Bioresource Technology

Transcription

1 Bioresource Technology 12 (211) Contents lists available at ScienceDirect Bioresource Technology journal homepage: Examination of microbial fuel cell start-up times with domestic wastewater and additional amendments Guangli Liu a, Matthew D. Yates b, Shaoan Cheng b,c, Douglas F. Call b, Dan Sun d, Bruce E. Logan b, a School of Environmental Science & Engineering, Sun Yat-sen University, Guangzhou 51275, PR China b Department of Civil & Environmental Engineering, Penn State University, 231Q Sackett Building, University Park, PA 1682, USA c State Key Laboratory of Clean Energy Utilization, Department of Energy Engineering, Zhejiang University, Hangzhou 327, PR China d State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology (SKLUWRE, HIT), Harbin 159, PR China article info abstract Article history: Received 19 February 211 Received in revised form 21 April 211 Accepted 27 April 211 Available online 3 April 211 Keywords: Microbial fuel cell Domestic wastewater Startup time Substrate Rapid startup of microbial fuel cells (MFCs) and other bioreactors is desirable when treating wastewaters. The startup time with unamended wastewater (118 h) was similar to that obtained by adding acetate or fumarate ( h), and less than that with glucose (181 h) or Fe(III) (353 h). Initial current production took longer when phosphate buffer was added, with startup times increasing with concentration from 149 h (25 mm) to 251 h (5 mm) and 526 h ( mm). Microbial communities that developed in the reactors contained Betaproteobacteria, Acetoanaerobium noterae, and Chlorobium sp. Anode biomass densities ranged from 2 to 6 lg/cm 2 for all amendments except Fe(I) (165 lg/cm 2 ). Wastewater produced 91 mw/m 2, with the other MFCs producing 5 mw/m 2 (fumarate) to 13 mw/m 2 (Fe(III)) when amendments were removed. These experiments show that wastewater alone is sufficient to acclimate the reactor without the need for additional chemical amendments. Ó 211 Elsevier Ltd. All rights reserved. 1. Introduction Microbial fuel cell (MFCs) are a promising approach for treating wastewater, as electricity is produced directly from the process of organics biodegradation (Logan, 29; Logan, 21). Many kinds of wastewaters have been tested in recent years, including synthetic, domestic and industrial wastewaters (He et al., 25; Huang and Logan, 28; Ahn and Logan, 29). A number of factors should be addressed before MFC technologies can be applied at larger scales. Previous research has focused on anode and cathode materials, separators, and designs for scaling-up reactors. However, rapid start-up of any biological process used for wastewater treatment is desirable to avoid discharge of untreated wastewater. Reported startup times for MFCs vary depending on the substrates examined and the reactor architecture, ranging from 1s of hours to several months (Feng et al., 28; Liu et al., 28). For example, more than 5 h was needed to obtain maximum voltages in two-chamber, air-cathode MFCs inoculated with anaerobic sludge (Kim et al., 25). Liu and Logan (24) demonstrated that the single-chamber, air-cathode MFC could produce a consistent maximum voltage after 14 h (.32 V, 4 cycles) when inoculated with the effluent of a primary sedimentation tank, but a stacked MFC using a ferricyanide catholyte required 13 days following Corresponding author. Tel.: ; fax: address: blogan@psu.edu (B.E. Logan). inoculation with a mixture of anaerobic and aerobic sludge (Aelterman et al., 26). A cassette-electrode MFC with air-cathodes took 15 days before stable performance was achieved with a synthetic wastewater (Shimoyama et al., 28). One of the most efficient methods for starting up a new MFC is to use the effluent from an existing reactor treating the same type of substrate (Jung and Regan, 27; Chae et al., 29; Kim et al., 27). However, a large volume of pre-acclimated exoelectrogens may not be available for starting-up larger scale reactors. For example, a L pilot-scale microbial electrolysis cell (MEC) had to be inoculated with domestic wastewater to treat winery wastewater, and it required 6 days for start up (Cusick et al., 211). Thus, more information is needed on how to start up larger reactors in the absence of a pre-acclimated inoculum. In the case of domestic wastewater treatment, it is not known if startup can be accelerated or subsequent performance can be improved through creating different conditions in the wastewater during the start up phase of operation. Several approaches can be used to improve startup. First, additional substrates can be added since the wastewater strength is typically lower than that used in laboratory systems (1 g/l chemical oxygen demand, COD). Second, the addition of specific alternate electron acceptors can be used to encourage the growth of known exoelectrogenic bacteria such as various Geobacter or Shewanella species. Fumarate or Fe(III) is often used to culture Geobacter sulfurreducens prior to inoculation into an MFC (Wang et al., 21; Torres et al., 29), although fumarate can also be used /$ - see front matter Ó 211 Elsevier Ltd. All rights reserved. doi:1.116/j.biortech

2 732 G. Liu et al. / Bioresource Technology 12 (211) as a substrate by bacteria. Third, the conductivity of domestic wastewater is low (1 ms/cm) compared to some buffered laboratory solutions (7 ms/cm for 5 mm phosphate buffer). A low conductivity can limit current densities, and thus it may allow other non-exoelectrogenic bacteria to colonize the electrodes and inhibit growth of exoelectrogenic bacteria. Others have suggested electrochemical control of the system, such as setting the anode potential, might also work as a method to improve startup (Wang et al., 29b). In this study, the effects of different additives (electron donors, acceptors, and varied ionic strength buffers) to domestic wastewater were examined to try to improve startup times and power production. While the addition of substrates and buffers have been examined for power generation from specific chemicals (i.e. glucose and acetate), the use of additives to improve the long term operation of an MFC treating a domestic wastewater has not previously been examined. In addition to examining startup time and power, the microbial communities that developed in these reactors after relatively long-term operation was characterized. 2. Methods 2.1. Wastewater source Domestic wastewater (primary clarifier effluent) was obtained from the Pennsylvania State University Wastewater Treatment Plant and used without any pretreatment as a control. Split wastewater samples were then amended with sodium acetate, sodium fumarate, Fe(III) or phosphate buffer (PB) at different concentrations shown in Table 1. Phosphate buffer and Fe(I) oxide (ferrihydrite) was prepared as previously reported (Wang et al., 21; Zuo et al., 28) MFC construction and operation Single-chamber MFCs were constructed from media bottles (32 ml capacity, Corning Inc., NY) and a cathode electrode placed at the end of a side port (3.8 cm in diameter, projected cathode surface area of 4.9 cm 2 ) and coated on the water facing side with a Pt catalyst.5 mg/cm 2 ; 1% Pt) as previously described (Logan et al., 27). Anode electrodes (1.5 cm 9 cm, 27 cm 2 ) were made of heat-treated carbon cloth (type A, BASF Fuel Cell, Inc., USA) (Wang et al., 29a). All reactors were covered with aluminum foil to exclude light. MFC operation was divided into two stages: (1) startup with different amendments to the wastewater (525 h); and (2) subsequent operation with only wastewater (675 h). All experiments were carried out in duplicate at room temperature (23 ± 1 C) Electrochemical measurements and calculations The voltages (V) across a O external resistance were recorded using a multimeter with a data acquisition system Model 27 (Keithley Instruments, Cleveland, OH, USA). Power density curves were measured and normalized by the projected cathode surface area as previously described (Cheng and Logan, 27) Anode characterization Table 1 Characteristics of the media used at the start-up stage. Medium ph Conductivity (ms/cm) A 1.5 cm 2 cm piece of the anode was cut off during start-up and analyzed for the bacterial community and biomass concentration. Anode biomass (1.5 cm 1 cm) was measured in terms of protein concentration by the bicinchoninic acid method (Sigma Chemical Co., USA) (Ishii et al., 28; Zhang et al., 29). Genomic DNA was extracted from the samples with a PowerSoil DNA Isolation Kit (MO BIO Laboratories, Inc., Carlsbad, CA, USA) according to the manufacturer s instructions. PCR amplification of the 16S rrna gene was performed using a pair of universal primers: 968F 5 -AACGCGAAGAACCTTAC-3 (Escherichia coli 16S rrna positions ) to which a GC clamp was attached (CGCCCGCC GCGCCCCGCGCCCGTCCCGCCGCCCCCGCCCG) at the 5 -terminus, and 141R, 5 -CGGTGTGTACAAGACCC-3 (E. coli 16S rrna gene positions ) as previously described (Xing et al., 21). PCR reaction volumes of 21-lL were used and contained 9 ll of 2 GoTaq Ò Green Master Mix (Promega, Madison, WI, USA),.5 lm of each primer, 2 ng (1 2 ng/ll) DNA template and sterilized distilled water to the final volume. The samples were amplified in an icycler iq (Bio-Rad Laboratories, Hercules, CA, USA) as following: initial denaturation of DNA for 5 min at 94 C, 3 cycles of 1 min at 94 C, 3 s at 57 C (decreasing.1 C per cycle to 54 C), 1 min at 72 C, and then a final extension for 7 min at 72 C. Denaturing gradient gel electrophoresis (DGGE) was conducted by using the DCODE Universal Mutation Detection System (Bio-Rad Laboratories). PCR products (15 ll per lane) were loaded onto 7% (wt/vol) polyacrylamide (37.5:1 acrylamide/bisacrylamide) gels in a 1 TAE buffer with a denaturing gradient ranging from 3% to 6%. DGGE was run in.5 TAE (Tris acetate EDTA) buffer at 7 V for 12 h (6 C). Gels were silver stained and then prominent DGGE bands were excised with a razor blade for sequencing. The bands were transferred to 5 ll TE buffer (1 mm Tris HCl, 1 mm EDTA [ph 8.]) and equilibrated overnight at 4 C. Then 1 ll of buffer containing DNA was taken as a template to run the PCR amplification again as described above, except that the forward primer lacked the GC clamp. PCR products were examined by electrophoresis on a 1% (wt/vol) agarose gel with a blank control. PCR products were purified using a QIAquick PCR Purification Kit (Valencia, USA). Ligation, transformation, and plasmid purification were carried out using a TOPO TA cloning kit (Invitrogen, USA). The chemically competent One Shot E. coli cells TOP 1 F was used as previously described (Kim et al., 27). Plasmids were isolated with the EZ 96 Fastfilter Plasmid Kit (Omega-Biotek, USA) from 4 randomly selected clone colonies for each band and then sequenced by the nucleic acid facility at the Pennsylvania State University. The nucleotide sequences obtained in this study were deposited in the GenBank database under accession numbers JF JF Principal component analysis (PCA) was used to evaluate changes in the bacterial community between time points using Minitab 16. DGGE gels were scored based on the presence or absence of bands and their distance in the gels. 3. Results and discussion 3.1. Start-up with different substrates COD (mg/l) Domestic wastewater () 7.54 ± ± ± mm PBS 7.21 ± ± ± mm PBS 7.2 ± ±.3 48 ± 5 + mm PBS 7.17 ± ± ± mg/l acetate 7.52 ± ± ± mg/l fumarate 7.56 ± ± ± mg/l glucose 7.53 ± ±.3 85 ± mm Fe(I) solution 7.28 ± ±.3 18 ± 5 Different times were needed to reach >2 mv during startup, defined here as the startup time (Fig. 1). The shortest time was

3 G. Liu et al. / Bioresource Technology 12 (211) h using + acetate and the longest was 353 h using + Fe(I). The addition of glucose delayed startup to 181 h compared to 118 h with only. This result was consistent with previous reports that acetate and glucose had distinctly different times needed for current generation (Lee et al., 28), with 5 days for acetate and 8 days with glucose. All reactors produced electricity after the first cycle (Fig. 2A), with the cell maximum voltages obtained with a fixed resistance of X during start up decreasing in the order: + acteate > + fumarate > > + glucose > + Fe(I). After two cycles (27 h), all the maximum cell voltages exceeded 2 mv, with the highest one (261 mv) due to acetate addition ( + 4 mg/l acetate). These results are consistent with those reported by others that acetate fed MFCs produce higher voltages than those fed glucose (Jung and Regan, 27). It is well known that G. sulfurreducens is important for high power densities in MFCs, and that it grows through reduction of Fe(I) and fumarate (Ishii et al., 28; Kiely et al., 211). It was found here that wastewater amended with Fe(I) initially (first cycle) produced a much lower voltage (159 mv) than fumarate (33 mv). Lower voltages could be due to growth of G. sulfurreducens in solution using Fe(III) rather than on the anode, or to flocculation due to Fe(I) amendments as the COD decreased to less than 2 mg/l (see Table 1). Higher power densities with fumarate than Fe(III) may have been due to fumarate serving as an additional electron donor for anodic bacteria. When reactors were switched to a feed of only, the maximum voltages remained in the range of mv for cycle 3, and decreased to mv in cycle 4. The lowest maximum voltages were produced in the reactors started up with and fumarate (176 mv) Start-up with different PBS buffers The addition of PBS (25, 5 or mm) was detrimental to MFC startup times but in some cases increased power (Fig. 1). The startup times were 149 h for 25 mm PBS and 251 h for 5 mm PBS, and the reactor with mm PBS failed to start up. The maximum voltages obtained with a fixed resistance of X, and with PBS added (cycle 2) decreased in the order: + 5 mm PBS (46 mv) > + 25 mm PBS (366 mv) > (231 mv) + mm PBS (8 mv) (Fig. 2B). When the PBS addition was discontinued and the reactors were fed only wastewater, the reactors originally amended with mm PBS produced nearly as much power as the other MFCs (cycle 3 and cycle 4). The lower PBS concentrations likely increased power when they were added by increasing the conductivity of the wastewater. However, too large an increase in salinity (from 1 ms/cm for to 12.8 ms/cm for 4 A Maximal voltage (mv) B Maximal voltage (mv) acetate + fumarate + glucose + Fe ( III) Cycle1 Cycle2 Cycle3 Cycle4 Cycle number + 25 mm PBS + 5 mm PBS + mm PBS Cycle1 Cycle2 Cycle3 Cycle4 Cycle number Fig. 2. Start-up and operation of MFC using (A) different substrates, and (B) different PBS concentrations. (1) Startup stage: cycle 1 ( 27 h) and cycle 2 ( h); (2) operation stage with unamended : cycle 3 ( h) and cycle 4 ( h). mm PBS) may have adversely affected bacteria and resulted in poor performance. It is well known that mm PBS buffer produces higher cell voltages than lower PBS concentrations (Logan et al., 27; Min et al., 28; Nam et al., 21). However, relatively few studies have examined MFC startup times with. Here, the MFCs fed with mm PBS failed to perform well, producing <2 mv even after 526 h. Feng et al. (28) showed that the addition of 2 mm PBS (14.6 ms/cm) increased the performance of an MFC when it was added after startup of the reactor with brewery wastewater. This suggests that it might be necessary to first acclimate a reactor for power generation, and then to add PBS. However, it is clear that PBS addition during the startup phase is not beneficial for reducing startup times using domestic wastewater. Startup time (h) acetate + fumarate + glucose Medium + Fe(III) + 25 mm PBS + 5 mm PBS Fig. 1. Amount of time for MFCs to reach a maximum voltage of 2 mv or more during startup (with indicated amendments) Power production after startup When amendments were discontinued and the reactors were fed unamended wastewater from 526 h (cycle 3) to 12 h (cycle 4), the maximum voltages produced were all similar (2 215 mv) (Fig. 2). This suggests that the anode biofilm had the same capacity for current generation at a high resistance regardless of the startup strategies. Polarization data obtained after the startup period with unamended wastewater (at 15 h during cycle 4) showed that different maximum power densities could be produced as a result of the different electron donor and acceptor amendments (Fig. 3A), but not with the PBS amendments (Fig. 3B). The MFC originally fed Fe(III) produced the highest maximum power density of P max = 13 ± 2 mw/m 2, with the lowest power of P max =

4 734 G. Liu et al. / Bioresource Technology 12 (211) ± 2 mw/m 2 produced for the MFC originally amended with fumarate. The MFC that was always fed only produced a maximum power of P max = 91 ± 22 mw/m 2 that is not statistically different to that produced with the MFC originally amended with Fe(III). However, the reactors amended with Fe(III) showed much less variation in power production than those consistently fed (as shown by the size of the error bars in Fig. 3). The reactors originally amended with PBS all produced maximum power densities of mw/m 2 once they were run on only, even the reactor that had a poor start up with mm PBS. These maximum power densities are within a reasonable range based on the specific and MFC architecture used here. Liu et al. (28) achieved a higher P max = 148 mw/m 2 with wastewater from this treatment plant by using a more optimized reactor configuration due to a higher cathode surface area per volume of reactor. With the same single-chamber bottle reactors P max = 3 mw/ m 2 was obtained by using 1 g/l of acetate and 5 mm PBS with a pre-acclimated MFC inoculum (Logan et al., 27). Using the same single-chamber bottle reactor inoculated from anaerobic sludge, P max = 197 mw/m 2 was obtained with 1 g/l of acetate and 5 mm PBS solution after 2 weeks, but this declined to 135 mw/ m 2 after 3 weeks (Ren et al., 211). It appears that among the electron donor and acceptor amendments examined here only Fe(III) showed any promise of affecting subsequent power generation. The MFC originally fed Fe(III) produced more consistent maximum power densities than the fed reactor, and the other amendments resulted in lower power production when switched to an unamended. A Power Density (mw/m 2 ) Fe(III) +glucose +acetate +fumarate 3.4. Biomass measurement The biomass density on the anode after cycle 1 ranged from 6 to lg/cm 2 based on protein measurements (Fig. 4). Biomass densities using + PBS (83 lg/cm 2 ) or + Fe(I) (6 lg/ cm 2 ) are comparable to the report by Yi et al. (29) using 1 mm acetate and G. sulfurreducens strain (27 57 lg/cm 2 ) after h, but this was much lower than 1245 lg/cm 2 reported by Zhang et al. (29) after 5 h with 1 g/l acetate and 5 mm PBS. After being fed wastewater for 674 h, the biomass densities increased to 2 6 lg/cm 2, with the exception of 165 lg/cm 2 obtained from the MFC originally fed + Fe(I). The addition of Fe may have resulted in deposition of iron on the anode, which could have enhanced the growth of iron-reducing bacteria (Kim et al., 25). Although 165 lg/cm 2 of the biofilm density was 2.5 times higher than that using different medium, the P max = 13 ± 2 mw/ m 2 with originally amended with Fe(I) during startup was only 1% higher than that obtained with during the whole time with (P max = 91 ± 22 mw/m 2 ) Microbial community analyses in MFCs Based on DGGE results (Supplementary material, Fig. S1) several of the most prominent bands were excised and sequenced (Table 2). Band 2 was identified as most similar to Acetoanaerobium noterae and was common to all reactors, regardless of the influent substrate or the time point sampled. A band most similar to Acidovorax sp. was found to be present in all reactors except for the + 5 and mm PBS. One band, with a 9% similarity to a Legionella sp. (Band 1), was found to be unique to the + Fe(III) amended reactor. Betaproteobacteria, A. noterae, and Chlorobium sp. were identified by DGGE analysis of several of the other darker bands after being fed only. There was an apparent shift in the anode communities of all reactors, regardless of the initial amendment to the system, after being fed only. This is seen from the clustering of the samples during the amendment period in a different quadrant than the samples fed only wastewater in a PCA plot (Fig. 5). Thus, the sampling time was more important to the structure of the community than the specific amendment Implications for MFC startup B Power Density (mw/m 2 ) Current density (A/m 2 ) +25mM PBS +5mM PBS +mm PBS High current densities from different biodegradable substrates are dependent on the rapid and successful colonization of the anode by electrochemically active bacteria. The results here demonstrated that adding additional electron donors and acceptors did Current density (A/m 2 ) Fig. 3. Polarization and power density curves after 15 h operation with wastewater by using (A) different substrates and (B) different PBS concentrations during startup ( 526 h). Fig. 4. Biomass measurement with different substrates during different cycles. Cycle 1 ( 27 h) and cycle 2 ( h) during startup ( 526 h); cycle 4 ( h) at the operation stage with.

5 G. Liu et al. / Bioresource Technology 12 (211) Table 2 Phylogenetic identification of predominant 16S rrna gene fragments from DGGE bands. Band GenBank closet match (accession number) Identity (%) 1 Legionella sp. HB911 (GU ) 9 2 Acetoanaerobium noterae strain ATCC (GU ) 3 Acidovorax sp. smarlab (AY ) 98 4 Beta proteobacterium pach94 (AY ) 98 5 Acetoanaerobium noterae strain ATCC (GU ) 6 Chlorobium sp. enrichment culture clone 5z-5 (FJ ) 98 not modify the microbial communities as significantly as the run time, based on DGGE band patterns analyzed using PCA (Fig. 5). The amount of power produced was increased by some of these amendments while amendments were added to the. However, when these amendments were removed, and the MFCs were operated using only, there was either comparable or reduced performance depending on the amendment. Wastewater amendments also did not decrease startup times, and in some cases they appeared to delay startup. Additional organics such as acetate, glucose, or fumarate that were added here, should either result in faster growth rates of bacteria or serve as a reserve substrate for bacteria. Addition of a fermentable substrate like glucose could result in increased growth of bacteria on the anode, or in suspension, without current generation. For example, Freguia et al. (27) showed that bacteria store substrates and then consume them later during periods of starvation based on data showing power generation in the absence of these substrates in solution. Exoelectrogenic bacteria therefore may compete for substrates with microorganisms that can colonize the anode even if they are not producing current. Considering that electricity generation is dominated by the biofilm close to the anode, and that electron transport from bacteria to the anode is one of the rate-limiting steps for power production (Ishii et al., 28; Read et al., 21), it may be more important that bacteria attach on the anode than just consume substrate. Therefore, it is reasonable that additional organics do not directly assist in the startup period. It was found that the addition of PBS did not improve startup, despite the well reported observation that PBS can increase power generation in MFCs due mostly to an increase in solution conductivity. It appears here that the increase in phosphate concentration was inhibitory to some exoelectrogenic bacteria, and that at high concentrations the phosphate buffer was very detrimental to reactor startup and subsequent operation. Geobacter strains are well known exoelectrogenic bacteria and are often found in anode biofilms reported by others (Logan, 29; Kiely et al., 211). However, it was not found that they dominated in these reactors based on the predominant bands that were sequenced from the DGGE gels. A similar result was found for an MFC fed a chocolate industry wastewater (Patil et al., 29). Thus, the use of a complex source of organic matter such as domestic wastewater may not produce many Geobacter in the biofilm relative to other bacteria important for the degradation of the. The startup time obtained here of 11 h with only domestic is a reasonable and relatively short time for producing power. Thus, amendments may not be needed for domestic wastewater for starting up laboratory-scale reactors. However, it is not known if similar startup times could be achieved for larger scale reactors using domestic wastewater. In one test with a L MEC, a very long startup time was needed (9 days) in the field relative to those required for smaller reactors in the laboratory (5 days) (Cusick et al., 211). At the present time, it appears that use of only during startup can produce the best longer term operation compared to adding amendments. In particular, phosphate buffer amendments should be avoided when starting up MFCs using domestic wastewater. The effect of phosphate on the startup of reactors with other substrates and wastewater should be further investigated. The lack of a need for amendments in practice would actually be desirable as it could help improve the economics for MFC startup. 4. Conclusions The results demonstrated that the startup period of the singlechamber MFC could not be greatly decreased by inoculation amended with acetate, fumarate, glucose or Fe(I). The startup period was delayed with addition of a PBS buffer, and reactors amended with mm PBS buffer were unable to produce reasonable voltages (after 526 h). Therefore, MFC startup cannot be accelerated by the addition of these different electron donors, acceptors or buffer. Thus, attempts to improve the MFC electricity generation by adding chemicals to the solution needs to be carefully evaluated in the laboratory before being put into practice. Acknowledgements The authors would like to thank Ms. Henjing Yan and Mr. Sokhee Jung for assisting the DGGE analysis. This research was supported by Award KUS-I from the King Abdullah University of Science and Technology (KAUST) and a scholarship from the China Scholarship Council (CSC, No. 27A4911). Fig. 5. PCA analysis showing the community shift between reactors fed amended wastewater (AA AH) and un-amended wastewater (WA WH). The second letter in the designation corresponds to the following: A = ; B = + 25 mm PBS; C = + 5 mm PBS; D = + mm PBS; E = + 4 mg/l acetate; F = + 6 mg/l fumarate; G = + 35 mg/l glucose; H = + Fe(I). Appendix A. Supplementary material Supplementary data associated with this article can be found, in the online version, at doi:1.116/j.biortech

6 736 G. Liu et al. / Bioresource Technology 12 (211) References Aelterman, P., Rabaey, K., Pham, H., Boon N, T., Verstraete, W., 26. Continuous electricity generation at high voltages and currents using stacked microbial fuel cells. Environ. Sci. Technol. 4, Ahn, Y., Logan, B.E., 29. Domestic wastewater treatment using microbial fuel cells and electrical energy production. Bioresour. Technol. 11, Chae, K.J., Choi, M.J., Lee, J.W., Kim, K.Y., Kim, I.S., 29. Effect of different substrates on the performance, bacterial diversity, and bacterial viability in microbial fuel cells. Bioresour. Technol., Cheng, S., Logan, B.E., 27. Ammonia treatment of carbon cloth anodes to enhance power generation of microbial fuel cells. Electrochem. Commun. 9, Cusick, R.D., Bryan, B., Parker, D.S., Merrill, M.D., Mehanna, M., Kiely, P.D., Liu, G., Logan, B.E., 211. Performance of a pilot-scale continuous flow microbial electrolysis cell fed winery wastewater. Appl. Microbiol. Biotechnol. 86, Feng, Y., Wang, X., Logan, B.E., Lee, H., 28. Brewery wastewater treatment using air-cathode microbial fuel cells. Appl. Microbiol. Biotechnol. 78, Freguia, S., Rabaey, K., Yuan, Z.G., Keller, J., 27. Electron and carbon balances in microbial fuel cells reveal temporary bacterial storage behavior during electricity generation. Environ. Sci. Techn. 41, He, Z., Minteer, S.D., Angenent, L.T., 25. Electricity generation from artificial wastewater Using an upflow microbial fuel cell. Environ. Sci. Technol. 39, Huang, L., Logan, B.E., 28. Electricity generation and treatment of paper recycling wastewater using a microbial fuel cell. Appl. Microbiol. Biotechnol. 8, Ishii, S., Watanabe, K., Yabuki, S., Logan, B.E., Sekiguchi, Y., 28. Comparison of electrode reduction qctivities of Geobacter sulfurreducens and an enriched consortium in an air-cathode microbial fuel cell. Appl. Environ. Microbiol. 74, Jung, S., Regan, J.M., 27. Comparison of anode bacterial communities and performance in microbial fuel cells with different electron donors. Appl. Microbiol. Biotechnol. 77, Kiely, P.D., Rader, G., Regan, J.M., Logan, B.E., 211. Long-term cathode performance and the microbial communities that develop in microbial fuel cells fed different fermentation endproducts. Bioresour. Technol. 12, Kim, J.R., Min, B., Logan, B.E., 25. Evaluation of procedures to acclimate a microbial fuel cell for electricity production. Appl. Microbiol. Biotechnol. 68, Kim, J.R., Jung, S.H., Regan, J.M., Logan, B.E., 27. Electricity generation and microbial community analysis of alcohol powered microbial fuel cells. Bioresour. Technol. 98, Lee, H.S., Parameswaran, P., Kato-Marcus, A., Torres, C., Rittmann, B.E., 28. Evaluation of energy-conversion efficiencies in microbial fuel cells (MFCs) utilizing fermentable and non-fermentable substrates. Water Res. 42, Liu, H., Logan, B.E., 24. Electricity generation using an air-cathode single chamber microbial fuel cell in the presence and absence of a proton exchange membrane. Environ. Sci. Technol. 38, Liu, H., Cheng, S., Huang, L., Logan, B.E., 28. Scale-up of membrane-free singlechamber microbial fuel cells. J. Power Sources 179, Logan, B.E., 29. Exoelectrogenic bacteria that power microbial fuel cells. Nature Rev. Microbiol. 7, Logan, B.E., 21. Scaling up microbial fuel cells and other bioelectrochemical systems. Appl. Microbiol. Biotechnol. 85, Logan, B.E., Cheng, S., Watson, V., Estadt, G., 27. Graphite fiber brush anodes for increased power production in air-cathode microbial fuel cells. Environ. Sci. Technol. 41, Min, B., RománÓ, B., Angelidaki, I., 28. Importance of temperature and anodic medium composition on microbial fuel cell (MFC) performance. Biotechnol. Lett. 3, Nam, J.Y., Kim, H.W., Lim, K.H., Shin, H.S., Logan, B.E., 21. Variation of power generation at different buffer types and conductivities in single chamber microbial fuel cells. Biosen. Bioelec. 25, Patil, S.A., Surakasi, V.P., Koul, S., Ljmulwar, S., Vivek, A., Shouche, Y.S., Kapadnis, B.P., 29. Electricity generation using chocolate industry wastewater and its treatment in activated sludge based microbial fuel cell and analysis of developed microbial community in the anode chamber. Bioresour. Technol., Read, S.T., Dutta, P., Bond, P.L., Keller, J., Rabaey, K., 21. Initial development and structure of biofilms on microbial fuel cell anodes. BMC Microbiol. 1, Ren, Z.Y., Ramasamy, R.P., Cloud-Owen, S.R., Yan, H., Mench, M.M., Regan, J.M., 211. Time-course correlation of biofilm properties and electrochemical performance in single-chamber microbial fuel cells. Bioresour. Technol. 12, Shimoyama, T., Komukai, S., Yamazawa, A., Ueno, Y., Logan, B.E., Watanabe, K., 28. Electricity generation from model organic wastewater in a cassette-electrode microbial fuel cell. Appl. Microbiol. Biotechnol. 8, Torres, C.I., Krajmalnik-Brown, R., Parameswaran, P., Marcus, A.K., Wanger, G., Gorby, Y.A., Rittmann, B.E., 29. Selecting anode-respiring bacteria based on anode potential: phylogenetic, electrochemical, and microscopic characterization. Environ. Sci. Technol. 43, Wang, X., Cheng, S., Feng, Y., Merrill, M.D., Saito, T., Logan, B.E., 29a. The use of carbon mesh anodes and the effect of different pretreatment methods on power production in microbial fuel cells. Environ. Sci. Technol. 43, Wang, X., Feng, Y.J., Ren, N.Q., Wang, H.M., Lee, H., Li, N., Zhao, Q.L., 29b. Accelerated start-up of two-chambered microbial fuel cells: effect of anodic positive poised potential. Electrochim. Acta 54, Wang, A., Sun, D., Ren, N., Liu, C., Liu, W., Logan, B.E., Wu, W.M., 21. A rapid selection strategy for an anodophilic consortium for microbial fuel cells. Bioresour. Technol. 11, Xing, D., Cheng, S., Logan, B.E., Regan, J.M., 21. Isolation of the exoelectrogenic denitrifying bacterium Comamonas denitrificans based on dilution to extinction. Appl. Microbiol. Biotechnol. 85, Yi, H., Nevin, K.P., Kim, B.-C., Franks, A.E., Klimes, A., Tender, L.M., Lovley, D.R., 29. Selection of a variant of Geobacter sulfurreducens with enhanced capacity for current production in microbial fuel cells. Biosens. Bioelectron. 24, Zhang, X., Cheng, S., Wang, X., Huang, X., Logan, B.E., 29. Separator characteristics for increasing performance of microbial fuel cells. Environ. Sci. Technol. 43, Zuo, Y., Xing, D., Regan, J.M., Logan, B.E., 28. Isolation of the exoelectrogenic bacterium Ochrobactrum anthropi YZ-1 by using a U-tube microbial fuel cell. Appl. Environ. Microbiol. 74,