Supporting Information

Transcription

1 Supporting Information Massie et al /pnas SI Materials and Methods Construction of DGC Overexpression Plasmids. The overexpression plasmids for each V. cholerae DGC were constructed by restriction digestion of the appropriate PCR fragment into the vector pevs143 (1). The primers used for amplification of each DGC and the restriction sites used for cloning are indicated in Table S1. Site-directed mutagenesis was performed using the Quick Change Lightning Site Directed Mutagenesis Kit (Agilent) according to the instructions of the manufacturer. The V. cholerae strain C6706str2 (2) used in this study encodes 40 distinct DGCs. Importantly, each ORF was translated from the expression plasmid using an identical ribosome-binding site located upstream of the cat gene in pevs143. Each plasmid was sequenced to confirm that no mutations had been generated. PCR was performed with the enzyme Phusion (Invitrogen) using standard methodology. Escherichia coli strains DH10B (Invitrogen) and S17-λpir (3) were used for DNA manipulation and conjugation of plasmids into V. cholerae. Determination of the Intracellular Concentration of c-di-gmp. After removal of 10 μl for biofilm analysis, each tube grown as described in the previous section was sonicated by a Sonifier 450 (Branson) sonicator for three pulses at the output setting of one. We determined that this level of sonication disrupted bacterial aggregates without killing any cells. The OD 600 of each culture was measured, and 1 ml of this culture was removed, pelleted for 30 s at maximum speed in a bench-top centrifuge, and resuspended in 100 μl of 40% (vol/vol) acetonitrile/40% (vol/vol) methanol/0.1 N formic acid. This slurry was incubated for 30 min at 20 C. The insoluble material was pelleted using a table-top microcentrifuge at 4 C for 5 min, and the supernatant was collected. Ten microliters of each combined sample were analyzed using LC-MS/MS on a Quattro Premier XE mass spectrometer (Waters) coupled with a Acquity Ultra Performance LC system (Waters). c-di-gmp was detected with electrospray ionization using multiple reaction monitoring in negative-ion mode at m/z The MS parameters were as follows: capillary voltage, 3.5 kv; cone voltage, 50 V; collision energy, 34 V; source temperature, 110 C; desolvation temperature, 350 C; cone gas flow (nitrogen), 50 L/h; desolvation gas flow (nitrogen), 800 L/h; collision gas flow (nitrogen), 0.15 ml/min; and multiplier voltage, 650 V. Chromatography separation was reverse phase using a Waters BEH C mm column with a flow rate of 0.3 ml/min with the following gradient of solvent A (10 mm tributylamine plus 15 mm acetic acid in 97:3 water:methanol) to solvent B (methanol): t = 0 min; A-99%:B- 1%, t = 2.5 min; A-80%:B-20%, t = 7.0 min; A-35%:B-65%, t = 7.5 min; A-5%:B-95%, t = 9.01 min; A-99%:B-1%, t = 10 min (end of gradient). Chemically synthesized c-di-gmp (Axxora) was dissolved in the extraction buffer at concentrations of 250, 125, 62.5, 31.25, 15.62, and 7.81 nm to generate a standard curve for calculating the c-di-gmp concentration in each extract. To determine the intracellular concentration of c-di-gmp, we divided the total c-di-gmp extracted by the intracellular volume of bacteria extracted. The total intracellular volume extracted was determining by multiplying the number of colony-forming units in each extracted sample by the volume of one bacterium, which was estimated to be L by analysis of differential image-contrast micrographs using the software ImageJ, estimating bacterial cells to be cylindrical. 1. Dunn AK, Millikan DS, Adin DM, Bose JL, Stabb EV (2006) New rfp- and pes213-derived tools for analyzing symbiotic Vibrio fischeri reveal patterns of infection and lux expression in situ. Appl Environ Microbiol 72: Thelin KH, Taylor RK (1996) Toxin-coregulated pilus, but not mannose-sensitive hemagglutinin, is required for colonization by Vibrio cholerae O1 El Tor biotype and O139 strains. Infect Immun 64: de Lorenzo V, Timmis KN (1994) Analysis and construction of stable phenotypes in gram-negative bacteria with Tn5- and Tn10-derived minitransposons. Methods Enzymol 235: of6

2 A. B. FL-270 FL-708 C. D. FL-560 FL-881 E. F. FL-3,572 FL-12,270 G. H. FL-23,112 FL-27,901 I. FL-27,863 Fig. S1. The Ptac promoter is induced as a graded response. IPTG induction of the vector pbrp157 containing the gfp gene under control of the Ptac promoter on the same vector backbone used in this study to induce the DGCs was examined by flow cytometry. V. cholerae containing this vector was grown for 3 h from a 1/100 dilution of an overnight culture in eight IPTG concentrations. (A) V. cholerae containing a plasmid control that does not express gfp. The concentrations (in mm) of IPTG used were: (B); (C); (D), (E); (F); 0.11 (G); 0.33 (H); and 1.0 (I). The number within each histogram indicates the median gfp fluorescence. 2of6

3 E E E E E (Forward Sca er)(% Parent)1.E+07 Fig. S2. VPS production and an intact GGDEF active site are required for biofilm formation. The ability of each DGC to induce biofilm formation was determined by flow cytometry in WT V. cholerae (black bars), the ΔvpsL mutant (gray bars), and DGC active site mutant alleles in the WT strain (white bars). Biofilm formation was quantified by multiplying the mean forward scatter by percentage aggregate population of cultures analyzed by flow cytometry. DGCs were induced with 0.1 mm IPTG and analyzed in triplicate. The error shows the SD from the mean. DGC Biofilm VC1067 C-di-GMP VC1067 Biofilm VC1353 C-di-GMP VC1353 VC1104 VC1104 VC1599 VC1599 VC1216 VC1216 VC2224 VC2224 Fig. S3. (Continued) 3of6

4 Biofilm C-di-GMP VC2454 VC2454 VCA0165 VCA0165 VCA0074 VCA0074 Fig. S3. Biofilm- and c-di-gmp induction curves. The induction of biofilm formation (left column) and c-di-gmp synthesis (right column) for the nine DGCs examined are shown. Experiments were repeated in triplicate, and error bars represent SD from the mean for any given IPTG-induction state. 30 Slope (fold change over minimum) Biofilm Forma on apha Transcrip on 0 VC1104 VC1216 VC1353 VC1599 VC2454 VCA0074 VCA0165 DGC Fig. S4. The slopes of the best-fit lines for individual DGCs were divergent. The slopes of the best-fit lines from Fig. 3 B and D were used to quantify and compare phenotypic rates of change across the seven analyzed DGCs. In both cases, slopes were originally reported as a phenotypic output per micromolar concentration of c-di-gmp. All slopes were normalized to the lowest slope in each phenotype (VCA0074 in both cases) and reported as a fold change over this value for ease of comparison across phenotypes. The error bars represent the 95% confidence intervals in slope values as reported by the computer program Prism, which were similarly normalized to VCA of6

5 Table S1. Oligonucleotides used Primer name Sequence Insert Vector VC0900-f taggaattcaggagctaaggaagctaaaatgggcgttctagaacaaga VC0900-r atatcatgattatttccaaactaactgac BspHI Cut vector with NcoI VC1029-f taggaattcaggagctaaggaagctaaagtgacttctattttttcctc VC1029-r ataggatccctattcatgccaagtggtac VC1067-f taggaattcaggagctaaggaagctaaagtgggggtatttacgataaa VC1067-r ataggatccttaaacgatgtgtaatcctt VC1104-f taggaattcaggagctaaggaagctaaaatgaatcagcgcatgagttt VC1104-r ataggatcctcagtaaaccaactgatttt VC1185-f taggaattcaggagctaaggaagctaaagtgaaagtgctgccaagagt VC1185-r ataggatcctcaccctttttctccatcac VC1216-f taggaattcaggagctaaggaagctaaaatgcaatcattcaaatggga VC1216-r ataggatccctagctcggcgcaccaaaag VC1353-f tagcaattgaggagctaaggaagctaaaatgacaggaattaggctttt MfeI VC1353-r ataggatcctcaatggaggccgcttttta VC1367-f tagcaattgaggagctaaggaagctaaattgtttatcaagttaatgag MfeI VC1367-r ataggatccttaagagcaagcagtcagca VC1370-f taggaattcaggagctaaggaagctaaattgatcaactcattaaaccg VC1370-r ataggatcctcagctcactaaactggtgt VC1372-f taggaattcaggagctaaggaagctaaagtgcattcaggacgaccaag VC1372-r ataggatccttaactcgcgctcacgtctt VC1376-f taggaattcaggagctaaggaagctaaaatgatagataacataataag VC1376-r ataagatctctaccttgctgcattgtgcg BglII VC1593-f tagcctaggaggagctaaggaagctaaaatgatggacacagataaccg AvrII Cut vector with AvrII VC1593-r ataggatcctcagcactgaatcggtaaat VC1599-f taggaattcaggagctaaggaagctaaaatggatgctaggttatttga VC1599-r ataggatcctcacacgttctcggtttgtt VC2224-f taggaattcaggagctaaggaagctaaaatggtatatggattacgttt VC2224-r ataggatcctcacaagccaacgaccttat VC2285-f taggaattcaggagctaaggaagctaaaatgaatttaaataactttag VC2285-r ataggatccttagacaaaatttcgcacaa VC2454-f taggaattcaggagctaaggaagctaaaatgactgatcaaacgcgaac VC2454-r ataggatccctatctgaactgatcctgct VC2697-f taggaattcaggagctaaggaagctaaaatggtgaatcgtgccgattc VC2697-r ataggatccttaccgatcagcaatcaccc VCA0049-f taggaattcaggagctaaggaagctaaagtgacgccatcggattggct VCA0049-r ataccatggctactcaacacacacttggt NcoI Cut vector with NcoI VCA0074-f tagcaattgaggagctaaggaagctaaaatgaatacacaaactcagaa MfeI VCA0074-r ataggatcctcacgatgaggggctttttt VCA0165-f taggaattcaggagctaaggaagctaaaatgtttcctcgaaccctact VCA0165-r ataggatccctacatttctgcctgtatgc VCA0217-f taggaattcaggagctaaggaagctaaaatgacgatgacaaaatcgac VCA0217-r ataggatcctcagcgatgaccatgagttg VCA0557-f tagcaattgaggagctaaggaagctaaagtgacttacaaaggatatga MfeI VCA0557-r ataggatccttatgaccaggtacgaaaga VCA0560-f taggaattcaggagctaaggaagctaaaatgtcttctagctttgttac VCA0560-r ataggatccttagctagcgactttgacac VCA0697-f tagcaattgaggagctaaggaagctaaattgattcgttctatagtatg MfeI VCA0697-r ataggatcctcacgcaaagtgatgcattt VCA0785-f taggaattcaggagctaaggaagctaaaatggcaccgatcctttcac VCA0785-r ataggatccttacgccagagcgtggcttt VCA0848-f taggaattcaggagctaaggaagctaaaatgaatgacaaagtgcttga VCA0848-r ataggatccttagaaaagttcaacgtcat VCA0939-f taggaattcaggagctaaggaagctaaaatgaaaaattggctgtgtca VCA0939-r ataggatccttattctgtggattggcgat VCA0956-f taggaattcaggagctaaggaagctaaagtgatgacaactgaagattt VCA0956-r ataggatccttagagcggcatgactcgat VCA0960-f tagcaattgaggagctaaggaagctaaaatggggttaacctcgcacaa VCA0960-r ataggatcctcaaaagcgatagagtgggt VCA0965-f taggaattcaggagctaaggaagctaaaatggatcgaatttggatgga VCA0965-r ataggatccttagtgcgcttttttcagtg VCA1082-f tagcctaggaggagctaaggaagctaaaatgacgctatacaaacaact AvrII Cut vector with AvrII VCA1082-r ataggatcctcagctcaggattggatttc VC0072-f taggaattcaggagctaaggaagctaaattggagtctgacttgagccg VC0072-r ataagatctctacgctttctctttgagtt BglII 5of6

6 Table S1. Cont. Primer name Sequence Insert Vector VC0130-f taggaattcaggagctaaggaagctaaaatgtttacggtctcgcgtct VC0130-r ataggatccttaacccaagcgtgaaggtc VC0398-f taggaattcaggagctaaggaagctaaagtggcacaaatgaggtatac VC0398-r ataagatctctatttggttcgccatcgat BglII VC0653-f taggaattcaggagctaaggaagctaaaatgcctgctcaaacctcatc VC0653-r ataggatccttagagggatttgcgatggc VC0658-f taggaattcaggagctaaggaagctaaaatgaccaaatttcgcaagat VC0658-r ataggatccctatttttgtaaactgtttg VC0703-f tagcctaggaggagctaaggaagctaaaatgaagctaaaccatagaat AvrII Cut vector with AvrII VC0703-r ataggatccctaacggcattcactttggc VC1934-f taggaattcaggagctaaggaagctaaattggcagatcagcagtatag VC1934-r ataggatccttactcattaatttgcgtgg VC2750-f tagtctagaaggagctaaggaagctaaagtgagattagagaagggtat XbaI Cut vector with AvrII VC2750-r ataggatccttaactttgcttcatgttaa VCA0080-f tagcaattgaggagctaaggaagctaaaatgaccaagactcaactgat MfeI VCA0080-r ataggatccttaggctacattcgtttctt VC0137-f taggaattcaggagctaaggaagctaaattggttcgatgtttatgggc VC0137-r ataggatccctaaattaatcgattgatgt VC0515-f taggaattcaggagctaaggaagctaaaatggatagtttcatagcaaa VC0515-r ataggatccctatttaacttctttcatta VC1592-f taggaattcaggagctaaggaagctaaaatgaatcacatccaccccta VC1592-r ataggatccctataacgcagacatacgtg VC1652-f tagcctaggaggagctaaggaagctaaaatgaaaataatgatagtaga AvrII Cut vector with AvrII VC1652-r ataggatccctattttaatgttacaaaac VC1851-f taggaattcaggagctaaggaagctaaattgaagtactcgtatgtcgc VC1851-r ataggatccttaggtttgtacaccaagaa VCA0101-f taggaattcaggagctaaggaagctaaaatggctaaggaaaagactgt VCA0101-r ataagatctttatattttgcttgtggcaa BglII VCA0536-f taggaattcaggagctaaggaagctaaaatggcgtgcgtcaaaagtct VCA0536-r ataggatccttagttagcatttgctacct VCA1083-f taggaattcaggagctaaggaagctaaattgggcaaacagcagtggaa VCA1083-r ataggatccttacttatcaacaatgaagc Q-PCR primer apha forward accgggtacgatataaccaaagag apha reverse gatggctggctttccagaag gyra forward ccaacgttcgtgcgaatg gyra reverse acaccaatcagcgagtcttcgt apha probe 6-fam/ttctgctagcattggct/6-tamra gyra probe 6-fam/ttgattgcgctcaacc/6-tamra All ligation used BamHI and EcoRI unless noted otherwise. f, forward; fam, 1-[2-(4-fluorobenzoyl)aminoethyl]-4-(7-methoxynaphthyl) piperazine hydrochloride; r, reverse; tamra, 6-carboxytetramethylrhodamine. 6of6