Soybean Microarrays. Microarray construction. An Introduction. By Steve Clough

Transcription

1 Soybean Microarrays Microarray construction An Introduction By Steve Clough

2 Common Microarray platforms cdna: spotted collection of PCR products from different cdna clones, each representing a different gene Oligo: spot collections of oligos, usually bp long that span known/predicted ORFs. May have one or more oligos representing each gene. Affy: Affymetrix gene chips, 25 bp oligos 11 per gene predicted to span ORF Steve Clough, USDA-ARS

3 Soybean cdna Microarrays Microarray construction Produced in the lab of Dr. Lila Vodkin, U of Illinois l-vodkin@uiuc.edu

4 cdna Library Synthesis (represents expressed genes) extract RNA from AAAAAAAAAAAAAA AAAAAAAAAA variety of tissues and conditions AAAAAAAA cdna synthesis T T T T T T T T AAAAAAA Steve Clough, USDA-ARS AAAAAAAA T T T T T T T T AAAAAAAA Clone cdna into vector

5 A T T T T T T T T AAAAAAA C T G T T T T T T T T AAAAAAA GCTCTAAGTCATCGTACTAGATCT = protein kinase cdna clone Sequence cdna Compare EST sequence to database to identify Eliminate duplicates to generate set of unique clones Steve Clough, USDA-ARS T T T T T T T T AAAAAAA PCR amplify insert of unique clone set Pipette PCR products into microtiter plates to print onto slides

6 Printing microarrays picking up PCR samples Steve Clough, USDA-ARS

7 Steve Clough, USDA-ARS Printing PCR products on glass slides

8 Steve Clough, USDA-ARS Pin Washing Between PCR Samples

9 Spots of single-stranded DNA adhered to glass surface Typically 10-25,000 spots are printed on a standard 1 x 3 microscope slide TTCTAGTACA TTCTAGTACA TTCTAGTACA ACGTGTCCAA ACGTGTCCAA ACGTGTCCAA CAAGAGATACCG CAAGAGATACCG CAAGAGATACCG Note: DNA does not bind well to glass so glass is specially coated to allow ionic binding (poly-lysine slides) or covalent binding (amine or aldehyde slides) Steve Clough, USDA-ARS

10 Fluorescently label cdna from tissue of interest to hybridize to spots on the slide AAAAAAAAAAAAAA AAAAAAAAAA AAAAAAAA cdna synthesis and fluorescent labelling TTTTTTTTT TTTTTTTTT TTTTTTTTT Steve Clough, USDA-ARS

11 Direct Labelling labelling with with Reverse Transcriptase mrna 5? 3? AAAAAAAA RT dttttttt datp dgtp dttp dctp dutp mrna 5? cdna RT AAAAAAAA 3? TTTTTTT 3? 5? RNAse Steve Clough, USDA-ARS cdna TTTTTTT 3? 5?

12 Indirect labelling with aa-dutp and Reverse Transcriptase AAAAAAAAAAAAAA * aa-dutp dttp RT dtttttttt dctp datp dgtp * * * * * * * * * AAAAAAAAAA TTTTTTTTT Steve Clough, USDA-ARS

13 Steve Clough, USDA-ARS Indirect labelling with Klenow

14 Hybridization Chamber Flourescently labelled sample is pipetted under the coverslip and allowed to hybridize to spots on slide Steve Clough, USDA-ARS

15 Steve Clough, USDA-ARS Hybridization in Water Bath

16 Washing After Hybridization 15 minutes with shaking for each X SSC 0. 2 % SDS 0.2X SSC 0.2% SDS 0.1X SSC Spin dry 2 minute 500 rpm Steve Clough, USDA-ARS

17 Steve Clough, USDA-ARS Scan on a Fluorescent Scanner

18 Theory: Spot A will fluoresce 3 times brighter than Spot B AAGATCATGT* TTCTAGTACA AAGATCATGT* TTCTAGTACA TTCTAGTACA AAGATCATGT* TGCACAGGTT* ACGTGTCCAA ACGTGTCCAA ACGTGTCCAA Spot Gene A Spot Gene B Steve Clough, USDA-ARS

19 Blocking slides to reduce background. Example, positively charged amine slides DNA DNA DNA + DNA Wash with SDS to block charges and to remove excess DNA. Then place in hot water to generate single strands. Repeat SDS wash. Steve Clough, USDA-ARS

20 False Coloring of Fluorescent Signal Scale of increasing fluorescent intensities Steve Clough, USDA-ARS 2 65,536 Stronger signal (16 bit image)

21 Principles behind gene expression analysis mrna Fluorescent cdna Hybridized to array of individual spots of different genes Fluorescent intensity of spot is proportional to expression level Labelled representation of all recently expressed genes PFK1 DND1 EPS2 UNK UNK CRC1 PRP1 CHS1 UNK XPR1 UNK PHC1 Steve Clough, USDA-ARS

22 Fluorescent intensities from quality data (Background ~80) ,580 53,485 45,239 49,334 15,916 15,986 7,327 7,577 Steve Clough, USDA-ARS

23 Fluorescent intensities from quality data (Background ~80) 12,605 12,338 4,455 4,560 5,989 6,427 4,552 3,824 1,262 1,233 19,990 22,899 Steve Clough, USDA-ARS

24 2 dyes with well separated emission spectra allow direct comparison of two biological samples on same slide GSI Lumonics

25 Ratio of Expression of Genes from Two Sources Cells from condition A Cells from condition B mrna Label Dye 1 Label Dye 2 cdna Steve Clough, USDA-ARS equal higher in A higher in B

26 Cy3 Scan Cy5 Scan Overlay Steve Clough, USDA-ARS

27 Steve Clough, USDA-ARS Example: Cy3 scan of Uninoculated control

28 Steve Clough, USDA-ARS Example: Cy5 scan of Pathogen inoculated sample

29 CHS control gene often induced by pathogens Composite image of Inoculated vs control Steve Clough, USDA-ARS

30 Use software such as GenePix to extract data from image 1. Locate spots, define spot area, collect data from pixels within spots 2. Flags bad spots (ex: dust in spot) 3. Calculates ratio Cy5 fluorescent intensity over Cy3 intensity for each spot 4. Produces tab-delineated tables for import to analysis programs Steve Clough, USDA-ARS

31 Value of pixels within spot equals the raw data. Software will give pixel value related to fluorescence from both Cy3 and Cy5 scans Steve Clough, USDA-ARS

32 Cy5 Quick view of expression results per slide can be seen by examining scatter plots of Cy5/3 intensity ratios per spot 0 hr 6 hr 18 hr 48 hr Cy3 Cy3 Cy3 Cy3 Steve Clough, USDA-ARS

33 Oligo-based Microarrays Design specific oligos for every ORF Spotted Microarray Synthesize with 5 -amino linker Design one to multiple oligos/orf Collect in 384-well plates Spot on aldehyde coated slides Affymetrix Gene Chips Synthesize oligo directly on chip Proprietary photolithography synthesis 11 oligo/orf plus mismatches Spotted oligo termed the probe Perfect match oligos 1-base mismatch oligos Steve Clough, USDA-ARS

34 GeneChip Probe Arrays GeneChip Probe Array Hybridized Probe Cell Single stranded, labeled RNA target Oligonucleotide probe * * * * * 11 µm 1.28cm Millions of copies of a specific oligonucleotide probe > 1,200,000 different complementary probes Image of Hybridized Probe Array Courtesy of Mike Lelivelt

35 SYBR Green I (SG) is an asymmetrical cyanine dye [1] used as a nucleic acid stain in molecular biology. SYBR Green I binds to DNA. The resulting DNA-dye-complex absorbs blue light (λ max = 497 nm) and emits green light (λ max = 520 nm). The stain preferentially binds to double-stranded DNA, but will stain single-stranded DNA with lower performance. SYBR green can also stain RNA with a lower performance than DNA

36 URI Genomics & Sequencing Center Calculator for determining the number of copies of a template enter amount of DNA (ng): enter length of template (bp): number of copies :x10^ This calculation is based on the assumption that the average weight of a base pair (bp) is 650 Daltons. This means that one mole of a bp weighs 650 g and that the molecular weight of any double stranded DNA template can be estimated by taking the product of its length (in bp) and 650. The inverse of the molecular weight is the number of moles of template present in one gram of material. Using Avogadro's number, 6.022x10 23 molecules/mole, the number of molecules of the template per gram can be calculated: mol/g * molecules/mol = molecules/ g Finally, the number of molecules or number of copies of template in the sample can be estimated by multiplying by 1*10 9 to convert to ng and then multiplying by the amount of template (in ng) This calculator requires the user to input the amount of a template present (in ngs) and the length of the template (in bp) and with this information the number of copies of the template is calculated. The formula used is: number of copies = ( amount * 6.022x10 23 ) / (length * 1x10 9 * 650) number = (ng * number/mole) / (bp * ng/g * g/ mole of bp) If 100 bp DNA is 1000ng(1ug), number of DNA copies id 9.26 X 10 12

37 Nucleic acids absorb ultraviolet light in a specific pattern. In the case of DNA and RNA, a sample that is exposed to ultraviolet light at a wavelength of 260 nanometres (nm) will absorb that ultraviolet light. The resulting effect is that less light will strike the photodetector and this will produce a higher optical density (OD)

38 Real time qpcr Ct value

39 Absolute and Relative Qua

40 2 x =10

41

42 How do we measure changes in gene expression? Real time qpcr: In molecular biology, real-time polymerase chain reaction, also called quantitative real time polymerase chain reaction (qpcr) or kinetic polymerase chain reaction is a laboratory technique based on the PCR, which is used to amplify and simultaneously quantify a targeted DNA molecule. For one or more specific sequences in a DNA sample, Real Time-PCR enables both detection and quantification. The quantity can be either an absolute number of copies or a relative amount when normalized to DNA input or additional normalizing genes

43 AAAAAAAA AAAAAAAA AAAAAAAA AAAAAAAA AAAAAAAA Glycosyl hydrolases WRKY protein Peroxidase Heat shock protein 70 RNA-dependent RNA polymerase Calcium-binding protein Calmodulin-binding protein No apical meristem () protein RNase3-like protein Myb-like DNA-binding protien Plastocyanin-like protein NBS-LRR resistance gene analogue Glycosyl hydrolases Seed-storage protease inhibitor Glycosyl hydrolase Protein phosphatase 2C Pathogenesis-related 10-like protein AAAAAAAA AAAAAAAA AAAAAAAA AAAAAAAA AAAAAAAA AAAAAAAA AAAAAAAA

44 Reverse Transcription The enzyme is encoded and used by reverse-transcribing viruses, which use the enzyme during the process of replication. Reversetranscribing RNA viruses, such as retroviruses, use the enzyme to reverse-transcribe their RNA genomes into DNA, which is then integrated into the host genome and replicated along with it. Human Immunodeficiency Virus (HIV) and Human T-Lymphotropic virus (HTLV).

45 Soybean Arabidopsis PFAM Fold change Glyma01g At5G Dirigent-like protein 27.3 ± 20.0 Glyma15g At1G LRR stress-induced receptor kinase 21.9 ± 2.6 Glyma10g At5G Iron/manganese superoxide dismutases 18.2 ± 5.5 Glyma05g At4G Thaumatin-like protein 15.2 ± 3.1 Glyma03g At2G Putative cytochrome P ± 3.1 Glyma09g At2G Cf-2-like LRR resistance gene analogue 8.2 ± 1.1 Glyma06g At2G Protein tyrosine kinase 7.8 ± 2.6 Glyma09g At5G Glycosyl hydrolases 7.1 ± 1.1 Glyma06g At1G WRKY protein 6.7 ± 1.5 Glyma15g At2G Peroxidase 5.9 ± 1.4 Glyma15g At1G Heat shock protein ± 1.4 Glyma02g At1G RNA-dependent RNA polymerase 5.2 ± 1.2 Glyma04g At1G Calcium-binding protein 4.7 ± 1.6 Glyma09g At1G Calmodulin-binding protein 4.7 ± 1.2 Glyma11g At5G No apical meristem () protein 3.9 ± 1.1 Glyma09g At3G RNase3-like protein 3.7 ± 0.9 Glyma14g At5G Myb-like DNA-binding protien 3.5 ± 1.0 Glyma17g At5G Plastocyanin-like protein 3.2 ± 0.4 Glyma17g At4G NBS-LRR resistance gene analogue 3.0 ± 0.4 Glyma12g At3G Glycosyl hydrolases 2.7 ± 0.5 Glyma05g At3G Seed-storage protease inhibitor 2.4 ± 0.1 Glyma11g At4G Glycosyl hydrolase -2.2 ± 0.1 Glyma05g At2G Protein phosphatase 2C -2.2 ± 0.2 Glyma15g At1G Pathogenesis-related 10-like protein -2.3 ± 0.1

46 Gene expression: Fold change? 2 ΔCt((CtTarget mrna A CtHousekeeper mrna)-(cttarget mrna B CtHousekeeper mrna) Based on Standard Curve we can anticipate copy number of mrna