Chemistry of Heterocyclic Compounds. Porphyrins Purines and pyrimidines Nucleosides and nucleotides

Transcription

1 Chemistry of Heterocyclic Compounds Porphyrins Purines and pyrimidines Nucleosides and nucleotides

2 Introduction to Heterocyclic Compounds. Cyclic compounds with one or more other elements along with carbon atoms are heterocyclic compounds. Non carbon atoms are the hetero atoms. Common hetero atoms are the N, S, O etc. Number of drugs in pharmaceutical science are heterocyclic compounds.

3 5-MEMBERED HETEROCYCLIC COMPOUNDS HAVING ONE HETERO ATOM. PYRROLE FURAN THIOPHENE 3

4 Pyrrole Pyrrole is an important five membered heterocyclic compound possessing a nitrogen atom as hetero atom. plays important role in the chemistry of living organisms. 4

5 Pyrrole The essential structural feature of heme is porphyrin, which consists of four Pyrrole rings held together by bridges.

6

7 Heme Hemoglobin 7

8 Porphyrin Ring in Heme

9 Porphin rings Porphin rings are common biological ligands. Chlorophyll, the photosynthetic pigment of green plants, is a porphyrin with Mg 2+ at the center of the porphin ring Vitamin B 12 has Co 3+ at the center of the porphin ring. Hemoglobin 9

10 Porphin rings Porphin rings are common biological ligands. Vitamin B 12 chlorophyll Hemoglobin 10

11 Pyrrole The amino acids, prolin and hydroxyproline are tetrahydropyrrole (pyrrolidine) derivatives. Proline Pro - P

12 5-MEMBERED HETEROCYCLIC COMPOUNDS HAVING ONE HETERO ATOM. FURAN Derivatives of furan: Vitamin C (ascorbic acid) 12

13 5-MEMBERED HETEROCYCLIC COMPOUNDS HAVING MORE THAN ONE HETERO ATOMS. PYRAZOLE IMIDAZOLE OXAZOLE ISOXAZOLE THIAZOLE 13

14 5-MEMBERED HETEROCYCLIC COMPOUNDS HAVING MORE THAN ONE HETERO ATOMS. Among few naturally occurring products that contain the thiazole nucleus are vitamin B 1 and the pencillins. THIAZOLE Vitamin B 1 (Thiamine) General pattern of the penicillins

15 5-MEMBERED HETEROCYCLIC COMPOUNDS HAVING MORE THAN ONE HETERO ATOMS. Among few naturally occurring products that contain the thiazole nucleus are the pencillins. THIAZOLE General pattern of the penicillins

16 5-MEMBERED HETEROCYCLIC COMPOUNDS HAVING MORE THAN ONE HETERO ATOMS. Among the few naturally occurring products known to contain the imidazole nucleus are amino acids (histidine), purines, uric acid. IMIDAZOLE Histidine His - H

17 6-MEMBERED HETEROCYCLIC COMPOUNDS HAVING ONE HETERO ATOM. PYRIDINE PIPERIDINE 6-MEMBERED HETEROCYCLIC COMPOUNDS HAVING MORE THAN ONE HETERO ATOMS. PYRIMIDINE PYIRIDAZINE PYRAZINE 17

18 6-MEMBERED HETEROCYCLIC COMPOUNDS HAVING ONE HETERO ATOM. PYRIDINE Niacin, nicotinamide and isoniazide derivatives of piridine Niacin (nicotinic acid), also known as Vitamin PP (Vitamin B 3 ). Nicotinamide - it is an amide of nicotinic acid Isoniazid is biologically active and proved to be highly effective in the treatment of tuberculosis. 18

19 6-MEMBERED HETEROCYCLIC COMPOUNDS HAVING ONE HETERO ATOM. PYRIDINE 19

20 6-MEMBERED HETEROCYCLIC COMPOUNDS HAVING MORE THAN ONE HETERO ATOMS. PYRIMIDINE Pyrimidines The pyrimidines are heterocyclic compounds whose basic structure is a six-membered ring containing carbon and nitrogen atoms as illustrated by the parent compound, pyrimidine. 20

21 Pyrimidines Thymine, cytosine, and uracil are substituted pyrimidines found in nucleic acid. Their structural formulas are as follows:

22 CONDENSED HETEROCYCLIC COMPOUNDS. INDOLE PURINE 22

23 CONDENSED HETEROCYCLIC COMPOUNDS. INDOLE Tryptophan- Indole group 23

24 Purines Purines The parent substance, purine, consists of pyrimidine ring attached to imidazole ring. The structural formula of the purine is as follows:

25 Nucleosides and nucleotides Functions Nucleotides are precursors of the nucleic acids, deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The nucleic acids are concerned with the storage and transfer of genetic information.

26 Nucleosides and nucleotides Functions The universal currency of energy, namely ATP, is a nucleotide derivative. Nucleotides are also components of important coenzymes like - NAD+ and FAD, and - metabolic regulators such as camp and cgmp.

27 Composition of Nucleotides When a base combines with a pentose sugar, a nucleoside is formed. When the nucleoside is esterified to a phosphate group, it is called a nucleotide or nucleoside monophosphate.

28 Composition of Nucleotides A nucleotide is made up of 3 components: - a. Nitrogenous base (a purine or a pyrimidine) - b. Pentose sugar, either ribose or deoxyribose - c. Phosphate groups esterified to the sugar.

29 Composition of Nucleotides When a second phosphate gets esterified to the existing phosphate group, a nucleoside diphosphate is generated. The attachment of a 3rd phosphate group results in the formation of a nucleoside triphosphate. The nucleic acids (DNA and RNA) are polymers of nucleoside monophosphates

30 Components of a nucleotide Sugars have five carbons 1 to 5 (pentose) and they can be either a ribose or a 2 -deoxyribose (ribose without the oxygen attached to C2 ). C1 binds the nitrogenous base C2 lacks the oxygen in the case of deoxyribose C5 binds the phosphate group Base Phosphate Sugar X=H: DNA X=OH: RNA Nucleoside Nucleotide

31 Bases Present in the Nucleic Acids Two types of nitrogenous bases; - the purines and pyrimidines are present in nucleic acids.

32 Basic structure of pyrimidine and purine Bases are numbered in a conventional manner, with purine and pyrimidine numbered in opposite directions. 32

33 Pyrimidines 33

34 Purines 34

35 Purine Bases The purine bases present in RNA and DNA are the same; - adenine and guanine. Adenine is 6-amino purine and guanine is 2-amino-6-oxopurine. The numbering of the purine ring with the structure of adenine and guanine are shown in Figure.

36 Purine Bases H H H Adenine is 6-amino purine 2-amino -6-oxo purine

37 Pyrimidine Bases The pyrimidine bases present in nucleic acids are cytosine, thymine and uracil

38 Pyrimidine Bases Cytosine is present in both DNA and RNA. Structures are shown in Figure. H (2 oxo-4-amino pyrimidine)

39 Pyrimidine Bases Thymine is present in DNA and uracil in RNA. Structures are shown in Figure. H H H 2,4-dioxo-pyrimidine H 5-methyluracil 2,4-dioxo-5 methylpyrimidine

40 These two words are often confused THYMINE is the base present in DNA Thiamine (B1) is a member of vitamin B complex

41 Nucleosides Nucleosides are formed when bases are attached to the pentose sugar, D-ribose or 2-deoxy-D-ribose. Sugar groups in nucleic acids

42 Nucleosides All the bases are attached to the corresponding pentose sugar by a beta-n-glycosidic bond between the 1st carbon of the pentose sugar and N9 of a purine or N1 of a pyrimidine. The deoxy nucleosides are denoted by adding the prefix d- before the nucleoside.

43 Nucleosides The carbon atoms of the pentose sugar are denoted by using a prime number to avoid confusion with the carbon atoms of the purine or pyrimidine ring. Numbering in base and sugar groups. Atoms in sugar is denoted with primed numbers.

44 Nucleosides Nucleosides with purine bases have the suffix -sine, while pyrimidine nucleosides end with -dine. vi. Uracil combines with ribose only; and thymine with deoxy ribose only.

45 Nucleosides The names of the different nucleosides are given in Table.

46 Nucleotides These are phosphate esters of nucleosides. Base plus pentose sugar plus phosphoric acid is a nucleotide.

47 Nucleotides The esterification occurs at the 5th or 3rd hydroxyl group of the pentose sugar. Most of the nucleoside phosphates involved in biological function are 5'-phosphates.

48 Nucleotides Moreover, a base can combine with either ribose or deoxy ribose, which in turn can be phosphorylated at 3' or 5' positions.

49 Nucleotides

50 Nucleotides Since 5'-nucleotides are more often seen, they are simply written without any prefix. For example, 5'-AMP is abbreviated as AMP; but 3' variety is always written as 3'-AMP.

51 Nucleotides Many co-enzymes are derivatives of adenosine monophosphate. Examples are NAD +, NADP +, FAD and Co-enzyme A.

52 Flavin adenine dinucleotide (FAD) is a prosthetic group that participates in several intracellular oxidation -reduction reactions. B 2 (Riboflavin) FAD

53 Flavin adenine dinucleotide (FAD) is a prosthetic group that participates in several intracellular oxidation -reduction reactions. B 2 (Riboflavin)

54 B 2 (Riboflavin)

55 The nicotinamide adenine dinucleotide (NAD) The nicotinamide adenine dinucleotide (NAD + ) molecule. The portion shown in purple is the nicotinamide molecule.

56 The nicotinamide adenine dinucleotide (NAD) Vitamin B 3 (niacin) Vitamin PP Niacin is a water-soluble vitamin, which is also known as nicotinic acid or vitamin B3. Nicotinamide is the derivative of niacin and used by the body to form the coenzymes nicotinamide adenine dinucleotide (NAD) and nicotinamide adenine dinucleotide phosphate (NADP).

57 The nicotinamide adenine dinucleotide (NAD) 2H + H + NAD + + 2e- + 2H > NADH + H + Nicotinamide adenine dinucleotide exists in two forms: an oxidized and reduced form abbreviated as NAD + and NADH respectively. In metabolism, nicotinamide adenine dinucleotide is involved in redox reactions, carrying electrons from one reaction to another.

58 The nicotinamide adenine dinucleotide (NAD) Reaction: CH 3 CH 2 OH + NAD + --> CH 3 CH=O + NADH + H + This is an oxidation reaction where 2 hydrogen atoms (or 2 hydrogen ions and 2 electrons) are removed from the organic metabolite. (The organic metabolites are usually from the citric acid cycle and the oxidation of fatty acids). One hydrogen is removed with 2 electrons as a hydride ion (H - ) while the other is removed as the positive ion (H + ). Usually the metabolite is some type of alcohol which is oxidized to a ketone. NAD + + 2e- + 2H > NADH + H +

59 The nicotinamide adenine dinucleotide (NADP) NADPH acts as a reducing agent during the synthesis of nucleic acids and lipids.

60 Co-enzyme A B 5 (pantothenic acid) Coenzyme A (CoA, CoASH, or HSCoA) is a coenzyme, notable for its role in the synthesis and oxidation of fatty acids, and the oxidation of pyruvate in the citric acid cycle.

61 Nucleoside Triphosphates Corresponding nucleoside di- and tri- phosphates are formed by esterification of further phosphate groups to the existing ones. In general, any nucleoside triphosphate is abbreviated as NTP or d-ntp.

62 Nucleoside Triphosphates Nucleoside diphosphate contains one high energy bond and triphosphates have 2 high energy bonds. ATP is the universal energy currency. Adenosine triphosphate (ATP)

63 Nucleoside Triphosphates It is formed during oxidative processes by trapping the released energy in the high energy phosphate bond. A phosphodiester linkage may be formed between the 3' and 5' positions of ribose group. Such compounds are called cyclic nucleotides.

64 Nucleotides 3', 5'-cyclic AMP or camp is a major metabolic regulator. Cyclic GMP also behaves similarly. These are second messengers in mediating the action of several hormones. 3',5'-cyclic AMP or camp

65 Nucleotides Deoxy ribonucleotides are used for synthesis of DNA and ribonucleotides for RNA. In pseudouridylic acid (found in trna) uridine is attached to ribose phosphate in a C-C bond instead of C-N bond in UMP or UTP. uridine pseudouridine Different attachment of uracil to sugars

66 DNA DNA - a polymer of deoxyribo nucleotides found in chromosomes and mitochondria carries the genetic information 66

67 DNA structure

68 5 end The primary structure of DNA is the sequence 5 3 Phosphodiester linkage 3 end 68

69 Traditionally, a DNA sequence is drawn from 5 to 3 end. A shorthand notation for this sequence is ACGTA 69

70 The secondary structure of DNA is the double helix 70

71 The secondary structure of DNA Two anti-parallel polynucleotide chains wound around the same axis. Sugar-phosphate chains wrap around the periphery. Bases (A, T, C and G) occupy the core, forming complementary A T and G C Watson-Crick base pairs. 71

72 Two hydrogen bonds between A:T pairs Three hydrogen bonds between C: G paired 72

73 Base Stacking The bases in DNA are planar and have a tendency to "stack". Major stacking forces: hydrophobic interaction van der Waals forces. 73

74 Normally hydrated DNA: B-form DNA Helical sense: right handed Base pairs: almost perpendicular to the helix axis; 3.4 Å apart One turn of the helix: 36 Å; ~10.4 base pairs Minor groove: 12 Å across Major groove: 22 Å across

75 In eukaryotic cells, DNA is folded into chromatin

76 Nucleosomes any of the repeating globular subunits of chromatin that consist of a complex of DNA and histone 76

77 Structure of nucleosome core 77

78 Compaction of DNA in a eukaryotic chromosome 78

79

80 Protein coding From the genetic code, we have the following amino acid sequence: AGU CUC UGU CUC CAU UUG AAG AAG GGG AAG GGG Ser - Leu - Cys - Leu - His - Leu - Lys - Lys - Gly - Lys - Gly

81 The Genetic Code How do 64 different codons produce 20 different amino acids?

82 Protein coding The sequence provided in the form of a double-stranded DNA molecule: 5' TCGTTTACGATCCCCATTTCGTACTCGA 3' 3' AGCAAATGCTAGGGGTAAAGCATGAGCT 5 The sequence of the complementary strand is (notice the 5-3 orientation): 5' TCGAGTACGAAATGGGGATCGTAAACGA 3 The RNA sequence obtained after the transcription of the DNA sequence provided will be identical to the sequence of the complementary strand, with the exception of the presence of uracil in place of thymine: 5' UCGAGUACGAAAUGGGGAUCGUAAACGA 3 The amino acid sequence is obtained after first separating the mrna sequence into codons: 5' UCG AGU ACG AAA UGG GGA UCG UAA ACG A 3' Ser-Ser-Thr-Lys-Trp-Gly-Ser-Stop

83