M1-AChR GCTCAAAGTGGGTGCCCTTG GGAGGGAGGAAGGGAAAGAGAG

Transcription

1 Table S1. List of primer sequences: Gene Forward (5-3 ) Reverse (5-3 ) M1-AChR GCTCAAAGTGGGTGCCCTTG GGAGGGAGGAAGGGAAAGAGAG M2-AChR CATGCCTGGTGGTGATGGTG GGCCCAGGGAAGTGGAAAC M3-AChR TTATGAACCGCTGGGCTCTG AATCATCACACCGGCTCGTT M4-AChR GCTAGTTCCGCCGTCTGTCC CAGGTGGTTGTGGGCTGTTG M5-AChR GCATGGCTGGTCTCCTTCATC CCCGGTAGATCCGGCAGTAG

2 Figure S1. pm1shrna enables Cre-dependent knockdown of M1-AChR, but did not influence mrna levels of other machrs a pm1shrna TATA-loxP TATA-loxP b CMV U6 CMV pm1shrna/cag-cre(-) TATA-loxP + Cre recombinase CMV U6 M1shRNA hgh polya M1shRNA hgh polya c pm1shrna/cag-cre(+) / / d 1.5 e 1.5 f mrna (fold change) CAG-Cre pcon + + pm1shrna M1-AChR mrna (fold change) CAG-Cre pcon M2-AChR M3-AChR M4-AChR M5-AChR pm1shrna machr mrna (fold change) 2 1 CAG-Cre + pcon pm1shrna pcon pm1shrna pcon pm1shrna pcon pm1shrna

3 Figure S2. M1-AChR knockdown in CaMKII CRE and SST CRE mice in a neuron-specific manner. a WT/AAV2 M1shRNA b 3 CaMKII CRE / 1 AAV2 M1shRNA M1-AChR M1-AChR Relative Fluorescent Intensity (x 1 3 ) 2 WT/ AAV2 M1shRNA CaMKII CRE / AAV2 M1shRNA c SST CRE /AAV2 SCR d 1 SST CRE /AAV2 M1shRNA M1-AChR M1-AChR Relative Fluorescent Intensity (x 1 3 ) SST CRE / AAV2 SCR SST CRE / AAV2 M1shRNA

4 Figure S3. M1-AChR knockdown in CaMKII CRE mice did not affect FosB activation following scopolamine treatment. a WT/AAV2 M1shRNA FosB Saline FosB Scopolamine b # FosB+ cells Prelimbic SAL SCOP SAL SCOP WT/ CaMKII CRE / AAV2 M1shRNA AAV2 M1shRNA CaMKII CRE /AAV2 M1shRNA c # FosB+ cells Infralimbic FosB FosB SAL SCOP SAL SCOP WT/ CaMKII CRE / AAV2 M1shRNA AAV2 M1shRNA

5 Figure S4. Somatostatin and parvalbumin interneurons have varied distribution in the mpfc. V III II I I II III V SST PL PV PL V III II I I II III V PV SST IL IL

6 Figure S5. AAV2 M1shRNA infusion in the mpfc of SST CRE or PV CRE mice did not influence baseline behavior. a Wild-type SST CRE PV CRE 3 weeks Bilateral mpfc infusion of psico-m1shrna OF Preswim Saline or Scopolamine (25 µg/kg) FST NSFT b c d Open Field (distance, m) WT SST CRE e 6 2 f g Open Field (distance, m) 4 2 WT PV CRE Open Field (center time, s) WT SST CRE WT SST CRE AAV2 M1shRNA AAV2 M1shRNA AAV2 M1shRNA Open Field (center time, s) Pre-swim (Immobility, s) Pre-swim (Immobility, s) 5 WT PV CRE WT PV CRE AAV2 M1shRNA AAV2 M1shRNA AAV2 M1shRNA

7 Figure S6. AAV2 M1shRNA, but not AAV2 SCR, infusion in the mpfc of SST CRE mice blocked scopolamine antidepressant-like effects in NSFT. a Wild-type 3 weeks b 6 SST CRE Bilateral mpfc infusion of AAV2 M1shRNA or AAV2 SCR Preswim Saline or Scopolamine (25 µg/kg) FST FUST NSFT NSFT (latency, s) SAL SCOP SAL SCOP SAL SCOP WT/ SST CRE / SST CRE / AAV2 M1shRNA AAV2 SCR AAV2 M1shRNA

8 Supplemental Figure Legends: Table S1. List of primer sequences. Figure S1. pm1shrna enables Cre-dependent knockdown of M1-AChR, but did not influence mrna levels of other machrs. a) Layout of pm1shrna construct and Cre-induced recombination enabling U6 driven expression of M1shRNA. b) Representative images of N2a transfection with pm1shrna alone (no CAG-Cre) showing expression of and expression. c) Representative images of N2a co-transfection with pm1shrna and CAG-Cre showing expression and limited after recombination. Relative gene expression of (d), M1-AChR (e), and other machrs (f) in transfected N2a cultures. Figure S2. M1-AChR knockdown in CaMKII CRE and SST CRE mice in a neuron-specific manner. a) Representative images of,, and M1-AChR in pyramidal neurons from wild-type (WT) or CaMKII CRE mice infused with AAV2 M1shRNA. b) Quantification of M1-AChR relative fluorescent intensity in WT and CaMKII CRE mice. c) Representative images of,, and M1-AChR in recombined interneurons from SST CRE mice infused with AAV2 SCR or AAV2 M1shRNA. d) Quantification of M1-AChR relative fluorescent intensity in SST CRE mice. Means that are significantly different than respective control group based on T-test are noted by (, p <.5). Figure S3. M1-AChR knockdown in CaMKII CRE mice did not affect FosB activation following scopolamine treatment. a) Represenative images of FosB immunolabeling in the prelimbic mpfc of wild-type (WT) or CaMKII CRE mice infused with AAV2 M1shRNA and treated with saline or scopolamine. White scale bar represents 1 µm. Quantification of FosB+ cells in the prelimbic (b) and infralimbic (c) mpfc. Means that are significantly different than respective saline group based on ANOVA are noted by (, p <.5). Figure S4. Somatostatin and parvalbumin interneurons have varied distribution in the mpfc. Representative images of somatostatin (SST) and parvalbumin (PV) immunolabeling in the prelimbic (PL) and infralimbic (IL) regions of the mpfc. Approximate laminar regions (I-V) are noted. White scale bar represents 1 µm. Figure S5. AAV2 M1shRNA infusion in the mpfc of SST CRE or PV CRE mice did not influence baseline behavior. As in Fig.7, wild-type (WT) littermates and SST CRE or PV CRE mice were infused with AAV2 M1shRNA and treated with saline or scopolamine (a). In SST CRE mice baseline open-field distance traveled (b), time in center of open-field (c), and immobility in pre-swim test (d) are shown. In PV CRE mice baseline open-field distance traveled (e), time in center of openfield (f), and immobility in pre-swim test (g) are shown. Figure S6. AAV2 M1shRNA, but not AAV2 SCR, infusion in the mpfc of SST CRE mice attenuated scopolamine antidepressant-like effects in NSFT. As in Fig.9, wild-type (WT) littermates and SST CRE mice were infused with either AAV2 M1shRNA or scrambled control (AAV2 SCR ) and treated with saline or scopolamine (a). Following saline or scopolamine treatment, latency to feed in the NSFT is shown (b). 31