pare gene loci are shown. A dash (-) denotes a wild type sequence with no mutations identified. Position numbers are based on the gyra, gyrb, parc, and pare sequences of S. pneumoniae strain R6. gyra parc gyrb pare Strains Nucleotide Amino acid Nucleotide Amino acid Nucleotide Amino acid Nucleotide Amino acid changes substitution changes substitution changes substitution changes substitution AAC-AGA Asn38Ser GCC-GTT Ala115Val AGA-ATA Arg124Ile 97 GTG-ATG Val201Met AAC-AGC Asn38Ser ACT-CCT Thr202Pro TCC-TTC Ser81Phe AAC-AGC Asn38Ser TCC-TTC Ser81Phe AAC-AGC Asn38Ser S AAC-AGC Asn38Ser ATG-ATA Met99Ile AAC-AGC Asn38Ser ACT-CCT Thr170Pro GAC-GAT GAT-AAT Asp214Asn AAT-AAT Lys224Asn AAC-AGA Asn38Ser AGA-ATA Arg124Ile AAC-AGC Asn38Ser

10 28 J INFECT DIS ANTIMICROB AGENTS Jan.-Apr the Samsung Medical Centre, Sungkyunkwan University, Korea for providing the fluoroquinolone resistant strains. References 1. Bartlett JG, Mundy LM. Community-acquired pneumonia. N Engl J Med 1995;333: Drlica K. Mechanism of fluoroquinolone action. Curr Opin Microbiol 1999;2: Pan XS, Ambler J, Mehtar S, Fisher LM. Involvement of topoisomerase IV and DNA gyrase as ciprofloxacin targets in Streptococcus pneumoniae. Antimicrob Agents Chemother 1996;40: Cullen ME, Wyke AW, Kuroda R, Fisher LM. Cloning and characterization of a DNA gyrase A gene from Escherichia coli that confers clinical resistance to 4- quinolones. Antimicrob Agents Chemother 1989;33: Yoshida H, Bogaki M, Nakamura M, Yamanaka LM, Nakamura S. Quinolone resistance-determining region in the DNA gyrase gyrb gene of Escherichia coli. Antimicrob Agents Chemother 1991;35: Brenwald NP, Gill MJ, Wise R. The effect of reserpine, an inhibitor of multi-drug efflux pumps, on the invitro susceptibilities of fluoroquinolone-resistant strains of Streptococcus pneumoniae to norfloxacin. J Antimicrob Chemother 1997;40: Brenwald NP, Gill MJ, Wise R. Prevalence of a putative efflux mechanism among fluoroquinolone-resistant clinical isolates of Streptococcus pneumoniae. Antimicrob Agents Chemother 1998;42: Piddock LJ, Johnson M, Ricci V, Hill SL. Activities of new fluoroquinolones against fluoroquinoloneresistant pathogens of the lower respiratory tract. Antimicrob Agents Chemother 1998;42: Gill MJ, Brenwald NP, Wise R. Identification of an efflux pump gene, pmra, associated with fluoroquinolone resistance in Streptococcus pneumoniae. Antimicrob Agents Chemother 1999;43: Unal S, Hoskins J, Flokowitsch JE, Wu CY, Preston DA, Skatrud PL. Detection of methicillin-resistant staphylococci by using the polymerase chain reaction. J Clin Microbiol 1992;30: Peterson S, Cline RT, Tettelin H, Sharov V, Morrison DA. Gene expression analysis of the Streptococcus pneumoniae competence regulons by use of DNA microarrays. J Bacteriol 2000;182: Piddock LJ, Johnson MM, Simjee S, Pumbwe L. Expression of efflux pump gene pmra in fluoroquinolone-resistant and -susceptible clinical isolates of Streptococcus pneumoniae. Antimicrob Agents Chemother 2002;46: