Identification and Characterization of Lyme Disease Spirochetes, Borrelia burgdorfien Sensu Lato, Isolated in Korea

Transcription

1 JOURNAL OF CLINICAL MICROBIOLOGY, JUlY 1993, P /93/ $02.00/0 Copyright 1993, American Society for Microbiology Vol. 31, No. 7 Identification and Characterization of Lyme Disease Spirochetes, Borrelia burgdorfien Sensu Lato, Isolated in Korea KYUNG-HEE PARK,' WOO-HYUN CHANG,2 AND TOM G. SCHWAN3* Department of Microbiology, College ofmedicine, Kon-Kuk University, , Choongju, Choongchungbuk-Do, 'and Department ofmicrobiology, College of Medicine, Seoul National University, Seoul, , 2 Korea, and Arthropod-Borne Diseases Section, Laboratory of Vectors and Pathogens, Rocky Mountain Laboratories, National Institute ofallergy and Infectious Diseases, Hamilton, Montana Received 24 February 1993/Accepted 22 April 1993 Lyme disease spirochetes, Borrelia burgdorferi sensu lato, were identified and characterized for the first time in Korea. Four isolates, designated Konkuk-1, Konkuk-2, Kangwon-3, and KM-4, were made from midgut suspensions of three bowdes ticks and heart tissue from one mouse, Apodemus agrarus, collected from Chungbuk and Kangwon provinces. The four Korean isolates and B. burgdorferi sensu lato from other geographic areas and biological sources were compared by using sodium dodecyl sulfate-polyacrylamide gel electrophoresis for protein profiles, Western blot (immunoblot) analysis for reactivities with monoclonal and polyclonal antibodies, and agarose gel electrophoresis for plasmid profiles. Two typing schemes using polymerase chain reaction identified three of the isolates as members of group VS461 and one, Kangwon-3, as Borrelia garinii. These results demonstrate the potential for human Lyme disease to occur in some provinces of Korea. Lyme disease is an emerging multisystem illness of humans and some domestic mammals and is caused by zoonotic, tick-borne spirochetes currently assigned to three species of Borrelia (2, 13, 18, 54). Burgdorfer made the seminal discovery in late 1981 when he identified spirochetes in the midgut of Ixodes ticks collected on Shelter Island, New York (13). These spirochetes were subsequently isolated in culture by Barbour, shown to be reactive by an indirect immunofluorescence assay with immune serum from human Lyme disease patients, and later named Borrelia burgdorferi (13, 18). Investigations throughout much of the northern hemisphere have now shown that Lyme spirochetes are widely distributed in natural foci in both North America and Eurasia. The spirochetes are maintained in foci of endemicity by tick-mammal associations involving a relatively few species of ticks in the genus Ixodes (25). Lyme spirochetes from throughout the northern temperate regions of the world have numerous variable genetic and molecular determinants (1, 7, 8, 11, 22, 24, 26, 28, 40, 56, 57). Such variation with natural groupings has led some to the opinion that Lyme spirochetes comprise at least three species, currently designated B. burgdorferi sensu stricto, Borrelia garinii, and group VS461 (2). The diversity implied by this nomenclature, although not entirely satisfactory, makes it important to continue efforts to identify new geographic areas where Lyme spirochetes, B. burgdorferi sensu lato, occur. Finding new regions of endemicity will help demonstrate the potential for humans there to become infected and develop some form of Lyme disease. No human cases of Lyme disease have yet been recognized in Korea. However, in June 1992, spirochetes were isolated from three Ixodes ticks collected from two provinces of Korea (39). These spirochetes were not identified, although light and electron microscopy showed that they had * Corresponding author morphological characteristics that were consistent for B. burgdorferi sensu lato. One additional isolate was subsequently made from a rodent. Herein we identify these four Korean isolates and partially characterize them in comparison with a representative group of Lyme spirochetes from other geographic areas and biological sources. MATERIALS AND METHODS Isolation of spirochetes. In June 1992, adult Ixodes persulcatus and unidentified nymphal Ixodes sp. ticks were collected by flagging vegetation at Choongju, Chungbuk Province, and Daekwanrung, Kangwon Province, Korea. Mice were also captured in the Choongju area. The midgut of individual ticks (n = 15) and heart tissue from individual mice, Apodemus agrarius (n = 12), were inoculated into BSK-II medium (3) containing neomycin (50,ug/ml) and incubated at 34 C. Three isolates were obtained from ticks, and one isolate was obtained from a mouse (Table 1). The Korean isolates had been passaged approximately 20 to 25 times when we examined them in the present study. Additional isolates from North America and Eurasia were included for comparison (Table 2). SDS-PAGE and Western blot (immunoblot) analysis. Whole-cell lysates of spirochetes were prepared as described previously (46). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using the Laemmli buffer (23), a vertical gel electrophoresis system (GIBCO-Bethesda Research Laboratories, Gaithersburg, Md.), and Coomassie brilliant blue staining were used to examine protein profiles and were done according to the instructions of the manufacturer. All spirochete isolates were examined by Western analysis for reactivity with six monoclonal antibodies and three rabbit monospecific polyclonal antibodies. The hybridoma tissue culture supernatants were H9724, reactive with flagellin (6); H5332, reactive with the outer surface protein OspA

2 1832 PARK ET AL. TABLE 1. Isolates of B. burgdorferi sensu lato from Korea Isolate Province Source Konkuk-1 Chungbuk Lxodes persulcatus female Konkuk-2 Chungbuk Ixodes sp. nymph Kangwon-3 Kangwon Lxodes persulcatus female KM-4 Chungbuk Apodemus agranus (9); HSTS, H6831, and H4610, reactive with OspB (8, 43); and a monoclonal antibody reactive with the P39 protein (50). Rabbit anti-p39 and anti-p22a antibodies were produced with Eschenchia coli carrying the recombinant plasmids pspr33 and pspr29 described previously (52, 53). Anti-OspC serum was produced by immunizing a rabbit with OspC of B. burgdorferi Sh-2-82 (48). Whole-cell lysates were electrophoresed in 12.5% acrylamide gels and blotted onto nitrocellulose membranes with the Towbin buffer system (55) and a Trans-Blot Cell (Bio- Rad Laboratories, Richmond, Calif.) according to the instructions of the manufacturer. The membranes were blocked overnight at room temperature with TSE-Tween (50 mm Tris [ph 7.4], 150 mm NaCl, 5 mm EDTA, 0.05% Tween 20) and then incubated with the tissue culture supernatants or immune serum. Bound antibodies were detected directly with 1"I-labeled protein A autoradiography as described previously (46). DNA purification and analysis. Total DNA was purified from 500-ml stationary-phase BSK-II cultures of spirochetes as described previously (51). DNA samples were examined by agarose gel electrophoresis using a Mini-Sub DNA Cell (Bio-Rad Laboratories). Equal quantities of DNA were electrophoresed in 0.2% agarose gels with TBE buffer (90 mm Tris, 90 mm boric acid, 20 mm EDTA) to resolve plasmids. Gels were run at 36 V for 5 min and then at 12 V for 16 h, stained with ethidium bromide, and examined by UV transillumination. PCR analysis. Polymerase chain reaction (PCR) (36) was used with DNA samples of the Korean isolates and other TABLE 2. Additional isolates of Borrelia examined Species or group and Geographic origin Source isolate B. burgdorferi sensu stricto B31 New York State, Ixodes scapularis (= USAW Ixodes dammini) Sh-2-82 New York State, I. scapularis USAa France I. ricinus B. garindi Ip90 Russia I. persulcatus G-1 Germany Human CSFb G-2 Germany Human CSFb G-25 Sweden I. ricinus VS461 IPF Japan I. persulcatus VS461 Switzerland I. ricinus Ip3 Russia I. persulcatus Ip21 Russia I. persulcatus Borrelia hermsii HS1 Washington State, Ornithodoros hernsi USA" a USA, United States of America. b CSF, cerebrospinal fluid. J. CLIN. MICROBIOL. spirochetes representative of the three species to determine whether the Korean isolates were either North American- or European-type spirochetes (B. burgdorferi sensu stricto, B. garinii, or group VS461) as previously described (27, 41, 42). Five sets of PCR primers were used (Table 3). Primer sets a and c were described by Rosa et al. (41) and specifically amplify DNA of North American (B31) type and all (universal) types of Lyme spirochetes, respectively. Primer sets BB, BG, and VS461 were described by Marconi and Garon (27) and specifically amplify DNA of B. burgdorferi sensu stricto, B. garindi, and group VS461, respectively. PCR analysis using primer sets a and c was done as previously described (41). PCR analysis using the three other sets of primers was modified from the published protocol (27) to include cycle parameters of 94 C for 40 s, 50 C for 30 s, and 72 C for 45 s. All reactions were done for 25 cycles with a Perkin-Elmer Cetus Thermocycler and GeneAmp Reagents (Perkin-Elmer Cetus, Norwalk, Conn.). PCR amplification products were examined in 1.5% agarose electrophoresis gels stained with ethidium bromide. RESULTS The four Korean isolates of spirochetes had protein profiles that were consistent for B. burgdorfen sensu lato (Fig. 1). Each of these isolates contained two dominant stained proteins of approximately 30 to 31 and 34 kda, which we presumptively identified as the outer surface proteins OspA and OspB, respectively. Isolate Kangwon-3 varied from the three other Korean isolates by having a slightly smaller OspA and a dominant polypeptide of approximately 24 kda, which we presumptively identified as OspC. The Korean isolates also displayed some variation in stained polypeptides with apparent molecular masses of 20 to 22 kda. Western immunoblot analysis of the Korean isolates confirmed the presence of several proteins known to be associated with B. burgdorferi sensu lato from other geographic areas (Table 4; Fig. 2 and 3). All of the Korean isolates bound monoclonal antibody H9724 (Fig. 2), confirming both the presence of flagellin in these spirochetes and their identity as Borrelia isolates. Three of the four Korean isolates bound monoclonal antibody H5332, confirming the presence of OspA, while the isolate Kangwon-3 did not bind this antibody (Fig. 2). All of the Korean isolates also bound monoclonal and polyclonal antibodies that confirmed the presence of the three other proteins OspC, P22A, and P39 (Fig. 3 and Table 4). Again, the isolate Kangwon-3 varied from the other three Korean isolates by reacting very weakly with the monoclonal anti-p39 antibody (Fig. 2). However, the presence of P39 in this isolate was confirmed by a longer (48-h) exposure of film to this blot and by binding of the rabbit anti-p39 antibody (Table 4, blots not shown). None of the Korean isolates bound any of the three monoclonal antibodies to OspB. However, epitopes that bind at least two of these antibodies (HSTS and H6831) can vary as cloned and uncloned populations of spirochetes are cultured in vitro (12, 44) and are thus less useful in characterizing isolates. All of the Korean isolates bound the rabbit anti-ospc antibody, although immunoblotting demonstrated differences in both the apparent molecular mass and the amount of this protein among them (Fig. 3). Plasmid profiles of the Korean isolates were also consistent for B. burgdorferi sensu lato, given the variability in number, size, and structure that exists in these extrachromosomal elements among different isolates from various sources (Fig. 4). Three distinct plasmid profiles were evident

3 VOL. 31, 1993 LYME DISEASE SPIROCHETES FROM KOREA 1833 Primer set TABLE 3. DNA sequences of primers used for PCR Forward Primer, 5' to 3' Primer aa CGAAGATACTAAATCTGT GATCAAATATTTCAGCTT Primer c' CCAACTTTATCAAATTCTGC AGGATCTATTCCAAAATC BBb GGGATGTAGCAATACATTC ATATAGTTTCCAACATAGG BGb GGGATGTAGCAATACATCT ATATAG[TTCCAACATAGT VS461b GCATGCAAGTCAAACGGA ATATAGTTTCCAACATAGC a From Rosa et al. (41). b From Marconi and Garon (27) with corrections of errors in published sequences in two of the six primers. Reverse among the four Korean isolates, with Konkuk-2 and KM-4 appearing to be nearly identical. Each of the Korean isolates contained a plasmid that migrated slightly above the 48.5-kb marker (estimated at 56 to 59 kb), similar to the other isolates examined from Eurasia but different from the two isolates from North America, B31 and Sh-2-82, in which the largest plasmid migrated as slightly smaller molecules at approximately 49 kb. Two PCR typing schemes also confirmed the identity of the four Korean isolates as B. burgdorferi sensu lato and identified them according to recently established nomenclature (2). With primer set c (universal primers), the appropriately sized fragment of DNA (127 bp) was amplified from all four Korean isolates, as was true for representatives of each of the three species within B. burgdorferi sensu lato (Fig. 5). However, with primer set a (B31 primers), DNA of the Korean isolates was not amplified, although the appropriately sized fragment of DNA (374 bp) was amplified from B31 (Fig. 5). Also, primer set BB did not amplify DNA from the Korean isolates but did amplify DNA of the appropriately sized fragment (575 bp) from B. burgdorfen B31 (Fig CN C 0.. E C, E. iv, *~~~~~~'" > C2 C e a* _*rsl ttt FIG. 1. SDS-PAGE of whole-cell lysates of Borrelia isolates. The 12.5% gel was stained with Coomassie brilliant blue and molecular size standards from Bio-Rad are shown at the left in kilodaltons. u) 6). Primer set BG amplified DNA of the appropriately sized fragment (575 bp) from Kangwon-3 and G2 while primer set VS461 amplified DNA of the appropriately sized fragment (590 bp) from the other three Korean isolates and IPF. These results demonstrate that the Korean isolates were identified as B. garinii (Kangwon-3) and group VS461 (Konkuk-1, Konkuk-2, and KM-4). DISCUSSION We have identified and partially characterized Lyme disease spirochetes isolated for the first time from ticks and a rodent from two provinces of Korea. Although the numbers of ticks and rodents examined were very small, the number of isolates obtained suggests that the prevalence of Lyme spirochetes may be fairly high in the areas sampled (20% of the ticks sampled in the present study). The tick isolates were obtained from two female I. persulcatus ticks and an unidentified Lxodes nymph. While the nymph was probably also I. persulcatus, there is at least one other sympatric species of Ixodes in Korea (58), which made a specific identification of the dissected nymph uncertain. In Japan, Ixodes ovatus and I. persulcatus have both yielded numerous isolates of Lyme spirochetes (29, 30, 34, 35, 37). Although I. ovatus has not been reported from Korea, its wide distribution throughout central Asia to Japan (15, 58) suggests that this tick may also occur in Korea. In spite of this uncertainty, I. persulcatus is established in natural foci in Korea, and investigators in other areas of Asia have clearly demonstrated its potential as a vector of Lyme spirochetes (19-21, 30, 37). The isolate from the mouse A. agrarius is also not unexpected, given the suitability of this species as both a natural and an experimental host for immature I. persulcatus and TABLE 4. Immunological reactivities of Korean isolates of B. burgdorfen sensu lato and B31 with monoclonal and polyclonal antibodies Antibody Target Result with following isolate: protein Kl K2 K3 K4 B Flagellin OspA TS OspB OspB OspB RaOspC OspC RaP39 P MAb-P39a P Weak + + RaP22A P22A a MAb, monoclonal antibody.

4 PARK ET AL. H H9724 H5332 H4610 anti-p B B B B31 J. CLIN. MICROBIOL. ṫ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~. _. _ow _ y1 - C: CQJ.l.=e c y CO I c 0 cj) cr Nt 1 2 v ma FIG. 2. Western blot analysis of the Korean isolates and B31 with monoclonal antibodies H9724 (antiflagellin), H5332 (anti- OspA), H4610 (anti-ospb), and P39 (anti-p39). Lanes 1, Konkuk-1; lanes 2, Konkuk-2; lanes 3, Kangwon-3; lanes 4, KM-4. Lxodes ncinus ticks (31, 32, 58). We were unable to find published reports describing other isolations of Lyme spirochetes from A. agrarius or other species of Apodemus. However, almost all small mammals tested so far appear to be susceptible to experimental infections with low-passaged isolates of B. burgdorfien sensu lato, as was first observed with hamsters (17). Therefore, most, if not all, small mammals that are fed upon by competent tick vectors of the spirochete are likely to become infected. The protein profiles and immunological reactivities with monoclonal and monospecific polyclonal antibodies demonstrated that the four Korean isolates of Lyme spirochetes were consistent within the range of heterogeneity now known to exist, especially among isolates from Japan and eastern continental Asia (1, 7, 29, 30, 37). Although the Korean isolate Kangwon-3 was more variant than the three other isolates, its lack of reactivity with monoclonal antibody H5332 is not without precedent. Other isolates of B. burgdorfen sensu lato that do not bind this anti-ospa antibody have been described (37, 40). Also, such nonreactivity has been used recently as part of a serotyping system to group isolates of Lyme spirochetes on the basis of their pattern of reactivity with a panel of OspA monoclonal antibodies (56). However, given the potential for recombination between the two genes of the ospab operon and the formation of novel chimeric OspA-B proteins (43, 56), monoclonal anti-ospa antibodies may not provide confirmation for the identity of all isolates. Clearly, anti-ospb monoclonal antibodies have only limited utility for identification because reactivity with these antibodies may change with cloning or continual passage of spirochetes in vitro (12, 44). None of our Korean isolates reacted with any of the anti-ospb monoclonal antibodies, a result which offers little information, considering that this pattern could have resulted from changes during the 20 to 25 passages in culture prior to examination of the isolates (44). P39 and P22A, proteins that are specific to B. burgdorferi sensu lato (49, 52, 53), were both present in all four Korean isolates. These proteins were identified by polyclonal antisera produced in rabbits immunized with recombinant forms of P39 and P22A (52, 53). Therefore, polyclonal antisera raised against highly conserved and specific proteins were FIG. 3. Western blot analysis of the Korean isolates with rabbit anti-ospc antibody. valuable in the present study and identified the Korean isolates as B. burgdorfen sensu lato when some of the monoclonal antibodies were unable to confirm their identity. We also used a polyclonal antibody that identified OspC in all four Korean isolates. As is typical for the expression of this outer surface protein (14, 48, 57), OspC in the Korean spirochetes varied in both its apparent molecular mass and the amount present. The significance of this highly variable surface protein for Lyme spirochetes and the pathogenesis of Lyme disease remains unknown. Plasmid profiles of the Korean isolates were similar to those for B. burgdorferi sensu lato from other regions examined in that there were numerous (seven to nine) distinct bands visible in the agarose gel stained with ethidium bromide. Also typical for Lyme spirochetes, the plasmid profiles of the four Korean isolates were different, with three distinct patterns. Such heterogeneity in the number of de-.4

5 VOL. 31, 1993 LYME DISEASE SPIROCHETES FROM KOREA 1835 Cc _ c y v 0 c C~C C r_ C r_ CTC) Cm m L Cl 2 &~~~ kb B.b. sensu strncto B. garinti VS461 L: -~~~~~~~~~~~~~~~1 -? r~c'4wl1 CY L1_c- CM r LL --> ty e "m _- A I' n- L1, a Kb FIG. 4. Plasmid profiles of Borrelia isolates froim Korea and other geographic areas. Molecular size standards (nnarkers) are X DNA, and A DNA-HindIII digest fragments are show'n at the left in kilobases FIG. 6. PCR amplification products from Korean and other Borrelia isolates with BB, BG, and VS461 primers. Lane 1, Konkuk-1; lane 2, Konkuk-2; lane 3, Kangwon-3; lane 4, KM-4. Molecular size standards are shown at the left in kilobases. B.b., Borrelia burgdorfen. tectable plasmids in Lyme spirochetes when agarose gel electrophoresis is used may be the result of sev,_1s] A erai lactors. First, Lyme spirochetes may harbor Korean isolates may not be a numerows, differently diversity of true plasmids occurring representation of in nature. the The Korean isocomplex gel sized linear and circular plasmids, creating a profile (4, 5, 16, 45, 51). Second, different lates did contain a conf large plasmid greater than 49 kb that we circular molecules (supercoiled, ormations of open circular presumptively identified as inear, the linear ospab-containing plas- and mid (10). This plasmid was similar in size among the Korean concatamers of variously sized molecules) m] ently so that the same circular plasmid may migi rate d ifer- and other Eurasian isolates, but distinctly larger than the four regions of a gel depending on how the DNA was ospab-bearing plasmid in the two North American isolates, prepared and what concentration of agarose wals used in the B31 and Sh The size difference in this plasmid between gel (33, 47, 51). Third, plasmids in Lyme spiroclhetes may be European and North American isolates of B. burgdorferi lost during in vitro cultivation (4, 38, 45), malking iegites mabe sensu lato has been noted it more the more useful markers when previously (5) and using may plasmids to be one of identify difficult to compare profiles of different isolates different lengths of time in artificial medium. Irsjthe to isolates from the two continents. study, the Korean spirochetes had been passage d in vitro no Finally, we used two typing schemes based on PCR results more than 25 times; however, we have obsenved that this to also confirm the identity of the Korean isolates as B. length of time may allow for the loss of one or mlore plasmids burgdorfen sensu lato and to subgroup them according to from an uncloned isolate of B. burgdorferi (45). In Fig. recent 4,we changes in nomenclature. While we believe that included isolate B31, which has been in h nearl) continuous identifying Lyme spirochetes simply as B. burgdorferi sensu cultivation for many years; only two plasmids, iwith lato approx- may be adequate for many investigations, PCR does imate sizes of 16 and 49 kb, are visible in the gel. wb31 isolatp offer a rapid and attractive alternative to some of the more that have been passaged fewer times, howe' vericontain cumbersome methods described to specifically identify several more plasmids, similar to isolate Sh-2-82 shown at Lyme spirochetes as B. burgdorferi sensu stricto, B. garinii, the far right in Fig. 4 (3). Thus, the profiles of plaismids in the or the inappropriate designation of group VS461. Among the four new Korean isolates, three were identified as group VS461 while Kangwon-3 was typed as B. garinii; none were B. burgdorfen sensu stricto. Future studies in Korea should B-31 Type Primers Universal Prrimers concentrate on determining the distribution and abundance of I. persulcatus and other Lrodes ticks throughout the () CM different provinces and identifying their primary mammalian C < Q m c: hosts. Further attempts should be made to identify other foci 2027 of Lyme spirochetes by cultivating tissues from ticks and small mammals. Finally, physicians in Korea should be I _i alerted to the possibility of patients presenting with Lyme disease after being bitten by Ixodes ticks, and they should be encouraged to attempt to confirm human cases by isolating spirochetes from skin biopsies or other tissues. FIG. 5. PCR amplification products from Korean and other Borrelia isolates with B31 and universal-type primers. Lane 1, Konkuk-1; lane 2, Konkuk-2; lane 3, Kangwon-3; lane 4, KM-4. Molecular size standards (markers) are shown at the left in base pairs. ACKNOWLEDGMENTS We thank Yasutake Yanagihara and Masahito Fukunaga for their assistance in isolating Borrelia spp. from ticks; Seung-Hyun Lee, Won-Jong Jang, Merry Schrumpf, and Robert Karstens for technical assistance; Patricia Rosa and Richard Marconi for providing PCR primers; Gary Hettrick and Robert Evans for photographic work;

6 1836 PARK ET AL. Betty Kester for preparation of the manuscript; and Kit Tilly and Scott Samuels for reviewing the manuscript. REFERENCES 1. Adam, T., G. S. Gassmann, C. Rasiah, and U. B. Gobel Phenotypic and genotypic analysis of Borrelia burgdorferi isolates from various sources. Infect. Immun. 59: Baranton, G., D. Postic, I. Saint Girons, P. Boerlin, J.-C. Piffaretti, M. Assous, and P. A. D. Grimont Delineation of Borrelia burgdorferi sensu stricto, Borrelia garinii sp. nov., and group VS461 associated with Lyme borreliosis. Int. J. Syst. Bacteriol. 42: Barbour, A. G Isolation and cultivation of Lyme disease spirochetes. Yale J. Biol. Med. 57: Barbour, A. G Plasmid analysis of Borrelia burgdorferi, the Lyme disease agent. J. Clin. Microbiol. 26: Barbour, A. G Classification of Borrelia burgdorferi on the basis of plasmid profiles. Zentralbl. Bakteriol. Mikrobiol. Hyg. Suppl. 18: Barbour, A. G., S. F. Hayes, R. A. Heiland, M. E. Schrumpf, and S. L. Tessier A Borrelia-specific monoclonal antibody binds to a flagellar epitope. Infect. Immun. 52: Barbour, A. G., and M. E. Schrumpf Polymorphisms of major surface proteins of Borrelia burgdorferi. Zentralbl. Bakteriol. Mikrobiol. Hyg. Ser. A 263: Barbour, A. G., S. L. Tessier, and S. F. Hayes Variations in a major surface protein of Lyme disease spirochetes. Infect. Immun. 45: Barbour, A. G., S. L. Tessier, and W. J. Todd Lyme disease spirochetes and ixodid tick spirochetes share a common surface determinant defined by a monoclonal antibody. Infect. Immun. 41: Bergstrom, S., V. G. Bundoc, and A. G. Barbour Molecular analysis of linear plasmid-encoded major surface proteins, OspA and OspB, of the Lyme disease spirochete Borrelia burgdorferi. Mol. Microbiol. 3: Bissett, M. L., and W. Hill Characterization of Borrelia burgdorfen strains isolated from lwodes pacificus ticks in California. J. Clin. Microbiol. 25: Bundoc, V. G., and A. G. Barbour Clonal polymorphisms of outer membrane protein OspB of Borrelia burgdorferi. Infect. Immun. 57: Burgdorfer, W., A. G. Barbour, S. F. Hayes, J. L. Benach, E. Grunwaldt, and J. P. Davis Lyme disease-a tick-borne spirochetosis? Science 216: Fuchs, R., S. Jauris, F. Lottspeich, V. Preac-Mursic, B. Wilske, and E. Soutschek Molecular analysis and expression of a Borrelia burgdorferi gene encoding a 22 kda protein (pc) in Escherichia coli. Mol. Microbiol. 6: Hoogstraal, H., C. M. Clifford, Y. Saito, and J. E. Keirans Ixodes (Partipalpiger) ovatus Neumann, subgen. nov.: identity, hosts, ecology, and distribution (Ixodoidea: Ixodidae). J. Med. Entomol. 10: Hughes, C. A. N., C. B. Kodner, and R C. Johnson DNA analysis of Borrelia burgdorfen NCH-1, the first northcentral U.S. human Lyme disease isolate. J. Clin. Microbiol. 30: Johnson, R. C., N. Marek, and C. Kodner Infection of Syrian hamsters with Lyme disease spirochetes. J. Clin. Microbiol. 18: Johnson, R. C., G. P. Schmid, F. W. Hyde, A. G. Steigerwalt, and D. J. Brenner Borrelia burgdorferi sp. nov.: etiologic agent of Lyme disease. Int. J. Sys. Bacteriol. 34: Kawabata, M., S. Baba, K. Iguchi, N. Yamaguti, and H. Russell Lyme disease in Japan and its possible incriminated tick vector, Ixodes persulcatus. J. Infect. Dis. 156: Korenberg, E. I., Y. V. Kovalevsky, V. N. Kryuchechnikov, and N. B. Gorelova Tick Lodes persulcatus Schulze, 1930 as a vector of Borrelia burgdorferi, p In F. Dusbabek and V. Bukva (ed.), Modem acarology. SPB Academic Publications, The Hague, The Netherlands. 21. Kryuchechnikov, V. N., E. I. Korenberg, S. V. Shcherbakov, Y. V. Kovalevsky, and M. L. Levin Identification of J. CLIN. MICROBIOL. Borrelia isolated in the USSR from Lxodespersulcatus Schulze ticks. J. Microbiol. Epidemiol. Immunol. 12: Kurashige, S., M. Bissett, and L. Oshiro Characterization of a tick isolate of Borrelia burgdorferi that possesses a major low-molecular-weight surface protein. J. Clin. Microbiol. 28: Laemmli, U. K Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227: Lane, R. S., and J. A. Pascocello Antigenic characteristics of Borrelia burgdorferi isolates from ixodid ticks in California. J. Clin. Microbiol. 27: Lane, R. S., J. Piesman, and W. Burgdorfer Lyme borreliosis: relation of its causative agent to its vectors and hosts in North America and Europe. Annu. Rev. Entomol. 36: LeFebvre, R. B., R. S. Lane, G.-C. Perng, J. A. Brown, and R. C. Johnson DNA and protein analyses of tick-derived isolates of Borrelia burgdorferi from California. J. Clin. Microbiol. 28: Marconi, R. T., and C. F. Garon Development of polymerase chain reaction primer sets for diagnosis of Lyme disease and for species-specific identification of Lyme disease isolates by 16S rrna signature nucleotide analysis. J. Clin. Microbiol. 30: Marconi, R. T., L. Lubke, W. Hauglum, and C. F. Garon Species-specific identification of and distinction between Borrelia burgdorferi genomic groups by using 16S rrna-directed oligonucleotide probes. J. Clin. Microbiol. 30: Masuzawa, T., Y. Okada, Y. Beppu, T. Oku, F. Kawamori, and Y. Yanagihara Immunological properties of Borrelia burgdorferi isolated from bcodes ovatus in Shizuoka, Japan. Microbiol. Immunol. 35: Masuzawa, T., Y. Okada, Y. Yanagihara, and N. Sato Antigenic properties of Borrelia burgdorferi isolated from Ixodes ovatus and Ixodespersulcatus in Hokkaido, Japan. J. Clin. Microbiol. 29: Matuschka, F.-R., P. Fischer, K. Musgrave, D. Richter, and A. Spielman Hosts on which nymphal Ixodes ricnus most abundantly feed. Am. J. Trop. Med. Hyg. 44: Matuschka, F.-R., R. Lange, A. Spielman, D. Richter, and P. Fischer Subadult Ixodes ricinus (Acari: Ixodidae) on rodents in Berlin, West Germany. J. Med. Entomol. 27: Mickel, S., V. Arena, Jr., and W. Bauer Physical properties and gel electrophoresis behavior of R12-derived plasmid DNAs. Nucleic Acids Res. 4: Miyamoto, K., M. Nakao, N. Sato, and M. Mori Isolation of Lyme spirochetes from an ixodid tick in Hokkaido, Japan. Acta Trop. 49: Miyamoto, K., M. Nakao, K. Uchikawa, and H. Fujita Prevalence of Lyme borreliosis spirochetes in Ixodid ticks of Japan, with special reference to a new potential vector, Ixodes ovatus (Acari: Ixodidae). J. Med. Entomol. 29: Mullis, K. B., and F. A. Faloona Specific synthesis of DNA in vitro via a polymerase catalyzed chain reaction. Methods Enzymol. 155: Nakao, M., K. Miyamoto, K. Uchikawa, and H. Fujita Characterization of Borrelia burgdorfiei isolated from Ixodes persulcatus and Ixodes ovatus ticks in Japan. Am. J. Trop. Med. Hyg. 47: Norris, S. J., C. J. Carter, J. K. Howell, and A. G. Barbour Low-passage-associated proteins of Borrelia burgdorfeni B31: characterization and molecular cloning of OspD, a surfaceexposed, plasmid-encoded lipoprotein. Infect. Immun. 60: Park, K.-H., S.-H. Lee, W.-J. Won, W.-J. Jang, and W.-H. Chang Isolation of Borrelia burgdorferi, the causative agent of Lyme disease, from Ixodes ticks in Korea. J. Korean Soc. Microbiol. 27: Nter, O., and A. G. Bretz Polymorphism of outer surface proteins of Borrelia burgdorferi as a tool for classification. Zentralbl. Bakteriol. Hyg. Ser. A 277: Rosa, P. A., D. Hogan, and T. G. Schwan Polymerase

7 VOL. 31, 1993 chain reaction analyses identify two distinct classes of Borrelia burgdorferi. J. Clin. Microbiol. 29: Rosa, P. A., and T. G. Schwan A specific and sensitive assay for the Lyme disease spirochete Borrelia burgdorfeni using the polymerase chain reaction. J. Infect. Dis. 160: Rosa, P. A., T. G. Schwan, and D. Hogan Recombination between genes encoding major outer surface proteins A and B of Borrelia burgdorferi. Mol. Microbiol. 60: Schwan, T. G., and W. Burgdorfer Antigenic changes of Borrelia burgdorferi as a result of in vitro cultivation. J. Infect. Dis. 156: Schwan, T. G., W. Burgdorfer, and C. F. Garon Changes in infectivity and plasmid profile of the Lyme disease spirochete, Borrelia burgdorferi, as a result of in vitro cultivation. Infect. Immun. 56: Schwan, T. G., K. K. Kime, M. E. Schrumpf, J. E. Coe, and W. J. Simpson Antibody response in white-footed mice (Peromyscus leucopus) experimentally infected with the Lyme disease spirochete (Borrelia burgdorferi). Infect. Immun. 57: Schwan, T. G., M. E. Schrumpf, and R. H. Karstens Rapid identification of small supercoiled plasmids in cloned populations of Borrelia burgdorferi, p In U. G. Munderloh and T. J. Kurtii (ed.), First International Conference on Tick-Borne Pathogens at the Host-Vector Interface: An Agenda for Research. University of Minnesota Extension Service, St. Paul, Minn. 48. Schwan, T. G., M. E. Schrumpf, R. H. Karstens, J. R. Clover, J. Wong, M. Daugherty, M. Struthers, and P. A. Rosa. Distribution and molecular analysis of Lyme disease spirochetes, Borrelia burgdorferi, isolated from ticks throughout California. Submitted for publication. 49. Simpson, W. J., W. Burgdorfer, M. E. Schrumpf, R H. LYME DISEASE SPIROCHETES FROM KOREA 1837 Karstens, and T. G. Schwan Antibody to a 39-kilodalton Borrelia burgdorferi antigen (P39) as a marker for infection in experimentally and naturally inoculated animals. J. Clin. Microbiol. 29: Simpson, W. J., W. Cieplak, M. E. Schrumpf, and T. G. Schwan. Unpublished data. 51. Simpson, W. J., C. F. Garon, and T. G. Schwan Analysis of supercoiled circular plasmids in infectious and non-infectious Borrelia burgdorferi. Microb. Pathog. 8: Simpson, W. J., M. E. Schrumpf, S. F. Hayes, and T. G. Schwan Molecular and immunological analysis of a polymorphic periplasmic protein of Borrelia burgdorferi. J. Clin. Microbiol. 29: Simpson, W. J., M. E. Schrumpf, and T. G. Schwan Reactivity of human Lyme borreliosis sera with a 39-kilodalton antigen specific to Borrelia burgdorferi. J. Clin. Microbiol. 28: Steere, A. C Lyme disease. N. Engl. J. Med. 321: Towbin, H., T. Staehelin, and J. Gordon Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76: Wilske, B., V. Preac-Mursic, U. B. G6bel, B. Graf, S. Jauris, E. Soutschek, E. Schwab, and G. Zumstein An OspA serotyping system for Borrelia bwgdorferi based on reactivity with monoclonal antibodies and OspA sequence analysis. J. Clin. Microbiol. 31: Wilske, B., V. Preac-Mursic, G. Schierz, R. Kuhbeck, A. G. Barbour, and M. Kramer Antigenic variability of Borrelia burgdorferi. Ann. N.Y. Acad. Sci. 539: Yamaguti, N., V. J. Tipton, H. L. Keegan, and S. Toshioka Ticks of Japan, Korea, and the Ryukyu Islands. Brigham Young Univ. Sci. Bull. Biol. Ser. 15: Downloaded from on January 21, 2019 by guest