SUPPLEMENTARY MATERIAL

Transcription

1 SUPPLEMENTARY MATERIAL Engineering a pyridoxal '-phosphate supply for cadaverine production by using Escherichia coli whole-cell biocatalysis Weichao Ma 1,,, Weijia Cao 1,, Bowen Zhang 1,, Kequan Chen 1,*, Quanzhen Liu 1,, Yan Li 1,, and Pingkai Ouyang 1, Supplementary Methods Construction of strains and plasmids Bacterial strains and plasmids are summarized in Table S1. All the PCR primers are listed in Table S. 11 The E. coli cada gene, encoding a lysine decarboxylase protein, were amplified from E. coli BL1 1 (DE) genomic DNA (GenBank: AM1.) using primers CadA-NdeI-Duet-F and 1 CadA-KpnI-Duet-R. The PCR product was introduced into the NdeI and KpnI sites of petduet-1 to 1 generate petduet-cada. 1 The operon comprising pdxs and pdxt was amplified from Bacillus subtilis NJ0 Genomic DNA 1 template with primers pair PdxST-NcoI-F and PdxST-SalI-R, the PCR fragment was digested with 1 NcoI and SalI, and ligated into ptrca, generating ptrca-pdxst. 1 To construct pet-cada-trcst, the Ptrc (trc promoter)- pdxst-rrnb cassette was amplified with 1 primers pair Trc-promoter-XbaI and Trc-termi-XbaI using ptrca-pdxst as the template. Then the 0 fragment was digested by XbaI, and ligated into petduet-cada linearized with AvrII. 1 The fragment containing the arabad promoter and arac gene was amplified with the primers 1

2 Para-Spe-Xba-F and Para-Nco-Bam-R using plasmid pkd as the template and was subsequently digested with NcoI and XbaI. The resulting fragment, together with the.-kb NotI-NcoI fragment of pet-cada-trcst containing the cassette of T promoter-cada and pdxst genes, were inserted into the NotI and AvrII sites of petduet-cada to yield pet-cada-badst. To construct pcwj-pdxst, the fragment containing pdxst coding sequence was digested by NcoI and SalI, and ligated into the same restriction sites of plasmid pcwj. The constructed plasmids ptrca-pdxst and pet-cada-trcst were separately transformed into E.coli Trans1-T1 (TransGen Biotech, Beijing, China) to create strains Trans-ST and Trans-AST, respectively. The plasmids petduet-cada, pet-cada-trcst and pet-cada-badst were separately transformed into E.coli BL1(DE) (TransGen Biotech, Beijing, China) to yield strains BL-CadA, 11 AST1 and AST, respectively. The plasmids petduet-cada and pcwj-pdxst were co-transformed 1 into E.coli BL1(DE) and defined as strain AST. 1 1 Determination of intracellular level of Pyridoxal '-phosphate 1 mg (dry cell weight) cell pellets of the h IPTG-induced E. coli cells were resuspended in 1. 1 ml phosphate buffered saline (PBS, ph., Sigma) containing 0 μg/ml lysozyme, µg/ml RNase 1 A, and µg/ml DNase I. After incubation on ice for 1 hour, bacteria were broken by sonication, and 1 0 µg of Proteinase K was added to each sample and incubated on ice for 0 minutes. Then proteins 1 were precipitated by adding chilled 0% Trichloracetic acid (TCA) at 1/ of the sample volume. The 0 samples were vortexed for 1 min and incubated 1 min on ice, and then were centrifuged for min at 1 1,000 g at C. The supernatant was cleared by 0. µm filtration. The separation, identification, and quantification of pyridoxal '-phosphate was conducted by

3 high-performance liquid chromatography (HPLC), following modifications of the procedure described by Cabo et al. and Kimura et al. 1,, using an Agilent (Santa Clara, CA, USA) 10 Infinity System equipped with a fluorescence detector (FLD G11B). The stationary phase was a reverse-phase column Prevail C1 (0 mm. mm μm) (Grace, Columbia, MD, USA). The mobile phase consisted of buffer A: 0.1 M potassium phosphate monobasic, 0.1 M sodium perchlorate and 0. g/l sodium bisulfite; buffer B: 0.1 M potassium phosphate monobasic, 0.1 M sodium perchlorate, 0. g/l sodium bisulfite and 0% acetonitrile. The ph of the buffers A and B were adjusted to.0 by adding phosphoric acid. The following gradient for the mobile phase was used: buffer A, 0%, from 0 to min and buffer B, %, from.1 to 1 min. An additional -min step was included to reach the initial conditions and achieve mobile phase stabilization. The flow rate was 1 ml/min, and the injection 11 volume was 0 μl. The temperature of the column was ± 1 C, and fluorescence was measured at an 1 excitation wavelength of 00 nm and an emission wavelength of 00 nm Cabo, R. et al. A simple high-performance liquid chromatography (HPLC) method for the 1 measurement of pyridoxal--phosphate and -pyridoxic acid in human plasma. Clinica chimica 1 acta; international journal of clinical chemistry, -1 (01). 1. Kimura, M., Kanehira, K. & Yokoi, K. Highly sensitive and simple liquid chromatographic 1 determination in plasma of B vitamers, especially pyridoxal `-phosphate. Journal of 0 Chromatography, -01 (1). 1

4 KDa CadA 1 PdxS PdxT PdxS PdxT Supplementary Figure S1. SDS-PAGE analysis of the expression of PdxS, PdxT and CadA. Lane 1, total protein in strain Trans-ST; Lane, total protein in strain Trans-AST; Lane, total protein in strain BL-CadA; Lane, total protein in strain AST1. The samples were collected after h of induction with IPTG.

5 Table S1. Strains and plasmids used in this work Strains or plasmids Description Source or Refs. Strains Bacillus subtilis NJ0 Wild-type Lab stock E.coli Trans1-T1 E.coli BL1(DE) F φ0(lacz)δm1 ΔlacX hsdr(r - K, m + K ) ΔrecA1 enda1 tona; E. coli host for gene cloning and for expression of proteins under the control of the trc promoter F ompt hsds(r - B, m - B ) gal dcm (DE); E. coli host for protein expression TransGen Biotech TransGen Biotech BL-CadA BL1(DE) harboring petduet-cada Ma et al. Trans-ST E.coli Trans1-T1 harboring ptrca-pdxst This work Trans-AST E.coli Trans1-T1 harboring pet-cada-trcst This work AST1 BL1(DE) harboring pet-cada-trcst This work AST BL1(DE) harboring pet-cada-badst This work AST BL1(DE) harboring petduet-cada and pcwj-pdxst This work Plasmids petduet-1 ColE1 ori, laci gene, Amp r, T promoters Novagen ptrca pmb1 ori, laci gene, Amp r, trc promoter Lab stock pcwj RSF ori, laci gene, Cm r, trc promoter Lab stock pkd psc1 ori, Amp r, λ Red recombinase under Lab stock petduet-cada ptrca-pdxst pet-cada-trcst pet-cada-badst arabinose-inducible arabad promoter ColE1 ori, laci gene, Amp r, T promoters, cada inserted between NdeI KpnI sites of petduet-1 pmb1 ori, laci gene, Amp r, trc promoter, Native pdxst operon of B. subtilis NJ0 inserted between the NcoI and SalI sites of ptrca ColE1 ori, laci gene, Amp r, Ptrc (trc promoter)- pdxst-rrnb cassette inserted into AvrII site of plasmid petduet-cada ColE1 ori, laci gene, Amp r, P BAD -controlled pdxst and P T -controlled cada Ma et al. This work This work This work pcwj-pdxst RSF ori, laci gene, Cm r, P trc -controlled pdxst This work

6 Table S. Primers used in this work (restriction sites are underlined) Primer CadA-NdeI-Duet-F CadA-KpnI-Duet-R PdxST-NcoI-F PdxST-SalI-R Trc-promoter-XbaI Trc-termi-XbaI Para-Spe-Xba-F Sequence GGAATTCCATATGAACGTTATTGCAATATTG GGGGTACCTTATTTTTTGCTTTCTTCTTTC CATGCCATGGCTCAAACAGGTACTGAACG ACGCGTCGACTTATACAAGTGCCTTTTGCTTATATTCCTCAACC CTAGTCTAGATTGACAATTAATCATCCGGCTCG CTAGTCTAGAATTTGTCCTACTCAGGAGAGCGTTC CCCACTAGTCTAGAATCGATTTATTATGACAACTTGACGGCTACA TCATTCAC Para-Nco-Bam-R CATAGGATCCATGGTTTATAACCTCCTTAGAGCTCGAATTCCC