somatic transition to was evident into airways in the

Transcription

1 Supplementary Fig. 1. A. Activation of an oncogenic K-Ras allele by recombination in somatic cells leads to spontaneous lung cancer in LA1 mice (ref. 20). In this mouse model, subpleural precancerous adenomas of the lung develop by two weeks of age. These adenomas transition to malignant adenocarcinomas, and multiple adenocarcinomas are evident in each lung by 150 days of age. We examined LA1 mouse lungs at three postnatal ages. At 120 days of age, most lesions consisted of atypical adenomatous hyperplasiaa with cells protruding on the lumen of the bronchus and cells extending outside the bronchus into distal alveoli such lesions weree previously designated as adenomas (Fig. 1A). By 170 days of age, larger adenomas became evident (Panel A), and some of these adenomas contained foci of adenocarcinomas (Panel B), which enlarged (Panels C and D). The number of lesions containing adenocarcinoma increased from 120 days of age to 170 days of age, and it increased even further at 220 days of age. At 170 and 220 days of age, invasion of adenocarcinoma into airways was evident in the tumors (Panel E). Boxed areas are shown at higher power in inserts. Bars are 50 mm.

2 Supplementary Fig. 2. Top row. Infiltrating adenocarcinoma (AC), KRAS mutated. A. Strong stromal (yellow arrows) and tumor (red arrows) positivity (A); lesss intense stromal positivity in lung parenchyma near the tumor (B); normal lung fibroblasts are negative (C). Middle row. Infiltrating AC, KRAS mutated. Strong immunostaining of fibroblasts in tumor stroma (yellow arrows) and in tumor (red arrows) (A, B); lower or negative immunostaining in stroma away from the tumor or in normal lung (C, D). Lower row, left. Infiltrating AC, KRAS mutated. Stromal fibroblast (yellow arrows) and tumor (red arrows) are negative for PTEN and ZEB2. Lower row, right. Infiltrating AC, KRAS, EGFR wild-type. Strong immunostaining of stromal fibroblasts in tumor stroma (yellow arrows) and in tumor (red arrows) ). Bars are 100 m.

3 Supplementary Fig. 3. H&E staining. Human lung adenocarcinoma with Ki-67, positive tumor cells (black arrows) ), positive stromal fibroblasts (red arrows), and inflammatory cells (yellow arrows). The bar is 50 m.

4 Supplementary Fig. 4. Uninvolved lung with bronchial mucosa, note Ki-67-negative negative fibroblasts (arrows). The bar is 50 m.

5 Supplementary Fig. 5. H&E staining. Uninvolved lung with vein, note Ki-67-negative negative fibroblasts (arrows). The bar is 50 m.

6 Supplementary Fig. 6. A. MEFs were serum starved overnight, and then retreated with 10% serum or 75 pm TGFb1 for 24 hrs as described (13). Real time PCR is shown. B. Cells were treated as in panel A, and cell number was counted at the indicated time points. C. 393P cells described in Fig. 4, were placed in serum-free conditions and conditioned media (CM) was collected after two days. MEFs were serum starved overnight and then retreated with 393P conditioned media as indicated for 24 hrs. Real time PCR is shown. D. Cells treated in panel C were counted at the indicated times. *** indicates p<0.01 by T-test. Experiments were repeated at least threee times.

7 Supplementary Table 1. Primers used for real-time PCR Primer name Sequence Tm C Mm Zeb1 LP 5'- TGGCAAGACAACGTGAAAGA 60 Mm Zeb1 RP 5'- AACTGGGAAAATGCATCTGG 60 Mm mtor LP 5'- ACTGAGGAGGGAGAACAGCA 57.9 Mm mtor RP 5'- TGGCTCCATCTGCTAGTGTG 56.8 Mm ACTB LP 5'- GGCTGTATTCCCCTCCATCG 57.6 Mm ACTB RP 5'- CCAGTTGGTAACAATGCCATGT 55.9 Mm GAPDH LP 5'- AGGTCGGTGTGAACGGATTTG 57.6 Mm GAPDH RP 5'- TGTAGACCATGTAGTTGAGGTCA 55.1 Amplicon (bp) Supplementary Table 2. Primers used for ChIP assay PCR Primer name Sequence (5' - 3') Tm C mtor PRMT LP 5'- ggatgttcctccccatcttc 55 mtor PRMT RP 5'- actccaggccccagactc 59.2 Amplicon (bp) 197 Supplemental Table 3 Primary antibodies used Name IgG Specificity Manufacturer Dilution pakt-473 Rabbit polyclonal m, rat, h Cell Signaling 1:20 Cdh1 mouse polyclonal m, rat, h BD BioSciences 1:50 Zeb1 Rabbit polyclonal m, rat, h from Dr. Douglas Darling 1:400 Anti-pAkt ser473 Rabbit monoclonal m, rat, h cell signaling 1;200 Pten (N-19) goat polyclonal m, rat, h Santa Cruz 1:50 ZEB2 (L-20) goat polyclonal m, rat, h Santa Cruz 1:50