Methods Bioinformatics and molecular biology in situ hybridisation and FM1-43 staining MO injections and "morphotyping"

Transcription

1 Methods Bioinformatics and molecular biology tblastn searches of the zebrafish genome were performed at the Sanger centre website ( using invertebrate NOMPC-specific domains as queries (i.e. the medial connective linker, ANK repeat 1, and the TRP region). Several genomic traces were identified, which counter-blasted to the entire GenBank database preferentially aligned to Drosophila and C. elegans NOMPCs. A zebrafish radiation hybrid panel (Invitrogen) was used to test for synteny between the identified exons. All mapped to the proximal end of linkage group 19 (13 cm dft). Subsequent PCR on cdna confirmed they belonged to the same gene, and further RACE (Clontech, Invitrogen) and long range PCRs were used to obtain the nompc fulllength cdna. Genscan (genes.mit.edu/genscan.html), Promoter 2.0, and Netstart 1.0 ( analyses were consistent with the gene being complete. Its genomic structure was determined by blasting the full-length cdna to the zebrafish genome draft assembly, and was further confirmed using Genotrace software (26). The Drosophila sequence presented in Fig. S1 is the TRP box-containing splice variant of fly NOMPC (kindly provided by R. Walker). Phylogenetic tree of various TRP channels based on a Clustal alignment of indicated proteins. Full-length amino acid sequences were used. The alignemnt and it s representative tree were generated using Megalign software (Lasergene, DNASTAR). Genbank accession number AY in situ hybridisation and FM1-43 staining Various digoxygenin-labelled antisense nompc riboprobes were synthesised and used for in situ hybridisation as described (27). Corresponding sense probes did not give rise to any detectable labelling. Live zebrafish larvae were stained with the styryl dye FM1-43 (Molecular Probes) as described (22). MO injections and "morphotyping" nompc gt MO (5 -TAATCCAAACTGTACCTGTGTGTGA-3 ) was injected in 1 cell stage wt embryos as described (28). Because of the inherent mosaicism and gradual dilution of the MO during development, it was difficult to obtain 72 hpf morphants expressing virtually no fulllength transcript in all cells. We therefore injected high amounts of MO (approx. 5 nl of 1mM-2 mm). This treatment frequently caused background defects during early development (strongly reduced eyes and heads, curled-down tails) epistatic to hearing defects. For experiments, we used only escapers, that is larvae that had normal morphology at all stages. As expected, the penetrance of the deafness phenotype among escapers was variable and depended on the amount of MO injected. The frequency of escapers could reach 80% with a deafness penetrance varying between 15-80% (n >139 larvae, 4 separate experiments). At MO concentrations 0.5mM, we observed no effect on balance or hearing. In all experiments, deafness was correlated with an absence of full-length mrna, whereas such a morphotype was never observed among sibling 72 hpf morphants that showed wt behaviour. Total RNA was extracted (Nucleospin RNAII, Macherey-Nagel) from pools of 5-10 control or morphant larvae at various stages, then reverse transcribed using Clontech MMLV, and was PCR amplified using forward and reverse primers located in exons 27 and 29, respectively (forward primer (in exon 27) 5'- GGCTGTCTGGAGGTGTTGTT-3'; reverse primer (in exon 29) 5'- AGATGAGCAGCAGACACTCG-3'). PCR products were gel-eluted and sequenced. Additional MOs were nompc atg MO (5'-CACACGAGCTCTCAGACATCACCGC-3'), nompc 4bpmm MO (5'-TAAACCCAACTGTACGTGTATGTGA-3') and twik2 MO (5'AGCAGGACCTGAACGCCGTTGACAT3'). All MOs were provided by GeneTools LLC.

2 Electrophysiological recordings Response currents in HCs were recorded from neuromasts as extracellular potentials ( microphonics (24,29)). Briefly, recordings were performed in Ringer s solution with a patch pipette (filled with Ringer s; 1 5 M) using an Axoclamp 2B amplifier (Axon Instruments). Signals were amplified 2000-fold and digitised at 10 khz and 16 bit. HCs were stimulated through a glass pipette oriented parallel to the long body axis. The tip (diameter, µm) was µm away from the neuromast. Sinusoidal deflections of hair bundles (20 Hz, 200 ms) were generated using a fluid jet (30). The stimulus amplitude was adjusted under visual control to saturate the dynamic range of neuromast HCs (deflections >10 ) (24). At least 200 trials were averaged for each neuromast. Power spectra were calcuated from unfiltered, meansubtracted data. Traces displayed were low-pass filtered at 50 Hz.

3 Movie S1. Video recording of the absence of the acoustic startle reflex in gt MO nompc morphants. At 80 hpf, uninjected and nompc MO-injected larvae were stimulated with a series of taps or vibrational stimuli. Control animals showed an escape response (13 out of 15 wild type larvae displayed a startle reflex during each tap), whereas 20 out of 23 nompc morphants did not react to the stimuli. In contrast, nompc morphants responded to touch stimuli (data not shown). The morphants were derived from a single experiment in which a high penetrance of the phenotype was observed. Fig. S1. Deduced amino acid sequences of invertebrate and vertebrate NompC proteins. Clustal alignment of zebrafish (D. rerio, Dr) NompC to D. melanogaster (Dm) and C. elegans (Ce) NOMPC proteins. ANK repeats, TRP channel transmembrane segments (S1-S6), pore loop (P), and the TRP box (a quasi invariant hexapeptide present in all TRPs) are denoted by blue boxes, purple lines, and a red line, respectively. Amino acid identities and similarities are indicated by black and grey boxes, respectively. Fig. S2. Vestibular or balance defects in nompc atg MO injected larvae. (A), Free swimming uninjected control larvae at 120 hpf. (B-C) nompc atg MO-injected larvae at the same stage. Morphant larvae rest on their sides, and spontaneously swim sideways (arrow), upside down (asterisk), or at a tilt. Note the slightly curved spines and unfilled swim bladders in the morphants, both of which are typical for zebrafish larvae with sensory HC defects (28). As with the gt MO-injected larvae, deafness was transient in the atg MO injected animals and recovery from vestibular defects also occurred one day later. Fig. S3. Apical endocytosis is specifically disrupted in nompc morphants. Left column panels, lateral view of the head region as in Fig. 4A-H. Middle and right column panels, fluorescent and bright field views, respectively, of one head neuromast at higher magnification. In the bright field panels, the outlines of each neuromast and their corresponding apical surface are delineated in green and black, respectively. Apical HC bundles can be distinguished within the black contours. (A-C) Normal FM1-43 uptake in an uninjected wt larva. (D-F) Severely compromised uptake in a nompc atg MO injected larva, phenocopying the effects of nompc gt MO (see Fig. 4A-F). (G- L), Normal FM1-43 uptake in nompc 4bpmm MO and twik2 MO injected larvae. Scale bar in A,D,G,J 60 µm, and 20 µm in all other panels. 1

4 References 26. E. Berezikov, R. Plasterk, E. Cuppen, Bioinformatics 18, Navesicius A. & Ekker S. C. Effective targeted gene knockdown in zebrafish. Nat Genet 26, (2000). 28. Hauptmann G. & Gerster T. Two-colour whole-mount in situ hybridization to vertebrate and Drosophila embryos. Trends Genet. 10, 266 (1994). 29. Flock, A. Transducing mechanisms in the lateral line canal organ receptors. Cold Spring Harbor Symp. Quant Biol (1965). 30. Denk W, & Webb, WW. Forward and reverse transduction at the limit of sensitivity studied by correlating electrical and mechanical fluctuations in frog saccular hair cells. Hear Res 60: (1992)

5

6

7