Heredity and Genotyping Notes:

Transcription

1 Vocabulary: Heredity and Genotyping Notes: 02 January 2019 Heredity: the passing of physical characters from parents to offspring Gene: a word used to describe factors that control a trait Alleles: the different forms of a gene Recessive Allele: it is a hidden form of a gene; it cannot be seen when the dominant allele is present Dominant Allele: it is a form of a gene that always shows up in the organism when the allele is present Probability: a number that describes how likely an event is to occur Punnett Square: a chart that shows all possible ways alleles can combine in a genetic cross Phen otype : visible trait; it s physical appearance (THINK: PH = physical) Gen otype : its genetic makeup or alleles (THINK: GEN = genes) Homozygous : if you have 2 identical alleles for a trait (Ex. FF or ff) Heterozygous : you have 2 different alleles for a trait (Ex. Ff, Ss)

2 Practicing with Punnett Squares: If two parents (P1) crossed with genotypes TT (tall) and Tt (tall), what would be the cross for the first set of offspring (F1)? T T TT Tt t T TT Tt Probabilities of Genotypes: TT : 2 out of 4 = 50% dominant (tall) Tt : 2 out of 4 = 50% dominant (tall) tt : 0 out of 4 = 0 % recessive (short) Probabilities of Phenotypes: Dominant (TT or Tt) = Tall 4 out of 4 = 100 % Recessive (tt) = Short 0 out of 4 = 0 %

3 If two parents (P1) crossed with genotypes Tt (tall) and Tt (tall), what would be the cross for the first set of offspring (F1)? T T TT Tt t t Tt tt Probabilities of Genotypes: TT : 1 out of 4 = 25% dominant (tall) Tt : 2 out of 4 = 50% dominant (tall) tt : 1 out of 4 = 25 % recessive (short) Probabilities of Phenotypes: Dominant (TT or Tt) = Tall 3 out of 4 = 75 % Recessive (tt) = Short 1 out of 4 = 25 %

4 If two parents (P1) crossed with genotypes bb (blue) and BB (brown) for eye color, what would be the cross for the first set of offspring (F1)? b B Bb Bb b B Bb Bb Probabilities of Genotypes: TT : 4 out of 4 = 100% dominant (brown) Tt : 0 out of 4 = 0 % dominant (brown) tt : 0 out of 4 = 0 % recessive (blue) Probabilities of Phenotypes: Dominant (BB or Bb) = Brown Eyes 4 out of 4 = 100 % Recessive (bb) = Blue Eyes 0 out of 4 = 0 %

5 Incomplete and Codominance 03 January 2019 Warm-up Problem: Please copy and answer the following question in your notebook / binder. A scientist is studying a gene that is responsible for the number of fingers an organism possesses. She discovered that the dominant allele, F, results in a phenotype of 10 fingers. The recessive allele, f, results in a phenotype of 11 fingers. If two parents, one heterozygous dominant (Ff) and the other homozygous dominant (FF), were crossed, what is the probability of each genotype and phenotype? F f F FF Ff F FF Ff Probabilities of Genotypes: FF: 2 out of 4 = 50 % (10 fingers) Ff: 2 out of 4 = 50 % (10 fingers) ff: 0 out of 4 = 0 % (11 fingers)

6 Probabilities of Phenotypes: Dominant = 10 fingers = 4 out of 4 = 100 % Recessive = 11 fingers = 0 out of 4 = 0 % ***Note*** The percentages of our genotypes are not the same as our phenotypes for dominant/recessive genes.

7 Codominance: is when both alleles for a gene are expressed equally Practice Problem: If a purple elephant has a gene with alleles expressed codominantly for colored spots, and the elephant can have either orange, O, or green, G, spots, what would happen if you crossed an elephant with orange spots (OO) and an elephant with both orange and green spots (OG)? List the probabilities of each genotype and phenotype. O O O OO OO G OG OG Probabilities of Genotypes and Phenotypes : OO = 2 out of 4 = 50% orange spots OG = 2 out of 4 = 50 % orange and green spots GG = 0 out of 4 = 0 % green spots ***Note*** The percentages of our genotypes are the same as our phenotypes for dominant/recessive codominant genes.

8 Practice Problem 2: There are two parents that have the gene for being good at Fortnite (F) and being good at Roblox (R). They can be expressed codominantly. If one parent is only good at Fortnite and the other is only good at Roblox, what are the probabilities of each genotype and phenotype of their offspring? F F R FR FR R FR FR Probability of Genotypes & Phenotypes: FR = 4 out of 4 = 100 % (good at both) FF = 0 out of 4 = 0 % (good at only Fortnite) RR = 0 out of 4 = 0 % (good at only Roblox)

9 Incomplete Dominance: when one allele is only partially dominant Practice Problem : If the dominant allele for color of a flower is red, and the recessive allele for color is white, what would a cross between two heterozygous parents (Rr) produce if the dominance is expressed incompletely? List the probabilities of each genotype and phenotype. R r R RR Rr r Rr rr Probabilities of Genotypes & Phenotypes: RR = 1 out of 4 = 25 % (Red) Rr = 2 out of 4 = 50 % (Pink) rr = 1 out of 4 = 25 % (White) What happens if you cross a homozygous dominant (RR) parent with a heterozygous parent (Rr)? List the probabilities of each genotype and phenotype.

10 R R R RR RR r Rr Rr Probabilities of Genotypes & Phenotypes: RR = 2 out of 4 = 50 % (Red) Rr = 2 out of 4 = 50 % (Pink) rr = 0 out of 4 = 0 % (White)

11 Warm-up Problems: REMEMBER ii is O type blood. i is the allele for O type blood. If a patient has Ai blood and there are two donors with AB blood and ii blood, which donor would be an acceptable donor for the victim? Ai blood - A Blood (victim) ii blood - O blood (acceptable donor) AB blood - AB blood If two parents, one with heterozygous B blood and the other with O blood, had a child, what are possible blood types of their children? Heterozygous B blood - Bi O Blood - ii B i i Bi ii i Bi ii Probabilities of Children: Heterozygous B - Bi - 2 out of 4 = 50% O blood - ii - 2 out of 4 = 50%

12 Codominance Worksheet Blood Types: 07 January 2019 Blood Type Genotype O ii AB AB A Ai (heterozygous) or AA (homozygous) B Bi (heterozygous) or BB (homozygous) 1. Write the genotype a. Homozygous B BB b. Heterozygous A Ai c. Type O blood i d. Type A & had a type O Ai e. AB AB f. Universal donor (O blood) ii g. Can only receive from O ii 2. Brad Pitt is homozygous B (BB) and Angelina Jolie (ii) had a baby. B B i Bi Bi i Bi Bi

13 3. What are the children of an O mother (ii) and an AB father (AB)? i i A Ai Ai B Bi Bi

14 2 Ai out of 4 = 50 % heterozygous A blood 2 Bi out of 4 = 50 % heterozygous B blood 4. Mrs. Clink type A and Mr. Clink is type O (ii). Matt - A - Ai Mark - O - ii Luke - AB - i cannot have i for AB blood (these are not his parents What is the genotype of Mr. Clink (O blood) - ii Mrs. Clink (A blood) - Ai She must be heterozygous A because she has Mark, an O child, so she must pass along an O allele (i). 5. Mom O blood Father AB blood Baby B blood What is the genotype of Mom? What is the genotype of Dad? What is the genotype of the baby? ii AB Bi i i A Ai Ai B Bi Bi Bi = 2 out of 4 = 50 % B blood

15 Ai = 2 out of 4 = 50 % A blood

16 Blood Typing Donors and Recipients: Donate to Receive From Blood O A, B, AB, O (universal donor) O Blood A A or AB A or O Blood B B or Ab B or O Blood AB AB A, B, AB, and O (universal receiver)

17 Chromosomes and Inheritance (pg ) 08 January 2019 Chromosomes: A threadlike structure within a cell s nucleus that contains DNA that is passed from one generation to the next There are 23 pairs of chromosomes in each individual s DNA. The 23rd pair is responsible for the sex (male or female) of the individual. Sex chromosome are X and Y. XX - female XY - male Remember: When we went over mitosis

18 Chromosome pairs become what they are during a similar process called meiosis. Meiosis: The process that occurs in the formation of sex cells (sperm or egg) by which the number of chromosomes is reduced by half. Baby DNA formula: ½ mom s DNA (1 set of chromosomes: egg) + ½ dad s DNA (1 set of chromosomes: sperm) baby s DNA (46 chromosomes or 23 pairs) In your chromosomes we store thousands of genes.

19 Karyotype: A picture of all the human chromosomes in a cell grouped together in pairs and arranged in order of decreasing size. Each chromosome at each pair has the same genes, however they may not be identical. There is a chance that each parent might have different alleles for a gene. Chromosomes are arranged in decreasing size order. Each pair is organized by aligning their centromeres. **Meiosis Note**: 4 cells are produced. Each cell has half the number of chromosomes of the parent cell. Each sex cell has only one chromosome from each original pair.

20 Abnormal Chromosomes:

21 What is DNA 22 January 2019 DNA - deoxyribonucleic acid - the genetic material that carries information about an organism and is passed from parent to offspring. 1.) Nitrogen Bases : molecules that contain nitrogen and other elements There are 4 types of nitrogen bases: A - adenine T - thymine G - guanine C - cytosine 2.) Pentose Sugar - deoxyribose 3.) Phosphate Group The order of the nitrogen bases along a gene forms a genetic code that specifies what type of protein will be produced. Gene : a sequence of DNA that determines a trait and is passed from parent to offspring DNA Replication: the process in which an identical copy of a DNA strand is formed for a new cell Steps in DNA Replication: The DNA helix unzips

22 Nitrogen bases in the cell nucleus pair up with the bases on the DNA halves Two new identical DNA molecules are formed Practicing Base Pairing for Replication: Rules: A=T and C = G Template / Parent Strand (Original Strand): A G G C T A T A T C T C C G A T A T A G Complementary Strand (New Strand) Parent Strand (Original Strand): T C C G T A C G T T T T A C G A G G C A T G C A A A A T G C (New Strand) If a parent strand has the following DNA strands, what does each daughter strand look like transcribed? Draw out each of the steps of transcription. 5 A G T C C G T A A T G C A 3 3 T C A G G C A T T A C G T 5

23 1. Unzip the DNA 5 A G T C C G T A A T G C A 3 3 T C A G G C A T T A C G T 5 2. Nitrogen Bases Pair Up to Parent Strands 5 A G T C C G T A A T G C A 3 3 T C A G G C A T T A C G T 5 5 A G T C C G T A A T G C A 3 3 T C A G G C A T T A C G T 5 Each daughter strand creates an indentical pair to the parent. Why are both daughter strands exactly the same?

24 Replicating/ making an identical copy. What happens if the daughter copies are not the same? If it is not the same DNA it does not always possess the same traits. Where does DNA replication occur? In the cell s nucleus. DNA is antiparallel which means they run opposite to one another. At the end of each strand of DNA there is a 5 at the start of the strand and a 3 at the end of the strand.

25

26 DNA Replication Continued 23 January 2019 Warm-up Problem: If you have a template strand of DNA as shown below, show the steps of DNA replication. 5 ATGCTATGCATAGCTAGTACCCCCCGAT 3 3 TACGATACGTATCGATCATGGGGGGCTA 5 5 ATGCTATGCATAGCTAGTACCCCCCGAT 3 3 TACGATACGTATCGATCATGGGGGGCTA 5 5 ATGCTATGCATAGCTAGTACCCCCCGAT 3 3 TACGATACGTATCGATCATGGGGGGCTA 5 5 ATGCTATGCATAGCTAGTACCCCCCGAT 3 3 TACGATACGTATCGATCATGGGGGGCTA 5 Another warm-up problem: Write the complementary strand to the template strand AND put it in 5 to 3 order. 5 AGTCGCCCATATATAGCATAGTCAGTGA 3 3 TCAGCGGGTATATATCGTATCAGTCACT 5 5 TCACTGACTATGCTATATATGGGCGACT 3

27 One more practice problem: Write the complementary strand to the template strand and put it in 5 to 3 order. 5 AGTCTGATATAGACTACGATGAT 3 3 TCAGACTATATCTGATGCTACTA 5 5 ATCATCGTAGTCTATATCAGACT 3 How Cells Make Proteins 23 January 2019 During protein synthesis, the cell uses information from a gene on a chromosome to produce a specific protein. Amino acids are the building blocks of proteins. There are 20 amino acids Protein synthesis takes place in the cytoplasm outside the cell s nucleus. RNA - ribonucleic acid - the genetic messenger that carries the genetic code from the DNA inside the nucleus to the cytoplasm Composed of 4 nucleotides Adenine Cytosine Guanine Uracil (replaces thymine) A = U It is usually one strand Contains a different sugar molecule than DNA

28 mrna - messenger RNA - copies a message from DNA in the nucleus and carries a message to the ribosomes in the cytoplasm REMEMBER - ribosomes are responsible for protein synthesis (makes proteins) trna - transfer RNA - carries amino acids to the ribosome and adds them to the growing protein. Steps to Protein Synthesis: 1. TRANSCRIPTION - mrna enters the cytoplasm: (DNA unzips, pair up to make mrna) (TEMPLATE DNA) 5 AGTCTGATATAGACTACGATGAT 3 3 UCAGACUAUAUCUGAUGCUACUA 5 (mrna STRAND) Practice: Transcribe the following template strand of DNA to mrna. 5 AGCTAAATGCTCGTAGAT 3 3 UCGAUUUACGAGCAUCUA 5 2. Ribosomes attach to mrna 3. trna attaches to mrna (mrna strand) 3 UCGAUUUACGAGCAUCUA 5 5 AGCUAAAUGCUCGUAGAU 3 (trna strand)

29 4. Amino acids join in the ribosome 3 UCG AUU UAC GAG CAU CUA 5 5 AGC UAA AUG CUC GUA GAU 3 AA AA AA AA AA AA 3 nucleotides of mrna together make 1 codon Each codon creates 1 of the 20 amino acids 5. Protein chain forms Protein = AA AA AA AA AA AA Steps summarized: 1. DNA strand 2. Copies to mrna 3. Copies to trna 4. Breaks into codons (groups of 3) 5. Matches AA (amino acids) and forms chain 6. Creates a protein Practice Problem: Translate the following DNA molecule to a chain of codons. 5 AGTCATAACG 3 (DNA) 3 UCAGUAUUGC 5 (mrna) 5 AGUCAUAACG 3 (trna) identical to DNA w/ U for T 5 AGU CAU AAC 3 (codons of trna) Ser --- His --- Asn Protein

30 Practice Problem 2: Translate the following DNA molecule to a chain of amino acids. 5 ACGTAGATAGCATAGATCAGTACCCGATAA 3 DNA mrna trna Codons AA chain Practice Problem 3: Translate the following DNA molecule to a chain of amino acids. 5 CGATACGATCTACCGATCCAAAATCTGACT 3 DNA mrna trna Codons AA chain

31

32

33