Agricultural soils as rich sources of potential biocontrol agents from the filamentous fungal genus Trichoderma

Transcription

1 SOILMAP Agricultural soils as rich sources of potential biocontrol agents from the filamentous fungal genus Trichoderma László Kredics 1, Shahram Naeimi 2, András Szekeres 3, Sándor Kocsubé 1, Péter Körmöczi 1, Mohammad Javan Nikkhah 2, László Manczinger 1, Lucian Dumitru Niţă 4, Dorin Tărău 5, Csaba Vágvölgyi 1 1 Department of Microbiology, Faculty of Science and Informatics, University of Szeged, Hungary 2 Department of Plant Protection, Faculty of Agriculture, University of Tehran, Karaj, Iran 3 FumoPrep LtD., Mórahalom, Hungary 4 Banat University of Agricultural Sciences and Veterinary Medicine, Timişoara, Romania 5 Office of Pedological and Agrochemical Studies, Timişoara, Romania

2 Importance of the genus Trichoderma Beneficial sides: Ecological role: degradation of plant residues in the soil Biotechnological importance: cellulose degradation (T. reesei) Agricultural application: biological control of plant pathogenic fungi (T. harzianum, T. virens, T. atroviride) Harmful sides: Clinical importance: opportunistic infections in immunocompromised patients (T. longibrachiatum) Green mould disease of cultivated mushrooms (T. aggressivum, T. pleurotum, T. pleuroticola) Benhamou and Chet, Appl. Environ. Microbiol. 63:2095, 1997 Munoz et al., J. Clin. Microbiol. 35:499 (1997)

3 Antagonism of biocontrol Trichoderma strains Direct effect on the target organism: competition antibiosis mycoparasitism Indirect effect on the target organism: Induction of resistance in plants Plant growth promotion

4 Aims Isolation of Trichoderma strains from agricultural habitats (winter wheat and rice fields) Molecular identification of the isolates by DNA sequence analysis of the internal transcribed spacer region Selection of strains with biocontrol potential Development of strain specific monitoring tools

5 Biodiversity of the genus Trichoderma in Hungarian winter wheat fields

6 Isolation of Trichoderma strains Sampling of winter wheat fields: 18 sampling sites 5 agricultural areas in Southern Hungary Algyő: 1 site Deszk: 4 sites Rúzsa: 6 sites Kunszentmiklós: 2 sites Tiszasziget: 5 sites Isolation: sampling directly the surface of roots selective medium: Dichloran Rose Bengal agar total: 116 Trichoderma isolates

7 Species level identification based on internal transcribed spacer (ITS) sequences - primers: - ITS1: 5 TCCGTAGGTGAACCTGCGG3 - ITS4: 5 TCCTCCGCTTATTGATATGC3 - product: 600 bp fragment - identification: - oligonucleotid barcode method (TrichOkey 2.0,

8 Trichoderma species isolated from winter wheat fields Trichoderma species Number of isolates Number of ITS-genotypes T. harzianum 41 8 T. virens 31 2 T. rossicum 10 2 T. atroviride 9 2 T. pleuroticola 3 1 T. tomentosum/t. cerinum 3 1 T. spirale 1 1 T. brevicompactum 4 1 T. gamsii 6 1 T. koningiopsis/t. ovalisporum 3 1 T. longibrachiatum/h. orientalis 5 1 Total

9 Occurrence of different species in the particular samples - K1: 6 species; R2: 1 species - most frequently isolated species: T. harzianum - occurrence in 12 samples - dominance in 7 samples (A1, D2, D3, R1, R6, T1, T3) 16 Number of isolates Number of isolates AL D1 D2 D3 D4 K1 K2 R1 R2 R3 R4 R5 R6 T1 T2 T3 T4 T5 Sample Sample T. harzianum, T. pleuroticola, T. tomentosum/t. cerinum, T. virens, T. rossicum, T. spirale, T. longibrachiatum/h. orientalis, T. brevicompactum, T. atroviride, T. gamsii, T. koningiopsis/t. ovalisporum

10 Typing of Trichoderma isolates by cellulose acetate electrophoresis (CAE) based isoenzyme analysis G6PDH PEP B GPI PEP D PEP A PGM G6PDH: glucose-6-phosphate dehydrogenase; GPI: glucose-6- phosphate isomerase; PEP A: peptidase A; PEP B: peptidase B; PEP D: peptidase D; PGM: phosphoglucomutase

11 Examined enzyme actvities Enzyme Abbrev. E.C. number Activity Number of electrophoretic patterns 6-phosphogluconate dehydrogease 6PGDH Aconitase ACN Glucose-6-phosphate dehydrogenase G6PDH Glucose-6-phosphate isomerase GPI Glycerol-3-phosphate dehydrogenase GPDH Malate dehydrogenase MDH Peroxidase PRX Peptidase A (Gly-Leu) PEP A / Peptidase B (Leu-Gly-Gly) PEP B / Peptidase D (Phe-Pro) PEP D / Phosphoglucomutase PGM Shikimate dehydrogenase SKDH Succinate dehydrogenase SUD

12 Isoenzyme analysis of the isolated Trichoderma strains T. harzianum, T. pleuroticola, T. tomentosum/t. cerinum, T. virens, T. rossicum, T. spirale, T. longibrachiatum/h. orientalis, T. brevicompactum, T. koningiopsis/t. ovalisporum, T. atroviride

13 Phylogenetic analysis of the isoenzyme patterns by parsimony analysis - The particular species are well represented by the patterns

14 Combined phylogenetic analysis of ITS-sequences and isoenzyme patterns by Bayesian analysis

15 Selection of Trichoderma strains for the biological control of wheat diseases caused by Fusarium species

16 Biocontrol abilities of the isolated Trichoderma strains - in vitro antagonism experiments, quantitative evaluation of the results by image analysis - aggressivity assays: measuring the infective abilities of Fusarium strains in the presence and absence of Trichoderma isolates - production of antibiotics - production of extracellular enzymes Promising biocontrol strains could be identified.

17 Biodiversity of the genus Trichoderma in Iranian rice fields

18 Isolation of Trichoderma strains CASPIAN SEA MAZANDARAN Sampling of rice fields: 45 rice fields located in different regions of Mazandaran province, Northern Iran sampling of soil and rice phyllosphere strain isolation on Trichoderma-selective medium total: 202 Trichoderma isolates

19 ITS-based identification of the isolates Trichoderma species From soil From rice phyllosphere Total T. harzianum T. virens T. atroviride T.hamatum 3-3 T. asperellum 1-1 T. brevicompactum 1-1 Total most frequent species: T. harzianum and T. virens (186 isolates) T. harzianum dominates in rice phyllosphere T. virens is more frequent in the soil than in the phyllosphere

20 Biodiversity of T. harzianum isolates from rice fields based on ITS sequences

21 Biodiversity of T. harzianum isolates from rice fields based on ITS sequences ITS type Characteristic sequence area Position 112 (ITS1) 145 (ITS1) 163 (ITS1) 404 (ITS2) hz a 5'...ACC-AAAACTCTTATT...TTTTTTTTTATAAT...GCCTT-CT...CCCTGCCTT--GGCGGTG...3' hz b 5'...ACC-AAAACTCTTATT...TTTTTTT--ATAAT...GCCTT-CT...CCCTGCCTT--GGCGGTG...3' hz c 5'...ACC-AAAACTCTTATT...TTTTTTT--ATAAT...GCCTT-CT...CCCTGCCTTAGCGGGGTG...3' hz d 5'...ACC-AAAACTCTTATT...TTTTTTTT-ATAAT...GCCTT-CT...CCCTGCCTTAGCGGGGTG...3' hz e 5'...ACC-AAAACTCTTTTT...TTTTTT---ATAAT...GCCTT-CT...CCCTGCCTTAGCG-GG-G...3' hz f 5'...ACC-AAAACTCTTTTT...TTTTTT---ATAAT...GCCTT-CT...CCCTGCCTT--GGCGGTG...3' hz g 5'...ACC-AAAACTCTTTTT...TTTTTT---ATAAT...GCCTT-CT...CCCTGCCTTT-GGCGGTG...3' hz h 5'...ACC-AAAACTCTTTTT...TTTTTT---ATAAT...GCCTT-CT...CCCTGCCTCT-GGCGGTG...3' hz i 5'...ACC-AAAACTCTTTTT...TTTTTT---ATAAT...GCCTT-CT...CCCTGCCTCTTGGCGGCG...3' hz j 5'...ACC-AAAACTCTTTTT...TTTTTTTTTATAAT...GCCTT-CT...CCCTGCCTCT-GGCGGTG...3' hz k 5'...ACCTAAAACTCTTATT...TTTTTTT--ATAAT...GCCTT-CT...CCCTGCCTT--GGCGGTG...3' hz l 5'...ACCTAAAACTCTTATT...TTTTTTT--ATAAT...GCCTT-CT...CCCTGCCTTAGCG-GGTG...3' hz m 5'...ACCTAAAACTCTTATT...TTTTTTTT-ATAAT...GCCTTTCT...CCCTGCCTTAGCG-GGTG...3' hz n 5'...ACCTAAAACTCTTATT...TTTTTTT--ATAAT...GCCTT-CT...CCTTCCTTCA-CG-GG-G...3' Alignment of characteristic sequence areas within ITS1 and ITS2 regions. Positions that are variable between the ITS-types are indicated in red. Arrows indicate positions within the ITS region in relation to the first nucleotide of ITS1.

22 Selection of Trichoderma strains for the biological control of rice sheath blight caused by Rhizoctonia solani

23 Sheath blight of rice rice (Oryza sativa): the most important seedcropintheworld sheath blight is globally the most important rice disease (up to 50% crop loss) serious problems due to rice sheath blight in Iran factors facilitating the ocurrence of rice sheath blight: introduction of new, high-yielding, high-tillering rice varieties high plant density increased number of leaf-leaf and leaf-stem contacts application of nitrogen fertilizers less sunlight, high humidity, hot climate

24 Sheath blight of rice the pathogen: Rhizoctonia solani (teleomorph: Thanatephorus cucumeris, Basidiomycota) initial symptoms: lesions on lower sheats during the late tillering or early internode elongation phases under optimal microclimatic conditions the infection is spreading to the upper plant parts and neighbouring plants mycelia in the host plant, survival with sclerotia in the soil

25 Possibilities of control control: exclusively with chemical pesticides (e.g. Tilt propiconazole) harmful effects on the environment and human health reliable, environment-friendly solutions needed biological control by antagonistic microorganisms genus Trichoderma: several potential biocontrol species members of the genus Trichoderma are frequently occurring on rice fields, both in the soil and on the surface of plants

26 Biocontrol abilities of the Trichoderma strains isolated from Iranian rice fields In vitro antagonism of Trichoderma strains against R. solani determined by the dual culture test Testing the effect of Trichoderma strains on viability of sclerotia Evaluation of the potential of Trichoderma strains for controlling sheath blight under glasshouse conditions 76 strains belonging to T. harzianum, T. virens and T. atroviride showed good biocontrol capabilities 14 could significantly control the disease at different levels T. harzianum AS12-2 was the best in controlling rice sheath blight, even better than propiconazole, the commonly used fungicide in Iran

27 Most promising isolates based on in vitro and glasshouse tests Isolate Species Source Location Biocontrol ability AS12-1 T. harzianum Soil Chalous Excellent AS12-2 T. harzianum Soil Chalous Excellent AS12-3 T. harzianum Soil Chalous Excellent AS12-4 T. harzianum Soil Chalous Excellent AD1-3 T. virens Plant litter Amol Excellent AS3-4 T. virens Soil Amol Good AS3-5 T. harzianum Soil Amol Excellent AS6-1 T. virens Soil Mahmood Abad Good AS15-6 T. harzianum Soil Sari Good AS16-22 T. virens Soil Sari Good AS20-3 T. harzianum Soil Amol Good AS21-1 T. harzianum Soil Amol Good AS21-2 T. harzianum Soil Amol Good AS22-1 T. harzianum Soil Amol Good

28 Development of strain-specidic monitoring tools for a Trichoderma strain with biocontrol potential

29 Significance of strain specific markers in biocontrol survival, spreading and population dynamics of biocontrol Trichoderma strains applied to the field discrimination of introduced Trichoderma strains from the naturally occurring ones exogenous markers: green fluorescent protein, β-glucuronidase, hygromycin B resistance endogenous markers (e.g. strain specific DNA sequences) UP-PCR (Universally Primed): fingerprinting technique similar to RAPD, non random primers aimed at the more variable, intergenic sequences strategy: SCAR (Sequence-Characterized Amplified Regions) targeted strain: T. harzianum AS12-2 Lu et al. Appl. Environ. Microbiol. 70:3073 (2004) Bae and Knudsen, Appl. Environ. Microbiol. 66:810 (2000)

30 Tested UP-primers and reaction conditions UP primer Length Sequence (5 3 ) Reference L45 17mer GTAAAACGACGGCCAGT Bulat et al., Mycol. Res. 102:933 (1998) mer TAAGGGCGGTGCCAGT Bulat et al., Mycol. Res. 102:933 (1998) AA2M2 16mer CTGCGACCCAGAGCGG Lübeck et al., FEMS Microbiol. Lett. 237:255 (2004) AS15inv 17mer CATTGCTGGCGAATCGG Bulat et al., Mycol. Res. 102:933 (1998) L15/AS19 15mer GAGGGTGGCGGCTAG Lübeck et al., FEMS Microbiol. Lett. 237:255 (2004) Step Temperature Time First denaturation 94 C 3 min DNA denaturation 92 C 50 s Primer annealing 55.7 C 80 s Primer extension 72 C 60 s 30 cycles Final extension 72 C 3 min

31 UP-PCR results T. harzianum T. virens M AS AS15inv alone 2. AA2M2 alone 3. Combination of AS15inv and AA2M2

32 Design of SCAR-primers cloning and sequencing of the fragments (904 bp, 684 bp és 842 bp) criteria of primer design: primers should not contain any single nucleotide repetitions a GC-content of about 50%, calculated melting point around C the 3 end of the primers should not show complete homology with any known Trichoderma sequence with any known sequence from R. solani and other filamentous fungi with the rice genom

33 SCAR-primers designed for the 3 specific fragments SCAR primer Length (nucleotide) Sequence (5 3 ) T m ( C) 15invFL1 22 CTGTGCTCCAATTGATCGACGA invF2 22 TTGCTGGCGAATCGGAGGATAC invRL1 26 GACAACTTGAAGGTAGACGAATCGTC invFS1 23 GCTTCAGTCGTATCAACCTTGGT invRS1 22 GTGTGATGTGCAAATCGGCAAG AA2M2FL1 22 GCCGGAGACTTACCTGAACCAT AA2M2RL1 24 AACTCGCGAGGCAACTTTATTCAG AA2M2FS1 24 ACCATCATCGGGTCGTTATTAAGC AA2M2RS1 23 CGTGCTGTCTAAAGTCTACGACC M2invFL1 21 CCGAACATTGCACGCAGTTCT M2invF2 22 CGGTAAGAACCGAACATTGCAC M2invRL1 22 GCACCACTATGGGCCTCTAACT M2invFS1 25 GTCAAATAGCCACTTGGACATGTCA M2invRS1 22 GCCGTCAAATTACACACGCATC 57.33

34 Testing of primer combinations with the representatives of the 14 T. harzianum ITS-genotypes Step Temperature Time Initial denaturation 94 C 1 min DNS denaturation 94 C 10 s Primer annealing and extension 67 C 35 s 35 cycles two primer combinations (15invFL1/15invRL1 and 15invF2/15invRL1) amplified a product only from strain AS12-2

35 Diagnostic PCR with specific primers M AS12-2 Negative result with 145 Trichoderma strains isolated from rice fields (13 T. harzianum ITS-genotypes, T. virens, T. atroviride, T. hamatum, T. asperellum, T. brevicompactum), with R. solani, and with other filamentous fungi commonly occurring in rice fields Future perspectives: testing the method with DNA-extracts from BCA-loaded and unloaded soil/leaf surface application for the on field monitoring of T. harzianum AS12-2

36 Summary Hungarian winter wheat fields Iranian rice fields Sampling sites Number of Trichoderma isolates Detected Trichoderma species 11 6 Biodiversity high medium Potential biocontrol agents yes yes Opportunistic human pathogens yes no Mushroom green mould species yes no In vitro antagonism experiments performed performed Glasshouse trials not performed performed Monitoring tools not developed developed

37 Thank you for your attention!