mrna PD 98059, ( P > 0105), %, % % 42Cyano232M2thylisoquinoline genistein PD 98059,
|
|
- Clifford Sharp
- 5 years ago
- Views:
Transcription
1 2, 26 (4) : 7 77 Journal of N anjing A gricultural U niversity mrna 1,2, 1, 2, 2 1, ( 1., 2195; 2., 2116) :,, EL ISA, RT2PCR mrna, G NF 2 C GF 192X 2 heparin Ca 2 + / calmodulin KN262 C U27122 G, ( P < 11) A 42Cyano22 M2thylisoquinoline genistein PD 9859, ( P > 15), %, 9111 % 8169 % 42Cyano22M2thylisoquinoline genistein PD 9859, 1 mrna ( P > 15), mrna, A : ; ; : S : A : 1 2 ( 2) Influences of signal transduction inhibitors on the production of monoclonal antibody and the expression of 1 mrna in hybridoma cells stimulated by bursin MIAO De2nian 1,2, SU Xiao2yun 1, YAO Hui2juan 2, FAN Sheng2chao 2, CHEN Pu2yan 1 ( 11 Key Laboratory of Animal Disease Diagnostic and Immunology, Ministry of Agriculture, Nanjing Agric Univ, Nanjing 2195, China ; 21 Animal Husbandry and Veterinary Research Institute, Shangha i Academy of Agricultural Sciences, Shangha i 2116, China) Abstract : In order to investigate the influences of signal transduction inhibitors on the antibody production and mrna expres2 sion in hybridoma cells promoted by bursin, hybridoma cells pre2treated by different inhibitors were stimulated by bursin, then antibody levels and mrna expression levels of which were tested by indirect EL ISA and semi2quantitative RT2PCR respectively. The results showed that, after treatment with NF2, GF192 X, heparin, KN262, U27122 and inhibitor of protein kinase G, bursin could still greatly promote the production of monoclonal antibody in hybridoma cells ( P < 11), while bursin played no role on the production of monoclonal antibody in hybridoma cells pre2treated by 42Cyano22M2thylisoquinoline, genis2 tein and PD9859 respectively. The inhibiting eff iciency of 42 Cyano22M2 thylisoquinoline, genistein and PD9859 on the pro2 duction rate of monoclonal antibody in hybridoma cells were %, 9111 %and 8169 %respectively. The expression levels of 1 mrna in hybridoma cells treated with bursin and 42Cyano22M2thylisoquinoline, genistein or PD9859 were , and respectively, showed no signif icant difference from that of hybridoma cells stimulat2 ed with 42Cyano22M2thylisoquinoline, genistein or PD9859 alone ( P > 15). These results indicated that protein kinase A ( PKA), tyrosine kinase and mitogen2activated protein kinase kinase ( MAPKK) were involved in the signal transduction of bursin on hybridoma cells. Key words : hybridoma cells; signal transduction inhibitors; bursin : : ( 1772) : ( 197 ),, E2mail : Corresponding author ' China Academic Journal Electronic Publishing House. All rights reserved.
2 74 26 ( bursin, BS) 1, [, 1 6],,, mrna, Peptide ; IgG, IgG 1, ; RPMI2164 Gibcou ; ; 9 NF2 ( Go/ Gi G ) GF192X ( C ) 42Cyano22M2thylisoquinoline ( A ) genistein ( ) PD9859 ( ) heparin ( 2 ) KN262 ( Ca 2 + / calmodulin ) U27122 ( C ) G, Cal2 biochem AMV ( avian myeloblastosis virus reverse transcriptase) T 4 D NA RNasin pgem2t easy vector Promega, dntp Olid ( T) 1, Taq D NA DL2 Ta Ka Ra ( ), RNA ( TRIzol) Gib2 co/ BRL AR 112, 1 % RPMI2164, 7 5 % CO 2, 11 D 49 1 g ml - 1 IgG ph mol L - 1 CBS ( ) , 1 L, 7 1 h, 4 ;,,, 1 % BSA 1 h;, 11, 12, 14, g ml - 1 IgG 1, 1 L ; PBS, 7 1 h;, 1 5, 7 1 h;, OPD ; 2 mol L - 1 H 2 SO 4 ; D 49 D ,, 6, ml , 1 L ;, 5 L, 7 min ; 1 g ml L, 7 5 % CO 2 2 h h, D 49, = ( h - 2 h ) / ( - 2) = ( ) - ( - ) ( - ( ( + ) mrna ) ) / + 2,, 6, 5 L ( 2 mol L Cyano22M2thylisoquinoline 1 mol L - 1 genistein 1 mol L - 1 PD9859), 7 min ; 1 g ml - 1, 7 5 % CO 2 6 min ;, TRIzol RNA RNA
3 4 : mrna RT2PCR mrna 1 5 2AAACCAAAGGCAGACCGA2 5 2TTTACCAGGAGAGTGGGAGA2 2actin 5 2CCCATCTACGAGGGCTAT2 5 2CTGGAAGGTGGACAGT GAG2 1 2actin cd NA 1 2 L, PCR 5 RT2Buffer 4 L, 1 mmol L - 1 dntp 2 L, 25 mmol L - 1 MgCl 2 18 L, 5 U L - 1 RNA 12 L, 1 ng L - 1 Olid ( T) 1 2 L, 1 ng L - 1 RNA 4 L, RNA 19 L, ; min ; 1 U L - 1 AMV 1 L, 42 1 h, 95 5 min 2 L, PCR 48 L ( 1 PCR2Buffer 5 L, 25 mmol L - 1 MgCl 2 4 L, 1 mmol L - 1 dntp 1 L, 5 U L - 1 Taq 12 L, 1 pmol 1 16 L, 2 pmol 2actin 1 L, 48 L), 94 5 min, 2 PCR ( 94 s, 51 s, 72 s), 72 1 min PCR 1 L 115 % EB Kodak 1D Electrophoresis Documentation and Analysis System 12 1 mrna/ 2 actin mrna mrna 117 Microsoft Excel, t D 49, g ml - 1 D 49 1, D 49 ( R 2 = 1999 ), y = 1 5e 21 x 1 D 49 Table 1 D 49 of monoclonal antibodies with different concentrations for standard curve ( x S E) / g ml - 1 Concentration of McAb D ,, 9 NF 2 GF192X heparin KN262 U27122 G, ( P < 11) 42Cyano22M2thylisoquinoline genistein PD9859, ( P > 15), %, 9111 % 8169 % 2, NF2 GF192X 42Cyano22M2thylisoquinoline genistein PD9859 heparin KN262 Groups 2 ( x S E, n = 6) Table 2 Effect of signal transduction inhibitors on antibody2secreting rate of hybridoma cells Treatment 1 NF2 + 5 g ml 21 bursin / g ml - 1 h - 1 Groups Antibody2secreting rate Treatment Heparin + 5 g ml - 1 bursin / g ml - 1 h - 1 Antibody2secreting rate NF Heparin GF192 X+ 5 g ml - 1 bursin KN g ml - 1 bursin GF192 X KN Cyano22Mthylisoquinoline + 1 g ml - 1 bursin U g ml - 1 bursin Cyano22M2thylisoquinoline U Genistein + 5 g ml - 1 bursin PKG inhibitor + 5 g ml - 1 bursin Genistein PKG inhibitor PD g ml - 1 bursin g ml - 1 bursin PD Control without bursin and inhibitors Note : 11 : P < 11 compared with that of corresponding inhibitor group without bursin ; 21 NF2 1 mol L - 1 ; GF192X 2 mol L - 1 ; 42Cyano22Mthylisoquinoline 2 mol L - 1 ; genistein 1 mol L - 1 ; PD mol L - 1 ; heparin 1 U; L - 1 ; U mol L - 1 ; PKG inhibitor 1 mol L - 1. KN262 5 mol
4 76 26 ( P < 15) 21 PCR 1 2actin PCR, 1 2actin PCR, 1 6 pmol, 2actin 2 pmol, PCR , PCR, PCR 1, 1 2actin, 18 22, 2 1 PCR Fig11 Changing of PCR product with the PCR cycles 214 mrna 1 2actin 4, A Table Effect of the ratio of 1 and 2actin primers on 42Cyano22M2thylisoquinoline disentormetric ratio genistein 1 PD9859, mrna ( P > 15), 1 / G Gs Table 4 Influences of signal transduction inhibitors on the camp Ca 2 + c GMP expression of 1 mrna in hybridoma cells JAK Ras [ 7,8] Gs, Group G s, camp, camp ( PKA) PKA, CREB/ ATF,, PKA 42Cyano22 6 M2thylisoquinoline, % 42 Cyano22M2thylisoquinoline min, 2actin Ratio of 1 and 2actin primers actin actin mrna ( x S E, n = 6) 1 2actin c( bursin) / Disentormetric ratio of g ml - 1 Inhibitors 1 and 2actin Cyano22M2thylisoquinoline mol L Genistein 1 mol L PD mol L CK CK : P < 11, compared with the control without bursin. mrna, PKA, ; Src,,,,, [,, 9] Genistein [ 1],
5 4 : mrna 77, ERK JNK/ SAPK P8 ERK5/ BM K1 4 MAPK MAPK MAPK MAPKK MAPKKK,, [, 11] PD9859 [ 12] ERK1/ 2, MEK1/ 2, Raf MEK1/ 2 PD9859 SAPK/ JNK p8 MAPK PD9859, 8169 %, ERK NF2 GF192X heparin KN262 U27122 G Go/ Gi G C - Ca 2 + / calmodulin C G,, : [ 1],,,. [ J]., 22, 25( 4) : [ 2],,,. [ J]., 22, 4( 7) : 8 1. [ ],,,. [ J]., 21, 17( 4) : [ 4],,,. [ J]., 22, 2 : [ 5],,,. LCGF IBD [ J]., 21, 2( 1) : [ 6],,,. [ J]., 1999, ( 1) : 4 6. [ 7] Hunter T. Signaling22 and beyond [ J]. Cell, 2, 1( 1) : [ 8] Shi Y. Progress in the studies of intracellular signal transduction and transcription regulation [ J]. Foreign Medical Science : Molecular Biology, 1997, 19( 5) : [ 9]. [ J]., 1999, 26( 6) : [ 1] Akiyama T, Ishida J, Nakaya wa S, et al. Genistein, a specific inhibitor of tyrosine2specific protein kinase [ J]. J Biol Chem, 1987, 262 : [ 11],,. ( MAPK) [ J]., 22, 7( 5) : [ 12] Alessi D R, Cuenda A, Cohen P, et al. PD9859 is a specific inhibitor of activation of mitogen2activated protein kinase kinase in vitro and in vivo [ J]. J Biol Chem, 1995, 27 : :