Sensitive Detection of Small Molecules by Competitive Immunomagnetic-Proximity Ligation Assay

Transcription

1 Sensitive Detection of Small Molecules by Competitive Immunomagnetic-Proximity Ligation Assay Shuyan Cheng a, Feng Shi a, Xuecheng Jiang a, Luming Wang a, Weiqing Chen b, Chenggang Zhu a * a College of Life Sciences, Zhejiang University, , Hangzhou, China. b College of Biology and Environmental Engineering, Zhejiang Shuren University, , Hangzhou, China Contents DNA oligonucleotides and the Proximity Ligation Assay (PLA) strategy... S-2 Buffers used in this assay... S-2 Biotinylation of CLE-BSA, RAC-BSA, CLE and RAC monoclonal antibodies... S-2 Preparation of CLE and RAC proximity probes... S-2 Antibody detection assays... S-3 Optimization of reagent concentrations... S-4 * Corresponding author: Chenggang Zhu, College of Life Sciences, Zhejiang University, Hangzhou, , (China). Phone: Fax: cgzhu@zju.edu.cn. This work was supported by grants from the National Natural Science Foundation of China ( ), and the Science and Technology Program of Zhejiang Province (2008C23052). S-1

2 1 DNA oligonucleotides and the Proximity Ligation Assay (PLA) strategy Cipla 1: 5 -Biotin- AAAACTCAAATCAACAGGCGAGCCGGACGCTACCAGCTTCTATACCGCAAGCAGCTTG GCCTGAATCTGCTC-OH-3 ; Cipla 2: 5 -P-TACGCCTCGACAGGACGCTGTGGCATTGCAGAGCGTGGCGCTTTACCTATGATATGATCGTG GTGATATCCGTC-Biotin-3 ; Connector 20: 5 -TTTTCGAGGCGTAGAGCAGATTCAAA-3 Primer Cipla1: 5 -AAAACTCAAATCAACAGGCG-3 Primer Cipla2: 5 -GACGGATATCACCACGATCA-3 Connector 20 was a 26 nt oligonucleotide with a TTT on the 5 end and a AAA on the 3 end (These two ends are designed to avoid the non-special amplification of the connector DNA), which can hybridize with the ends of nearby DNA strands existing on proximity probes (3 -OH free end of Cipla 1 and 5 -phosphorylated free end of Cipla 2). In PLA detection, binding of pairs of the proximity probes to the same target brings oligonucleotides of the two probes in proximity, through adding connector 20 in excess molar, the oligonucleotide ends can then be joined by T4 DNA ligase. The ligation products can then be replicated by nucleic acid amplification through PCR using Primer Cipla1 and Primer Cipla2, while the nonspecific binding and unreacted probes remain silent. 2 Buffers used in this assay The Buffers used in our assays included PLA blocking buffer (0.1 % BSA, 1 mm D-Biotin, 0.1 mg ml -1 Salmon sperm DNA,0.05% Tween-20 in PBS, ph 7.4), Probe dilution buffer (4.6 SSC Buffer, 0.5% DNA blocking reagent, 0.01 M EDTA, ph 8.0, 0.1% Tween-20), T4 DNA ligation buffer ( 0.5 U T4 DNA Ligase, 5 % (w/v) PEG 4000, 400 nm connector 20, 40 mm Tris-HCl, 10 mm MgCl 2, 0.5 mm ATP, ph 7.8), and real-time PCR Buffer (deionized water, 0.2 μm Primer pla1, 0.2 μm Primer pla2, 12.5 μl SYBR Premix Ex Taq TM II, to a final volume of 25 μl). 3 Biotinylation of CLE-BSA, RAC-BSA, CLE and RAC monoclonal antibody N-Hydroxysuccinimide (NHS) esters of biotin are the most popular type of biotinylation reagent. Herein we used a 20-fold molar excess of Sulfo-NHS-Biotin reagent (Thermo, 21217) to label 0.2 mg RAC-BSA, CLE-BSA, RAC mab and CLE mab in 200 μl PBS solution (ph 7.4) respectively, resulting in 4-6 biotin groups per molecule. Excess non-reacted biotin and reaction byproducts are removed through dialysis in PBS, stored at 4 C for 2 weeks or so, and diluted to a suitable concentration when they are needed for further use. 4 Preparation of CLE and RAC proximity probes The most commonly used protocol for conjugation of antibodies to oligonucleotides to produce the S-2

3 proximity probes uses the high-affinity interaction of biotin for streptavidin (STV) (KD approximately M). Here we followed the same principle. In the coupling procedure, biotinylated oligonucleotides (Cipla 1 and Cipla 2) were allowed to bind streptavidin molecules at a 1:1 ratio for 1 h at room temperature (RT). Then, the biotinylated CLE-BSA or RAC-BSA was added to the covalently linked oligonucleotide-streptavidin constructs at a ratio of 4:1 for 1 h at RT, allowed to form functional proximity probes. Lastly, dissociative D-biotin was added to a final concentration of 1 mm to block the unreacted sites on STV which were not bind by Bio-antigen-BSA or Bio-oligonucleotide. Therefore, we constructed four proximity probes separately, CLE-BSA-Bio~STV~Bio-Cipla1 (CLE Probe 1), CLE-BSA-Bio~STV~Bio-Cipla2 (CLE Probe 2), RAC-BSA-Bio~STV~Bio-Cipla1 (RAC Probe 1) and RAC-BSA-Bio~STV~Bio-Cipla2 (RAC Probe 2). The conjugates were diluted in Probe Dilution buffer when they were used in the following assays. 5 Antibody detection assays To estimate the effect of antibody in CIPLA, 5 μl of antibody conjugated immuno-magnetic Beads stock solution and STV Magnetic Beads were used in separate tubes. The STV Magnetic Beads were blocked with 50 μl 0.1 % BSA. Then, the magnetic beads were washed twice with 200 μl PBST and the two proximity probes were added. The results indicated that the threshold cycle (Ct) value of quantitative real-time PCR was in the presence of biotinylated CLE mab (Figure S-1 a1), and in the absence of mab (Figure S-1 a2), which appeared to have the difference of Ct value with For RAC, the threshold cycle (Ct) value of quantitative real-time PCR was in the presence of biotinylated RAC mab (Figure S-1 b1), and in the absence of RAC mab (Figure S-1 b2), which resulted in difference of Ct value with Figure S-1. Real-time PCR analysis of Antibody detection assay in the presence or absence of the biotinylated monoclonal antibody. (a) Comparative antibody detection assay of CLE mab; (b) Comparative antibody detection assay of RAC mab. S-3

4 6 Optimization of reagent concentrations For CLE mab, we tested 5 concentrations for biotinylated CLE monoclonal antibody, and 1000 pm proximity probes were used simultaneously. As shown in Figure S-2a, when the concentration of CLE mab increased, the Ct value decreased, from (0 ng ml -1 ) to (5000 ng ml -1 ). Therefore, we chose 5000 ng ml -1 as a final concentration of the Bio-CLE mab in further detection. For RAC mab, we also tested 5 concentrations and 1000 pm proximity probes were used. As shown in Figure S-2b, when the concentration of Bio-RAC mab increased, the corresponding Ct value of quantitative PCR decreased gradually, from (0 ng ml -1 ) to (5000 ng ml -1 ). Thus, a concentration of 5000 ng ml -1 of the Bio-RAC mab was determine to use in the subsequent experiments. Figure S-2. Real-time PCR analysis of monoclonal antibody in 5 different concentrations using Immunomagnetic-Proximity Ligation Assay. (a) CLE monoclonal antibody detection; (b) RAC monoclonal antibody detection. In proximity probe assay, we tested 4 concentrations (1000 pm, 100 pm, 10 pm and 1 pm) of the probes. We employed 5000 ng ml-1 biotinylated monoclonal antibody for this assay in the presence or absence of biotinylated mono-antibody. As shown in Figure S-3a, when the concentration of CLE probe increased, the difference between Ct values were also increased, Therefore, 1000 pm CLE proximity probes were chosen for further use. As shown in Figure S-3b, 1000 pm RAC proximity probes was the optimal working concentration. S-4

5 Figure S-3. Real-time PCR analysis of proximity probes in different concentrations using Immunomagnetic-Proximity Ligation Assay (IPLA). (a) IPLA of CLE proximity probes; (b) IPLA of RAC proximity probes. Supporting Information Available: This material is available free of charge via the Internet at S-5