Lecture 12. Genomics. Mapping. Definition Species sequencing ESTs. Why? Types of mapping Markers p & Types

Transcription

1 Lecture 12 Reading Lecture 12: p , Lecture 13: p Genomics Definition Species sequencing ESTs Mapping Why? Types of mapping Markers p & Types 222

2 omics Interpreting the structure, function and sequence of biological molecules 223 Genomics is the global study of the entire genome of a species or multiple species Includes sequencing, mapping, gene expression, gene discovery Proteomics Global study and discovery of proteins Metabolomics Global study of small MW metabolites inside a cell

3 Genome Sequencing Species Completed > 60 bacteria Yeast S. cerevisiae C. elegans Arabidopsis Drosphilia Chimpanzee Mosquito Opossum Malaria Dog Human Cat Mouse Chicken Rat Horse Puffer fish Bee Sea urchin Draft Sequences Rhesus Macaque Cow Pig Rabbit Zebrafish Platypus 224

4 Functional Genomics The study of global gene expression Expression in a whole organism, organ or tissue Studying the functions of unknown genes Bioinformatics Produce Expressed Sequence Tags (ESTs) cdna library of ALL cdnas in a cell or tissue ,000 unique cdna clones from a tissue Each represents a gene expressed by the tissue Sequence and use information to design probes, microarrays etc 225

5 Gene Mapping Determining where and in what order genes are on chromosomes Why map genes? Research tool to study biological processes Comparative mapping to find genes 226

6 Comparative Genetics Genomic organization at the sub-chromosomal level is often conserved across a wide range of taxonomic boundaries (species) Can infer the location of an unknown gene in one species if it has been mapped in another Can ask evolutionary questions Relationships by degree of similarity Can study functional relationships between genes and genome organization 227

7 Two Forms of Genomic Maps Genetic Maps (Linkage Maps) Gives gene order on a DNA strand Physical Maps Assign specific pieces of DNA to a certain chromosome Various types (more later) Sequencing is the ultimate genomic map 228

8 Linkage Maps Used to predict the relative order of genes along a DNA strand Yields marker order and linkage group No information on physical distance apart and chromosome assignment Statistical analysis of gene inheritance patterns Follow alleles (variants of the same gene) from generation to generation 229

9 Linkage Maps Based on scoring meiotic recombination Recombination frequencies (distance apart) Simple Mendelian inheritance One intact homologue from each parent Low frequency of DNA recombination occurs between homologous chromosomes during meiosis Maternal and paternal genomes intermixed on same chromosome Used as a statistical calculation tool for geneticists 230

10 Constructing a Linkage Map Done by comparing the segregation of 2 genes on the same chromosome See how often they segregate together Can tell how close they are The closer the genes are together, the less recombination that occurs Genes infrequently separated from each other by meiotic recombination Tightly linked If not linked, they don t segregate together 231

11 Constructing a Linkage Map Observed frequency of recombination used to construct linkage map Frequency of recombination proportional to distance between genes Unit of the genetic map is the centimorgan (cm) 1 cm is equivalent to 1% recombination frequency 232

12 Information Gained from Linkage Maps First approximation of how genes are ordered No physical distance apart Recombination frequency not constant Varies between the sexes, chromosomes and along a pair of chromosomes Many phenotypic traits are multigenic 233

13 Information needed to Build Linkage Maps Need to know trait is genetic Breed and look at segregation Recombination-based map Need pedigreed families segregating the trait you want to map Need polymorphic markers to score Something to follow through the generations Something associated with the phenotype you are following Need to be able to identify individual alleles 234

14 Markers Used to trace a trait through populations and generations Markers come in a variety of forms Differences in phenotype Differences in protein structure/function Differences in DNA sequence If you can follow any of these 3 types of markers, you can make a linkage map 235

15 DNA Markers DNA sequences that vary between related genomes DNA polymorphism Examples: RFLP AFLP STR (microsatellites) SNPs RADP 236

16 DNA Markers - RFLPs Restriction Fragment Length Polymorphisms The presence or absence of a restriction enzyme site is used to distinguish between alleles 237

17 DNA Markers - AFLP Amplified Fragment Length Polymorphisms Like RFLP but use PCR rather than Southern blotting Digest PCR product Don t need sequence data 238

18 DNA Markers - STR Short Tandem Repeats Microsatellites (SSRs or SSLPs) PCR-based marker Use of primers in unique sequence that flanks short tandem repeats 2, 3 or 4 bp repeats CA (n) or TAG (n) Need >10 repeats to be considered a marker 239

19 Microsatellites 1 ATCCTACGACGACGACGATTGATGCT 2 ATCCTACGACGACGACGACGACGATTGATGCT

20 DNA Markers - Microsatellites Advantages Highly polymorphic Good for linkage mapping Very common Occur at high frequency 10,000 copies/genome Broadly scattered throughout genome Disadvantages Don t translate will across species 241

21 DNA Markers - SNPs and RAPD Single Nucleotide Polymorphisms 1 ATCGATTGCCATGAC 2 ATCGATGGCCATGAC Very frequent Not very polymorphic Useful for fine mapping, short range scans Random Amplified Polymorphic DNA Small fragments generated with random primers Hard to score Clone and sequence to make specific primers 242