sequencing I. Brief history of sequencing II. Sanger dideoxy method for III. Maxam-Gilbert chemical cleavage method

Transcription

1 DNA SEQUENCING

2 DNA sequencing I. Brief history of sequencing II. Sanger dideoxy method for sequencing III. Maxam-Gilbert chemical cleavage method

3 DNA sequencing Why sequence DNA? All genes available for an organism to use -- a very important tool for biologists Not just sequence of genes, but also positioning of genes and sequences of regulatory regions New recombinant DNA constructs must be sequenced to verify construction or positions of mutations Etc.

4 DNA sequencing istory of DNA sequencing

5

6

7

8 DNA sequencing: methods A. Sanger dideoxy (primer extension/chain-termination) method: most popular protocol for sequencing, very adaptable, scalable to large sequencing projects B. Maxam-Gilbert chemical cleavage method: DNA is labelled and then chemically cleaved in a sequencedependent manner. C. yrosequencing: measuring chain extension by pyrophosphate monitoring

9 Fred Sanger, Was originally a protein chemist proteins sequencing (insulin) 1958 Nobel prize in chemistry RNA sequencing 1977 dideoxy sequencing method 1980 Nobel prize in chemistry DNA sequencing: Sanger Method

10 DNA sequencing for dideoxy sequencing you need: 1) Single stranded DNA template 2) A primer for DNA synthesis 3) DNA polymerase 4) Deoxynucleoside triphosphates and dideoxynucleoside triphosphates

11 DNA sequencing DNA templates for sequencing: Single stranded DNA isolated from recombinant M13 bacteriophage containing DNA of interest ssdna Bacteriophage infection

12 DNA sequencing rimers for DNA sequencing Oligonucleotide (primer) 5 - AGGATGCGCAGG -3 Oligonucleotide primers can be synthesized by phosphoramidite chemistry usually designed manually and then purchased Sequence of the oligo must be complimentary to DNA flanking sequenced region Oligos are usually nucleotides in length

13 DNA sequencing rimers for DNA sequencing Solid hase Synthesis CG support covalently linked with one of the four nucleosides Reactive groups of nucleosides are blocked or protected to prevent unwanted side reactions DNA synthesis occurs by connecting nucleoside monomers one at a time to the 5' end of growing chain (3' to 5' end) DNA chain is cleaved from the support by ammonia treatment

14 DNA sequencing rimers for DNA sequencing Direction of oligonucleotide synthesis Oligonucleotide 5 3 CG Natural DNA 5 3

15 DNA sequencing DNA Synthesis Chemistry Cycle synthesis by phosphoramidite required four steps Detritylation Coupling Capping Oxidation

16 DNA sequencing DNA Synthesis Chemistry Cycle Linking first nucleotide to column Washing Removing oligonucleotide from column Detritylation Washing Activation and coupling n cycles The cycle is repeated n times depending on the length of the oligonucleotide to be synthesized Washing urifying oligonucleotide Capping Oxidation

17 DNA sequencing DNA Synthesis Chemistry Cycle (4,4'-dimethoxytrityl) group DMT GROU C 3 DMT group is bound to the 5 hydroxyl group of the deoxyribose sugar O Structure of a phosphoramidite: phosphoramidites are avaible for each of the four bases (A,C,G and T) that are used for the chemical synthesis of a DNA strand C O C3 Diisopropylamine group is attached to the 3 phosphite group of the nucleoside and a methyl group protects the 3 phosphite group

18 Linking first nucleotide to column DNA sequencing DNA Synthesis Chemistry Cycle Removing oligonucleotide from column urifying oligonucleotide Washing Detritylation Washing Activation and coupling Washing Capping Oxidation n cycles Starting complex for the chemical synthesis of a DNA strand. The initial nucleoside has a DMT group attached to the 5 hydroxyl group of the deoxyribose moiety and a spacer molecule attached to the hydroxyl group of the 3 carbon of the deoxyribose. The spacer unit is attached to a solid support, which is usually a CG bead.

19 Linking first nucleotide to column DNA sequencing DNA Synthesis Chemistry Cycle Washing Detritylation Washing Removing oligonucleotide from column Activation and coupling n cycles urifying oligonucleotide Washing Capping Oxidation Detritylation: the 5 DMT group is removed by treatment with TCA

20 Linking first nucleotide to column DNA sequencing DNA Synthesis Chemistry Cycle Washing Detritylation Removing oligonucleotide from column urifying oligonucleotide Washing Activation and coupling Washing Capping Oxidation n cycles Activation and coupling: the activation of a phosphoramidite enables its 3 phosphite group to attach to the 5 hydroxyl group of the bound detritylated nucleoside

21 Linking first nucleotide to column DNA sequencing DNA Synthesis Chemistry Cycle Washing Detritylation Washing Removing oligonucleotide from column Activation and coupling n cycles urifying oligonucleotide Washing Capping Oxidation Capping: the available 5 hydroxyl group of unreacted detritylated nucleosides are acetylated to prevent them from partecipating in the coupling reaction of the next cycle

22 Linking first nucleotide to column DNA sequencing DNA Synthesis Chemistry Cycle Washing Detritylation Washing Removing oligonucleotide from column Activation and coupling n cycles urifying oligonucleotide Washing Capping Oxidation Oxidation: the phosphite triester internucleotide linkage is oxidized to the prevalent phosphate triester. This reaction stabilizes the phosphodiester bond and makes it less susceptible to cleavage under either acidic or basic conditions

23 DNA sequencing DNA polymerase Should be highly processive, and incorporate ddnts efficiently Should lack exonuclease activity

24 DNA sequencing Dideoxynucleotide triphosphates dat ddat 3 -O required for chain elongation TE STANDARD DNA RECURSOR (CAIN)

25 DNA sequencing ssdna olymerase Oligonucleotide (primer) 5 - AGGATGCGCAGG -3 ddnts T G dnts T A C A G C

26 DNA sequencing Extend the primer with DNA polymerase in the presence of all four dnts

27 DNA polymerase direction Growing strand Template strand hosphodiester bond O O

28 DNA polymerase direction Growing strand Template strand O O

29 DNA polymerase direction Growing strand Template strand O hosphodiester bond O O

30 DNA polymerase direction Growing strand Template strand O O O

31 DNA polymerase direction Growing strand Template strand O O hosphodiester bond O O

32 DNA polymerase direction Growing strand Template strand O O O O

33 DNA sequencing Extend the primer with DNA polymerase in the presence of all four dnts, with a limited amount of a dideoxy NT (ddnt)

34 DNA polymerase direction Growing strand Template strand hosphodiester bond O O

35 DNA polymerase direction Growing strand Template strand O O

36 DNA polymerase direction Growing strand Template strand O hosphodiester bond O dideoxynucleotide

37 DNA polymerase direction Growing strand Template strand O O

38 DNA polymerase direction Growing strand Template strand O O hosphodiester bond O

39 DNA polymerase direction Growing strand Template strand O O Termination of the synthesis

40 DNA sequencing olymerase ssdna Oligonucleotide (primer) 5 - AGGATGCGCAGG -3 dnts T A G C prepare four reactions Each reaction contains a different ddnt ddat ddtt ddgt ddct A T G C

41 DNA sequencing ddat ddtt ddgt ddct A T G C G G T T A A T G A C C C T G C A C A T G For each reaction, enzyme catalyzed synthesis will be terminated in a fraction of the population of chains at each site where the ddnt is incorporated (e.g. in the ddat reaction tube, a population of chains result with a fraction of the chains terminated at each site a A" occurs).

42 DNA sequencing DNA fragments The four reactions products primer G T C A A T T G T A G G T A A C C ddgt ddtt G C ddat C ddct

43 DNA sequencing: methods ow to visualize DNA fragments? Radioactivity Radiolabeled primers (kinase with 32 ) or ddnts Fluorescence ddnts chemically synthesized to contain fluorophores Each ddnt fluoresces at a different wavelength allowing identification

44 DNA sequencing Analysis of sequencing products: olyacrylamide gel electrophoresis good resolution of fragments differing by a single dnt Slab gels Capillary gels: require only a tiny amount of sample to be loaded, run much faster than slab gels, best for high throughput sequencing

45 DNA sequencing Gel Separation on a polyacrylamide gel

46 DNA sequencing Gel Separation The reaction mixtures are separated on a denaturing polyacrylamide gel. Denaturing to prevent the DNA from folding up on itself while it travels through. olyacrylamide to separate the strands which differ in length by only one nucleotide. Each band corresponds to a sequence of DNA which was terminated by a particular ddnt. This ddnt is identified by lane in the radioactive method and by color in the fluorescent method. The lowest band on the gel is the shortest. The shorter the strand, the earlier in the synthetic reaction the ddnt was incorporated. The lowest band on the gel is at the 5 end of our synthesized strand and is complementary to the 3 end of our unknown fragment.

47 DNA sequencing Gel Visualization Radioactive method which requires four gel lanes, one for each reaction vessel. Readout is done by hand or with a densitometric scanner. Nonradioactive fluorescence sequencing requires only one gel lane because each nucleotide has a distinct color. The readout process is done by laser scanner and recorded by computer.

48 Sequence of unkno own fragment DNA sequencing Radioactive ddgt ddat ddtt ddct Smaller fragments

49 DNA sequencing roblem: Consider the following sequencing gel pattern, find out the sequence (starting from 3 end) of the template. GEL SEQUENCE gcagaaataagtacatgact TEMLATE SEQUENCE 3 -cgtctttattcatgtactga

50 DNA sequencing: methods ow to visualize DNA fragments? Radioactivity Radiolabeled primers (kinase with 32 ) or ddnts Fluorescence ddnts chemically synthesized to contain fluorophores Each ddnt fluoresces at a different wavelength allowing identification

51 DNA sequencing Gel Visualization Radioactive method which requires four gel lanes, one for each reaction vessel. Readout is done by hand or with a densitometric scanner. Nonradioactive fluorescence sequencing requires only one gel lane because each nucleotide has a distinct color. The readout process is done by laser scanner and recorded by computer.

52 DNA sequencing: methods Fluorescent-ddNTs T G olymerase ssdna Oligonucleotide (primer) 5 - AGGATGCGCAGG -3 dnts A T C G A C Nonradioactive fluorescence sequencing requires one reaction tube and only one gel lane because each nucleotide has a distinct color. prepare one reaction

53 DNA sequencing: methods 1) 2) The sequencing reaction is transferred from the tube to a lane of a polyacrylamide gel

54 DNA sequencing: methods The gel is placed into a DNA sequencer for electrophoresis and analysis

55 DNA sequencing: methods The fragments migrate according to size, and each is detected as it passes a laser beam at the bottom of the gel fragments Laser beam Each type of dideoxynucleotide emits colored light of a characteristic wavelength and is recorded as a colored band on a simulate gel image

56 DNA sequencing: methods The simulated gel image is read from bottom to top, starting with the smallest fragment The computer program interprets the raw data and outputs an electropherogram with colored peaks representing each letter in the sequence

57 DNA sequencing: methods A. Sanger dideoxy (primer extension/chain-termination) method: most popular protocol for sequencing, very adaptable, scalable to large sequencing projects B. Maxam-Gilbert chemical cleavage method: DNA is labelled and then chemically cleaved in a sequencedependent manner. This method is not easily scaled and is rather tedious C. yrosequencing: measuring chain extension by pyrophosphate monitoring

58 DNA sequencing: methods Walter Gilbert arvard physicist Became intrigued with the biological side 1977 Maxam-Gilbert sequencing method 1980 Nobel prize in chemistry Allan Maxam is one of the pioneers of molecular genetics working as a student in the laboratory of Walter Gilbert Maxam-Gilbert

59 DNA sequencing: methods The Maxam-Gilbert Technique Chemical degradation of purified fragments The DNA fragment to be sequenced is end-labeled by reaction with - labeled AT in the presence of polynucleotide kinase, which attaches labeled to the 5 terminal The labeled DNA fragment is then divided into four aliquots, each of which is treated with a reagent which modifies a specific base 1. Aliquot A + dimethyl sulphate, which methylates guanine residue 2. Aliquot B + formic acid, which modifies adenine and guanine residues 3. Aliquot C + ydrazine, which modifies thymine + cytosine residues 4. Aliquot D + ydrazine + 5 mol/l NaCl, which makes the reaction specific for cytosine The four are incubated with piperidine which cleaves the sugar phosphate backbone of DNA next to the residue that has been modified

60 DNA sequencing: methods reparation of DNA fragment DNA duplex polynucleotide kinase attaches 32 labeled to the 5 terminal Label ends Cut with restriction enzyme Denature Discard Only end-labeled strand will be visible in autoradiograph

61 DNA sequencing The Maxam-Gilbert Technique rinciple - Chemical Degradation of urines urines (A, G) damaged by dimethylsulfate Methylation of base eat releases base Alkali cleaves G Dilute acid cleave A>G

62 DNA sequencing The Maxam-Gilbert Technique

63 DNA sequencing The Maxam-Gilbert Technique rinciple - Chemical Degradation of yrimidines yrimidines (C, T) are damaged by hydrazine iperidine cleaves the backbone 2 M NaCl inhibits the reaction with T

64 DNA sequencing The Maxam-Gilbert Technique piperidine

65 DNA sequencing

66 DNA sequencing SANGER METOD RAID; a large n of samples can be processed simultaneously composition of 2-D structure of the DNA template can cause premature termination by DNA polymerase accuracy due to the enzyme used MAXAM & GILBERT METOD by-pass all the problems associated with enzymes does not require subcloning into seq. vectors (restriction fragments can be used directly) the only method for sequencing small oligonucleotides time-consuming (labeling of a single end, purification steps to separate strands) background due to degradation