Two Genetic Loci Produce Distinct Carbohydrate-Rich Structural Components of the Pseudomonas aeruginosa Biofilm Matrix

Transcription

1 JOURNAL OF BACTERIOLOGY, July 2004, p Vol. 186, No /04/$ DOI: /JB Copyright 2004, American Society for Microbiology. All Rights Reserved. Two Genetic Loci Produce Distinct Carbohydrate-Rich Structural Components of the Pseudomonas aeruginosa Biofilm Matrix Lisa Friedman and Roberto Kolter* Department of Microbiology and Molecular Genetics, Harvard Medical School, Boston, Massachusetts Received 18 December 2003/Accepted 9 February 2004 Pseudomonas aeruginosa forms biofilms, which are cellular aggregates encased in an extracellular matrix. Molecular genetics studies of three common autoaggregative phenotypes, namely wrinkled colonies, pellicles, and solid-surface-associated biofilms, led to the identification of two loci, pel and psl, that are involved in the production of carbohydrate-rich components of the biofilm matrix. The pel gene cluster is involved in the production of a glucose-rich matrix material in P. aeruginosa strain PA14 (L. Friedman and R. Kolter, Mol. Microbiol. 51: , 2004). Here we investigate the role of the pel gene cluster in P. aeruginosa strain ZK2870 and identify a second genetic locus, termed psl, involved in the production of a mannose-rich matrix material. The 11 predicted protein products of the psl genes are homologous to proteins involved in carbohydrate processing. P. aeruginosa is thus able to produce two distinct carbohydrate-rich matrix materials. Either carbohydrate-rich matrix component appears to be sufficient for mature biofilm formation, and at least one of them is required for mature biofilm formation in P. aeruginosa strains PA14 and ZK2870. Pseudomonas aeruginosa has been extensively utilized as a model organism for the study of biofilm formation (16, 20). A key feature of mature P. aeruginosa biofilms is the presence of an extracellular matrix that encases the constituent cells. This matrix has been reported to contain a mixture of polymeric substances, including nucleic acids, proteins, and polysaccharides (11, 33 35). Matrix production occurs at a late stage in biofilm development, when cells display a high degree of autoaggregation (6, 27). The ability to autoaggregate leads to several macroscopic phenotypes; among them are the production of pellicles at the air-liquid interface of standing liquid cultures and the production of highly structured colonies on agar plates. Different strains of P. aeruginosa display variability in the abilities to form pellicles under different culture conditions and to show different colony morphologies. This phenotypic diversity most likely results from genetic differences among isolates (6, 11). Thus, we consider it important to perform genetic analyses of multiple strains. We recently identified the pel locus of P. aeruginosa strain PA14 (11). This locus contains seven genes whose products are required for matrix formation and which are therefore critical for the autoaggregative properties of the strain; pel mutants do not form pellicles or mature solid-surface-associated (SSA) biofilms. In addition, while the parent strain gives rise to wrinkled colonies under some growth conditions, the P. aeruginosa PA14 pel mutant colonies are invariably flat and smooth. The predicted protein products of the pel genes share sequence similarity with proteins involved in carbohydrate processing, and pel mutants lack a glucose-rich component of their extracellular matrix. Whether the pel genes are involved in the synthesis of a matrix component in other strains of P. aeruginosa is a question that we address in the present study. * Corresponding author. Mailing address: Department of Microbiology and Molecular Genetics, Harvard Medical School, Boston, MA Phone: (617) Fax: (617) Other strains of P. aeruginosa, such as PAO1, PAK, and 57RP, do not show autoaggregative phenotypes under the conditions in which strain PA14 does (6, 7). Autoaggregative phenotypes such as wrinkled colonies and pellicles can result, however, from spontaneous or transposon-mediated mutations in P. aeruginosa strains PAO1 and 57RP (6, 7, 9). D Argenio et al. showed that the autoaggregative mutant phenotype of P. aeruginosa strain PAO1 can result from mutations in wspf (a CheB-like methylesterase; PA3703), PA2933 (an efflux protein of the major facilitator superfamily), or PA0171 and PA1121 (two genes of unknown function) (6). However, the physical properties of the matrix component(s) that gives rise to wrinkled colonies in those PAO1 mutants remain unknown. Similar mutations in Pseudomonas fluorescens and Salmonella enterica serovar Typhimurium resulted in the identification of a cellulose-like polymer component of the matrix in those species (25, 30, 37). However, there is no evidence to date suggesting that P. aeruginosa produces such cellulose-like polymers. We sought to determine whether the pel genes play a role in the autoaggregative properties of P. aeruginosa strains other than PA14. Surprisingly, this investigation led us to the discovery of a second genetic locus, termed psl, which appears to contribute a mannose-rich component to the matrix of many P. aeruginosa strains, but notably not to strain PA14, which carries a deletion of part of this locus. Through different routes, two other groups have independently identified the psl locus as an important genetic determinant for biofilm matrix formation; their results are presented in accompanying papers (15, 17). MATERIALS AND METHODS Strains and culture conditions. Two strains of P. aeruginosa were used for this study: they are strain PA14, which is a well-characterized clinical isolate (21), and strain ZK2870, a clinical isolate selected from our strain collection because of its robust colony morphology phenotype (originally obtained from Jane Burns, University of Washington, Seattle). Mutant derivatives of these two strains are described below. Bacterial cultures were grown at room temperature (21 to 27 C), 30 C, or 37 C as specified. The media utilized were as follows: T-broth (

2 4458 FRIEDMAN AND KOLTER J. BACTERIOL. TABLE 1. Primers for construction of psl deletion mutants Primer Sequence (5 to 3 ) Gene with deletion PCR step Product Size (bp) LF204 GCTGGAGCCGGTGGGACGCAATAC pslc (PA2233) Round 1 5 primer Round 1 5 1,392 LF205 CTAGCACTAGTAGCGGCAAGTACCTGTGGAACG pslc (PA2233) Round 2 5 primer Round 2 5 1,073 LF206 TACAGGGCACCGGCGGCACGGCTGGCCGGCTCGATGACCTC psic (PA2233) 5 sewing primer Deleted region 579 LF207 GCTTGAACTCGCGCTGGTAGATGA pslc (PA2233) Round 1 3 primer Round 1 3 1,028 LF208 CTAGGAGCTCTGACGCCGACGCCGATGGACTTG pslc (PA2233) Round 2 3 primer Round LF209 GAGGTCATCGAGCCGGCCAGCCGTGCCGCCGGTGCCCTGTA pslc (PA2233) 3 sewing primer Round 2 product 1,995 LF210 GCCCCCGCCAGCGACGAGAAGAA psid (PA2234) Round 1 5 primer Round 1 5 1,039 LF211 CTAGCACTAGTGCGCGGGTCGAGGTCATC psid (PA2234) Round 2 5 primer Round LF212 TTCAGGTAGACGTCGACGCCGGGAATCCGTGCGGGGGTGTTTGC psld (PA2234) 5 sewing primer Deleted region 615 LF213 ATGTTGCTGATCTGGCTCTTGTCC psld (PA2234) Round 1 3 primer Round 1 3 1,423 LF214 CTAGGAGCTCGAGTTCGGCGAGCTGCTTTTCCTG psld (PA2234) Round 2 3 primer Round 2 3 1,268 LF215 GCAACACCCCCGCACGGATTCCCGGCGTCGACGTCTACCTGAA psld (PA2234) 3 sewing primer Round 2 product 2,122 LF222 CGCGCCGAACACCCTGACCACTC pslf (PA2236) Round 1 5 primer Round 1 5 1,014 LF223 CTAGCACTAGTACGTCGACAGCCTGGAGAAATC pslf (PA2236) Round 2 5 primer Round LF224 GGGTAGATGGCGCCGTTGCCCAGGGCGTTGCGGAAATGACTG pslf (PA2236) 5 sewing primer Deleted region 909 LF225 GTCCAGCGCACTCATCAGC pslf (PA2236) Round 1 3 primer Round 1 3 1,123 LF226 CTAGGAGCTCCGTCGGGCATCTCGCTGAA pslf (PA2236) Round 2 3 Round LF227 CAGTCATTTCCGCAACGCCCTGGGCAACGGCGCCATCTACCC pslf (PA2236) 3 sewing primer Round 2 product 1,644 g of Bacto tryptone/liter, 5 g of NaCl/liter), T-broth without NaCl, Luria broth, and Luria broth with 6% sucrose. Antibiotics were added as follows: tetracycline (15 g/ml), nalidixic acid (20 g/ml), and gentamicin (10 g/ml) for Escherichia coli and tetracycline (150 g/ml) and gentamicin (60 g/ml) for P. aeruginosa. Transposon mutagenesis. Transposon mutants were generated with Tn5-B21 Tc r in P. aeruginosa ZK2870 and ZK2870 pel by use of a modification of published protocols (28) as described by O Toole and Kolter (19). The resulting transposon mutants were screened for altered colony morphology on T-broth minus NaCl supplemented with 1% agar, 40 mg of Congo red/liter, and 20 mg of Coomassie brilliant blue/liter. Colonies of cells expressing the mutant phenotype were identified after growth for 21 h at 37 C followed by growth at room temperature for 48 to 96 h. We found that this protocol yielded the most robust colony phenotypes in the shortest amount of time. DNA sequences flanking the transposon mutants were determined by arbitrary PCR (20) followed by a sequence comparison with the Pseudomonas genome (11; Construction of P. aeruginosa ZK2870 pel and psl deletion mutants. The gene deletion strategy of Hoang et al. was used to construct chromosomal deletion mutants in strains PA14 and ZK2870 (13). The DpelA mutant of ZK2870 was obtained by crossing in the DpelA pex18gm plasmid containing 579 bp from the 5 region of the gene and 829 bp from the 3 region of the gene amplified from PA14. The resulting pela deletion contains the first 512 codons fused in frame with the last 194 codons. Overall, the PelA protein, if produced, would be missing 243 amino acids. This was the same plasmid construct used to create the pela deletion in PA14 and is referred to as Dpel in the remainder of this report (11). We generated deletions in 3 of the 11 psl genes: pslc (PA2233), psld (PA2234), and pslf (PA2236). Flanking sequences of the predicted open reading frame of each of these psl genes were amplified by PCR from the ZK2870 chromosomal DNA. The deletion constructs were created by splicing by overlap extension (SOE) PCR, SOEing the 5 and 3 regions of each respective gene together in two rounds of PCR (14). The respective primers for the first and second rounds of PCR are listed in Table 1. The first round of PCR created two products that flanked the gene of interest and the second round of PCR generated a fusion between the 5 - and 3 -flanking regions. The second-round primers were constructed with SacI and SpeI sites. The fusion PCR products were digested with SacI and SpeI and cloned into the pex18gm plasmid, which was digested with SacI and XbaI (13). These constructs were mated into ZK2870 and ZK2870 pel and used to replace the wild-type copy of each psl gene as described previously (8, 13). The constructs were confirmed by PCR amplification of the chromosomal DNA. Pellicle formation assay. Standing cultures containing 6 ml of T-broth were grown at room temperature (20 to 27 C) in 18- by 150-mm Durex borosilicate glass tubes. Pellicles were assayed by visual inspection of the air-liquid interface of the standing culture. Complete coverage of the surface of the culture by an opaque layer of cells and matrix material was considered pellicle formation. Abiotic SSA biofilm formation assay. Bacteria grown overnight on agar plates were resuspended in matching liquid medium and diluted to a final optical density at 600 nm (OD 600 ) of Cultures were transferred to standing culture vessels. Polystyrene 96-well microtiter plates were filled with 150 l of culture/well. The cultures were allowed to stand at room temperature, 30 C, or 37 C for the specified times. The extent of SSA biofilm formation was assayed by staining with crystal violet. For the initiation of the biofilm formation assay, culture vessels were washed by dunking the vessel into a container filled with standing water and gently tapping the wash into a waste container. For the mature biofilm assay, culture vessels were washed vigorously under hot tap water before staining. Samples were stained by the addition of 1% crystal violet solution to each well above the initial inoculation level and allowed to sit for 20 min before being washed. After staining, the vessels were washed with the respective wash condition. The crystal violet stain was measured after the addition of dimethyl sulfoxide to each dry well. The samples then sat for 20 min, after which the OD 590 values were measured on a plate reader. All samples were tested in at least seven independent wells. Genomic sequence analysis. The predicted protein products of psla to -K (PA2231 to PA2241) were analyzed with the PSI BLAST, Blocks, and pfam sequence comparison programs (1). Pairwise alignments were performed with PA2231 to PA2241 against all of the genomes in the Comprehensive Microbial Resource via the TIGR and GenBank databases using PSI-BLAST. Identities between sequences were calculated as the percentages of identical residues in the alignments. PSORT was used to tentatively predict the cellular locations and transmembrane domains of the predicted proteins (10, 18). Congo red assay. T-broth supplemented with Congo red (40 g/ml) and Coomassie brilliant blue (15 g/ml) was used to judge pellicle morphology and color (24). Congo red plates contained 0.5 to 1.5% agar and T-broth without NaCl. Cells were plated by spotting either 1, 5, or 10 l of bacterial culture directly or 100 l of dilutions, resulting in colonies arising from single cells. The plates were grown at room temperature to assess the colony morphology. Pellicle and crude matrix isolation. Standing 1-liter cultures in T-broth in a 2-liter flask were inoculated with plate-grown bacteria to an OD 600 of The cultures were left undisturbed at room temperature for 7 days. A 50-ml pipette was used to gather the pellicle from the top of the culture, removing as little medium as possible ( 5 ml). For whole-pellicle analyses, the pellicle was washed five times with water, followed by centrifugation for 7 min at 13,292 g in a Sorvall SLA-600TC rotor. The bacterial pellicle pellets were lyophilized overnight. For water-washed matrix isolation, the pellicle was washed once with water which was then discarded, followed five more times with 10 ml of water. The fluid from each wash was saved, run through a 0.2- m-pore-size filter, dialyzed against four changes of 2 liters of water, and then lyophilized. For ethanol-precipitated matrix isolation, the pellicle was washed once in sterile distilled H 2 O. Twenty milliliters of 1 M NaOH was added, and the sample was vortexed every 2 min for 15 min. The sample was spun at 200,000 g in an SW41Ti rotor for 1 h at 4 C. The supernatant was removed and filtered through a 0.2- m-pore-size filter. The filtrate was neutralized with concentrated HCl, precipitated by the addition of ethanol to 70%, and placed at 20 C overnight. The precipitate was collected by centrifugation at 13,292 g in a Sorvall SLA- 600TC rotor for 30 min at 4 C. The pellet was washed with 70% ethanol, allowed to dry for 45 min, resuspended in water, and then lyophilized. The lyophilized material was resuspended in water, dialyzed four times against 2 liters of water (each time), and lyophilized before carbohydrate analysis. Carbohydrate composition and linkage analysis. Glycosyl composition analysis was performed by combined gas chromatography/mass spectrometry (GC/

3 VOL. 186, 2004 PSEUDOMONAS AERUGINOSA BIOFILM MATRIX 4459 MS) of the per-o-trimethylsilyl (TMS) derivatives of the monosaccharide methyl glycosides produced from the sample by acidic methanolysis. Methyl glycosides were first prepared from 0.5 mg of dry sample by methanolysis in 1 M HCl in methanol at 80 C for 18 to 22 h, followed by re-n-acetylation with pyridine and acetic anhydride in methanol for the detection of amino sugars. The samples were then per-o-trimethylsilylated by treatment with Tri-Sil (Pierce) at 80 C for 0.5 h. These procedures were performed as previously described (35). GC/MS analysis of the TMS methyl glycosides was performed on an HP 5890 gas chromatograph interfaced with a 5970 MSD instrument using a Supelco EB1 fused silica capillary column. Sample analyses were performed by the Complex Carbohydrate Research Center at the University of Georgia, Athens. Sample analyses were performed in triplicate for the lyophilized pellicle samples. Sample analysis was performed in duplicate for the ethanol-precipitated cell-free crude matrix preparation. Glycosyl linkage analysis was performed as described by Wozniak et al. by the Complex Carbohydrate Research Center at the University of Georgia (35). RESULTS FIG. 1. Autoaggregative properties of P. aeruginosa strain ZK2870. P. aeruginosa strain ZK2870 forms wrinkled colonies (A) under conditions in which P. aeruginosa strain PA14 forms smooth flat colonies (B). The plates contained 1% agar, 10 g of tryptone/liter, 40 mg of Congo red/liter, and 15 mg of Coomassie brilliant blue/liter. Single colonies were grown at room temperature for 8 days. P. aeruginosa ZK2870. Our studies on the genetic bases of biofilm formation in P. aeruginosa have been greatly facilitated by the development of simple phenotypic assays. At first, we analyzed the initiation of biofilm formation on solid surfaces by using crystal violet staining (19). More recently, we exploited the formation of pellicles by P. aeruginosa PA14 to identify the pel genes, whose products appear to be involved in making a glucose-rich component of the biofilm matrix (11). In those studies, we demonstrated that pellicle-defective mutants of PA14 are also defective in the production of SSA biofilms. Most importantly, we noted that the pel mutants displayed gross phenotypic differences in colony morphology: while PA14 colonies grown in 0.5% agar gave rise to highly structured wrinkled colonies, the pel mutant colonies were smooth. The pellicles and wrinkled colonies formed by diverse microbial species are often referred to as macroscopic manifestations of a strain s autoaggregative properties and are known to be correlated with the production of extracellular structures such as fimbriae or exopolysaccharides that facilitate the physical clustering of cells (26, 36). Our findings that the pel mutants of PA14 failed to make pellicles, resulted in flat smooth colonies, and lacked a glucose-rich component of the extracellular matrix thus indicated that these genes are important for the autoaggregative properties of this strain. To study the pel genes in more detail, we wanted to address the question of whether they play a role in the synthesis of the matrixes of other strains of P. aeruginosa. As we began to analyze other P. aeruginosa strains in terms of pellicle-forming ability and colony morphology, we noticed diverse phenotypes. In particular, the commonly utilized strains PAO1 and PAK failed to form pellicles and gave rise to smooth colonies under the conditions in which PA14 formed pellicles and wrinkled colonies. Consistent with our observations, others had previously noted that mutations were required in order to obtained wrinkled colonies with strains PAO1 and 57RP (6, 7). When we analyzed different P. aeruginosa strains (17 clinical isolates and 5 environmental isolates) from our strain collection, we found that the majority (20 of 22) formed pellicles and wrinkled colonies. We decided to perform genetic analyses on one strain, ZK2870, which displayed a particularly robust colony morphology. Initial analyses indicated that there were significant differences between PA14 and ZK2870. ZK2870 formed wrinkled colonies on all media tested, while PA14 wrinkling was conditional. For example, PA14 colonies became smooth at high agar concentrations while ZK2870 colonies remained wrinkled (Fig. 1). Role of pel genes in ZK2870 autoaggregative phenotypes. We previously showed that the pel gene cluster is required for pellicle formation, wrinkled colony morphology, Congo red adsorption by the colonies, and the formation of mature SSA biofilms by strain PA14 (11). To determine if the pel locus was required for the autoaggregative properties of ZK2870, we constructed a pel derivative of ZK2870 (see Materials and Methods). Surprisingly, ZK2870 pel formed pellicles, similar to its parent (Fig. 2A). However, in the presence of Congo red the ZK2870 pellicles were red, while ZK2870 pel pellicles appeared orange (Fig. 2B). The effect of the pel mutation on Congo red binding was also apparent in the colony growth (Fig. 2C). From these observations, we concluded that in ZK2870, the pel genes are involved in the production of a Congo-red-binding component of the biofilm matrix. However, this component is not essential for pellicle formation in strain ZK2870 and is not solely responsible for the wrinkled morphology since ZK2870 pel still displayed some wrinkling. Thus, ZK2870 appeared to produce an additional matrix material that was involved in pellicle formation and colony wrinkling. Genes involved in biofilm matrix production in the absence of pel genes. To determine the genes involved in the production of the putative additional matrix material produced by ZK2870, we carried out two genetic screens, using colony wrinkling as our phenotypic assay. One was performed with ZK2870 under conditions in which PA14 does not produce wrinkled colonies (T-broth in 1% agar) and the other was performed with the ZK2870 pel strain under the same conditions. In both cases, we screened for smooth colony mutants after transposon mutagenesis (see Materials and Methods). For ZK2870, 6 of 6,000 mutants formed smooth colonies. For ZK2870 pel, 11 of 10,000 mutants formed smooth colonies. Arbitrary PCR followed by DNA sequencing allowed us to identify the locations of the transposon insertions. Seven of the 17 transposon insertions occurred in the gene cluster spanning PA2231 to PA2241 (gene numbers are from the PAO1 genome project). For ZK2870, we isolated single insertions in PA2234

4 4460 FRIEDMAN AND KOLTER J. BACTERIOL. FIG. 2. Role of the pel locus in P. aeruginosa strain ZK2870. (A) Wild-type pellicle and pel mutant pellicle in strain ZK2870. (B) Close-up photos of the wild-type pellicle and the pel mutant pellicle after the pellicles were grown in the presence of Congo red (40 mg/liter), removed from the culture, and rinsed in water before being photographed. (C) Colonies derived from single cells grown at 22 C for 6 days on 0.5% agar, 10 g of tryptone/liter, 40 mg of Congo red/liter, and 15 mg of Coomassie brilliant blue/liter. and PA2239, and for ZK2870 pel, we isolated three independent insertions in PA2238 and single insertions in PA2233 and PA2239 (Fig. 3). We focused our work on the analysis of the role of these genes in the autoaggregative properties of ZK2870. The isolation of multiple independent insertions into the same gene cluster is indicative that the insertions are responsible for the observed phenotype. In order to confirm this, we generated in-frame deletions in PA2233 and PA2234 in ZK2870 and PA2234 and PA2236 in ZK2870 pel. In all cases, the mutants gave rise to smooth colonies on high agar concentrations. Thus, we concluded that the mutations in these genes were responsible for the observed phenotypes and deemed that genetic complementation experiments were not necessary. We designate this gene cluster psla to -K (polysaccharide locus) after consultation with the other groups who have independently analyzed these genes (15, 17). We set the 3 limit of the gene cluster at pslk based on our mutational and sequence analyses (see below). Note that the other two reports (15, 17) include an additional four genes in the cluster, psll to -O, based on initial transcriptional analyses. Phenotypic dissection of the contributions of pel and psl genes. By testing the pellicle and colony morphology phenotypes of both single and double pel and psl mutants, we began to define the contribution of each locus to the extracellular matrix (Fig. 4). Since the psl mutants were isolated as smooth colony mutants on high agar concentrations and under conditions in which P. aeruginosa strain PA14 forms smooth colonies, we wanted to determine if the psl gene cluster is required for the wrinkled colony morphology under environmental conditions in which P. aeruginosa strain PA14 forms wrinkled colonies. We analyzed the colony morphologies of wild-type ZK2870, ZK2870 pel, and ZK2870 psl on 0.5% agar. Colonies derived from single cells of ZK2870 psl displayed a clearly different morphology from those derived from ZK2870 and ZK2870 pel (Fig. 4). Therefore, it appears that both the pel and psl loci contribute to the wrinkled colony morphology of P. aeruginosa strain ZK2870 when grown on 0.5% agar. Since both the pel and psl loci appear to be involved in the wrinkled colony morphology of P. aeruginosa strain ZK2870, we wanted to know if each locus alone was sufficient for the production of an extracellular matrix and if this strain produces additional structural components that are sufficient for matrix formation. psl::tn5 mutants in the ZK2870 pel background and two psl pel double mutants were tested for pellicles and colony morphology. The psl pel double mutants formed smooth colonies under all conditions tested (Fig. 4 and data not shown). The double mutants also failed to form pellicles (Fig. 4). The presence of either the psl or pel genes was sufficient for pellicle formation in ZK2870 and the presence of at least one of the two loci was required for pellicle formation in ZK2870. Previously, we showed that the pel locus is required for mature SSA biofilm formation in P. aeruginosa strain PA14 but is not required for the initiation of biofilm formation (11). We were interested in determining whether the pel and psl loci play a role in SSA biofilm formation in ZK2870. To this end, we tested the wild type and the pel, psl, and psl pel mutants by using a crystal violet assay for SSA biofilm formation at both room temperature and 37 C. Our previous studies indicated that depending on the time of incubation and the wash conditions, the crystal violet assay could be used to measure the initiation of biofilm formation and biofilm maturation (11). Gentle washing could detect defects in initiation, while harsh wash conditions measured mature biofilm formation (see Materials and Methods). Figure 5A shows a time course of biofilm formation as assayed by crystal violet staining and gentle washing of standing cultures grown at 37 C. During the first 3 h, the psl and pel single and double mutants initiated biofilm formation in a manner similar to that of their parent, ZK2870. After approximately 4 h, the psl single and psl pel double mutants showed a significant decrease in staining, suggesting a role for the psl locus during SSA biofilm formation. In contrast, the pel single mutant remained indistinguishable from the wild type throughout the course of the experiment. Yet, at time points after 6 h, the double mutant exhibited a more severe biofilm

5 VOL. 186, 2004 PSEUDOMONAS AERUGINOSA BIOFILM MATRIX 4461 FIG. 3. The psl locus. The 11 open reading frames are outlined in black and drawn to scale. The PA numbers and gene names are shown directly below the map. The locations of the transposon insertions in P. aeruginosa strain ZK2870 are indicated with triangles directly above the open reading frames. Open triangles, insertions in the wild-type strain; gray-filled triangles, insertions in the pel mutant background. The gray shading within the open reading frames indicates the genes that are missing from P. aeruginosa strain PA14. The stars indicate the in-frame deletions that we created in both the wild-type (open stars) and pel mutant (gray stars) backgrounds in P. aeruginosa strain ZK2870. defect than the psl single mutant, indicating that the pel locus does play a role at later time points during biofilm maturation. The contribution of both the pel and psl genes to the stability of mature biofilms was made more apparent when biofilm maturation was assayed under harsh wash conditions (Fig. 5B). The psl locus appeared to be sufficient for the production of the mature biofilm. However, the pel locus did contribute to mature SSA biofilm formation, as the psl pel double mutant exhibited a more severe defect than the single psl mutant. The temperature at which the biofilms were grown did not significantly alter the effects of the psl and pel mutations. Figure 5C shows the results of an experiment in which mature biofilm formation was assayed at 22 C after 24 h. Again, both loci were required for SSA biofilm maturation. Interestingly, the mature biofilms of strain ZK2870 were more robust than those formed by PA14, and the PA14 pel single mutant behaved like the ZK2870 double mutant (Fig. 5C). These results suggest that there is a pre-existing defect in psl in strain PA14. The foregoing analyses prompted the following question. If in ZK2870, mutations in both the pel and psl loci are required to disrupt pellicle- and SSA biofilm-forming ability, how was it possible to obtain pellicle-defective mutants in strain PA14 by simply inactivating the pel locus? Comparative genomic analyses offer an answer to this question. Downloaded from on January 31, 2019 by guest FIG. 4. Colony morphology and pellicle formation in P. aeruginosa strain ZK2870. (A) Colonies derived from single cells were grown on 0.5% agar at room temperature on plates containing 10 g of tryptone/liter, 40 mg of Congo red/liter, and 15 mg of Coomassie brilliant blue/liter. The images labeled psl and psl pel show the pslc and psld pel mutants, respectively. (B) Pellicles form in wild-type, pel, and psl standing liquid cultures, but not in the psl pel double mutant culture. The images shown are of psld and psld pel cultures and are similar to those for all other psl and psl pel mutants tested.

6 4462 FRIEDMAN AND KOLTER J. BACTERIOL. FIG. 5. SSA biofilm formation in P. aeruginosa strains ZK2870 and PA14. The crystal violet assay was used to measure SSA biofilm formation at 37 C (A and B) and 22 C (C). (A) The initiation of biofilm formation was assayed by gentle washing of the standing cultures over time. (B and C) Mature biofilm formation was assayed by harsh running water washing of the vessels. Initially, we used PA14 chromosomal DNA as a probe to hybridize against an Affymetrix GeneChip and found that the psla to -D genes of PAO1 were not present in PA14 (Fig. 3). These results have been confirmed now that the sequence of PA14 is nearing completion (GenBank accession no. AABQ to AABQ ). PA14 has a large replacement in the location of the psla to -D genes. Analysis of psl gene sequence. We defined the psl locus to encompass PA2231 to PA2241 based on putative open reading frame predictions and sequence conservation between the P. aeruginosa PAO1 genome (32) and a conserved genomic region in Pseudomonas syringae DC3000 (3). Several other bacteria contain homologs of as many as 9 of these 11 genes, often scattered throughout the genome. However, further analysis will be required to unambiguously define the psl genes. Rocchetta et al. identified the first three genes in the psl locus and referred to them as orf477, orf488, and orf303 (23). A sequence analysis of the 11 predicted psl gene products revealed homologies to predicted protein motifs involved in polysaccharide biosynthesis (Table 2). Therefore, all 11 genes may be involved in polysaccharide biosynthesis. The psl locus encodes three putative transmembrane proteins (10). psla is predicted to contain 6 transmembrane domains, pslj is predicted to contain 11 transmembrane domains, and pslk is predicted to contain 12 transmembrane domains. Carbohydrates produced by pel and psl loci. Since the psl gene sequence suggests the production of an exopolysaccharide, we wanted to analyze the carbohydrate content of ZK2870 and the single and double mutants. We performed carbohydrate analyses on the pellicles of four strains, specifically ZK2870, ZK2870 pel, ZK2870 psl, and ZK2870 psl pel. Pellicles contain large amounts of matrix material, and the ability of both single psl and pel mutants to form pellicles allowed us to compare two samples grown under very similar conditions. Figure 6 presents the results of carbohydrate analyses of the pellicles of the two single mutants. The major difference in carbohydrate content was the dramatic reduction in the amount of mannose in the psl mutant pellicle compared to that in the pel mutant pellicle. These results suggest that mannose is a component of the matrix requiring the presence of the psl gene cluster. In contrast, the pel mutant pellicle had reduced amounts of glucose, consistent with our prior results, which indicated that the pel genes were involved in the production of a glucose-rich component of the PA14 biofilm matrix (11). In order to learn more about the psl-dependent matrix material, we purified the matrix material from the pellicle of ZK2870 pel. We used two crude purification techniques. One involved ethanol precipitation of alkaline-treated cell-free material and was developed for the analysis of the pellicle from strain PA14 (11). The second procedure involved analyzing the water-soluble components of the biofilm matrix after a simple washing of the pellicle with water (see Materials and Methods). The results we obtained from total carbohydrate analyses were consistent with the presence of carbohydrate-rich material. For the alkaline-treated, ethanol-precipitated material, 1 mg of purified matrix material contained the following, on average: g of mannose, g of rhamnose, g of glucose, 7.55 g ofn-acetyl quinovosamine (QuiNAc), 17.9 g ofn-acetylglucosamine (GlcNAc), 2.15 g of 3-deoxy-D-

7 VOL. 186, 2004 PSEUDOMONAS AERUGINOSA BIOFILM MATRIX 4463 TABLE 2. Sequence analysis of psl gene cluster Gene no. Gene name COG/pfam identification and description a PA2231 psla COG2148/pfam02397, sugar transferases orf477 COG1086, predicted nucleoside-diphosphate sugar epimerases; pfam02719, polysaccharide biosynthesis protein PA2232 pslb COG0836/pfam00483, mannose-1-phosphate guanylyltranferase orf488 COG0662/pfam01050, mannose-6-phosphate isomerase PA2233 pslc COG1216, predicted glycosyltransferases orf303 pfam00535, glycos_transf_2, glycosyl transferase; COG1215, glycosyltransferases, probably involved in cell wall biogenesis; COG0463, WcaA, glycosyltransferases involved in cell wall biogenesis PA2234 psld COG1596, Wza, periplasmic protein involved in polysaccharide export; pfam02563, polysaccharide biosynthesis/export protein PA2235 psle COG3206, GumC, uncharacterized protein involved in exopolysaccharide biosynthesis; pfam02706, Wzz, chain length determinant protein PA2236 pslf COG0438/pfam00534, RfaG, glycosyltransferase; PF00534, glycosyltransferase, group 1 family protein PA2237 pslg COG3664, XynB, beta-xylosidase; pfam01229, glyco_ hydro_39, glycosyl hydrolases family 39; PF00150, cellulase (glycosylhydrolase family 5) PA2238 pslh COG0438/pfam00534, RfaG, glycosyltransferase; PF00534, glycosyltransferase, group 1 family protein PA2239 psli COG0438/pfam00534, RfaG, glycosyltransferase; PF00534, glycosyltransferase, group 1 family protein mannosyltransferase, WbkA (Brucella melitensis) PA2240 pslj PF04932, O-antigen polymerase (weak) PA2241 pslk COG0728/pfam03023, MviN, uncharacterized membrane protein, putative virulence factor; PF01943, polysaccharide biosynthesis protein (weak) a COG, clusters of orthologous groups. FIG. 6. Comparison of carbohydrate contents of pel pellicle and psli::tn5 pellicle of P. aeruginosa strain ZK2870. manno-octulosonic acid (Kdo), 6.25 g of ribose, 4.25 gofan unknown amino sugar, and 9.45 g ofn-acetyl fucosamine (FucNAc). For the water-purified sample, 0.5 mg of purified matrix material contained the following, on average: 16.4 gof mannose, 14.2 g of rhamnose, 14.0 g of glucose, 0.4 g of QuiNAc, 0.6 g of GlcNAc, and 0.6 g of Kdo. The watersoluble matrix fraction appeared to contain less lipopolysaccharide and less DNA than the alkaline-treated, ethanol-precipitated sample. These data are in agreement with the crude carbohydrate comparisons between psl and pel mutant pellicles and further support the conclusion that the psl-dependent matrix material is rich in mannose. To perform a linkage analysis, we subjected the alkalinetreated, ethanol-precipitated matrix material to methylation by preparing partially methylated alditol acetate derivatives. The linkage analysis of the purified matrix material revealed 31% 3-linked rhamnopyranosyl residues, 9% 2-linked rhamnopyranosyl residues, and 3% 3,4-linked rhamnopyranosyl residues. Of the glucopyranosyl residues, 3% were terminal linkages, 4% were 4-linked, 8% were 3-linked, 3% were 3,4-linked, 2% were 3,6-linked, and 5% were 6-linked. Of the mannopyranosyl residues, 8% were 3-linked, 11% were 4-linked, and 9% were 2,3-linked. These data suggest that the psl-dependent matrix material contains a mannose-rich carbohydrate material with linkages that are characteristic of a polysaccharide. DISCUSSION Genes required for the production of the P. aeruginosa ZK2870 biofilm matrix. The extracellular matrix functions to provide structure and stability to mature biofilm communities. When the cells are encased in a matrix, they are able to resist environmental stresses such as sheer fluid forces, grazing by predators, and antimicrobials. Studies of many microorganisms, including Salmonella, Escherichia, Pseudomonas, Vibrio, Bacillus, Staphylococcus, and Saccharomyces, have suggested that proteins and carbohydrate-rich polymers provide the structural basis for biofilm formation and are important in all aspects of autoaggregative behavior (2, 5, 12, 22, 26, 29, 36). In an effort to determine the structural components of the mature biofilm in P. aeruginosa, we performed screens for genes required for the production of pellicles, wrinkled colonies, and SSA biofilms in P. aeruginosa PA14 (11). Through those studies, we identified the pel locus and a glucose-rich polymer required for pellicle formation, wrinkled colonies, and SSA biofilms in P. aeruginosa PA14. For this study, we initiated an investigation of the role of the pel genes in another clinical isolate of P. aeruginosa, strain ZK2870. We chose P. aeruginosa strain ZK2870 because of its robust autoaggregative phenotypes under most environmental conditions. In P. aeruginosa strain ZK2870, the pel gene cluster is not required for pellicles, SSA biofilms, or wrinkled colony morphology. To determine the genetic basis of the pel-inde-

8 4464 FRIEDMAN AND KOLTER J. BACTERIOL. pendent matrix component, we screened for mutants that were unable to form wrinkled colonies under conditions in which strain PA14 formed smooth colonies. This led to the discovery of the psl locus, which appears to contribute a mannose-rich component to the biofilm matrix of many P. aeruginosa strains, but notably not to that of PA14, which carries a deletion of part of this locus. What do the psl gene products synthesize? Based on sequence analyses, we defined the psl locus as containing 11 genes, named psla to -K. All 11 predicted gene products have amino acid sequence similarities with proteins known to function in carbohydrate processing. The accompanying reports on the psl genes (15, 17) include four additional genes in the locus, psll to -O, based on a transcriptional analysis, but their gene products do not share sequence homologies with those of any other known genes. Rocchetta et al. had previously identified the first three genes of the psl locus in 1998, referring to them as orf477, orf488, and orf303 (23). They proposed that the genes were involved in the production of a putative surface polysaccharide because of their sequence similarities to genes such as wcaj of E. coli and gumd of Xanthomonas campestris, which are involved in the synthesis of the surface polysaccharides colanic acid and xanthan gum, respectively (4, 31). The homologies of other genes in the locus with carbohydrate processing genes add further support for this hypothesis. Based on the sequence similarities of the first three gene products to enzymes with known substrates, Rocchetta et al. postulated that the putative polysaccharide might consist of D-glucose, D-mannose, and L-rhamnose residues (23). Carbohydrate analyses of the purified psl-dependent matrix material were consistent with this hypothesis. Studies of the pellicle formation and colony morphology of many strains of P. aeruginosa showed a wide range of autoaggregative phenotypes, suggesting that there is genetic variability in the loci controlling these phenotypes (6, 9, 11). Our genetic analyses of biofilm formation in more than one strain of P. aeruginosa have allowed us to identify two genetic loci, psl and pel, that are involved in the production of two distinct carbohydrate-rich biofilm matrix components. In addition, it is now clear that the observed phenotypic variability among strains can be due to the deletion of some of these genes. However, even when a strain harbors both loci, there may still be differences in the way the genes are regulated. This may explain why strains such as PAO1, which contains both the pel and psl loci, fail to express the characteristic autoaggregative phenotypes of other P. aeruginosa strains. We hope to determine the specific regulatory pathways that lead to the different production levels of each of these matrix components in different strains and different environments. In addition, we plan to investigate the contribution of each of these matrix components to the overall biofilm physiology. ACKNOWLEDGMENTS We thank H. Schweizer and J. Burns for strains. We give special thanks to J. Friedman, E. Friedman, and H. Friedman for editorial support. This work was supported by grants NIH GM58213, CFF LORY00V0, and DOE DE-FG02-02ER63445 and the Ellison Medical Foundation grant ID-SS L.F. was the recipient of a Canadian Institutes of Health Research (CIHR) postdoctoral fellowship. The carbohydrate analysis was done by the Complex Carbohydrate Research Center, The University of Georgia, by P. Azadi and coworkers, who are supported in part by the Department of Energy-funded (DE- FG02-93ER-20097) Center for Plant and Microbial Complex Carbohydrates. REFERENCES 1. Altschul, S. F., T. L. Madden, A. A. Schaefer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25: Branda, S. S., J. E. Gonzalez-Pastor, S. Ben-Yehuda, R. Losick, and R. Kolter Fruiting body formation by Bacillus subtilis. Proc. Natl. Acad. Sci. USA 98: Buell, C. R., V. Joardar, M. Lindeberg, J. Selengut, I. T. Paulsen, M. L. Gwinn, R. J. Dodson, R. T. Deboy, A. S. Durkin, J. F. Kolonay, R. Madupu, S. Daugherty, L. Brinkac, M. J. Beanan, D. H. Haft, W. C. Nelson, T. Davidsen, N. Zafar, L. Zhou, J. Liu, Q. Yuan, H. Khouri, N. Fedorova, B. Tran, D. Russell, K. Berry, T. Utterback, S. E. Van Aken, T. V. Feldblyum, M. D Ascenzo, W. L. Deng, A. R. Ramos, J. R. Alfano, S. Cartinhour, A. K. Chatterjee, T. P. Delaney, S. G. Lazarowitz, G. B. Martin, D. J. Schneider, X. Tang, C. L. Bender, O. White, C. M. Fraser, and A. Collmer The complete genome sequence of the Arabidopsis and tomato pathogen Pseudomonas syringae pv. tomato DC3000. Proc. Natl. Acad. Sci. USA 100: Chou, F. L., H. C. Chou, Y. S. Lin, B. Y. Yang, N. T. Lin, S. F. Weng, and Y. H. Tseng The Xanthomonas campestris gumd gene required for synthesis of xanthan gum is involved in normal pigmentation and virulence in causing black rot. Biochem. Biophys. Res. Commun. 233: Danese, P. N., L. A. Pratt, and R. Kolter Exopolysaccharide production is required for development of Escherichia coli K-12 biofilm architecture. J. Bacteriol. 182: D Argenio, D. A., M. W. Calfee, P. B. Rainey, and E. C. Pesci Autolysis and autoaggregation in Pseudomonas aeruginosa colony morphology mutants. J. Bacteriol. 184: Deziel, E., Y. Comeau, and R. Villemur Initiation of biofilm formation by Pseudomonas aeruginosa 57RP correlates with emergence of hyperpiliated and highly adherent phenotypic variants deficient in swimming, swarming, and twitching motilities. J. Bacteriol. 183: Donnenberg, M. S., and J. B. Kaper Construction of an eae deletion mutant of enteropathogenic Escherichia coli by using a positive-selection suicide vector. Infect. Immun. 59: Drenkard, E., and F. M. Ausubel Pseudomonas biofilm formation and antibiotic resistance are linked to phenotypic variation. Nature 416: Engelman, D. M., T. A. Steitz, and A. Goldman Identifying nonpolar transbilayer helices in amino acid sequences of membrane proteins. Annu. Rev. Biophys. Chem. 15: Friedman, L., and R. Kolter Genes involved in matrix formation in Pseudomonas aeruginosa PA14 biofilms. Mol. Microbiol. 51: Gotz, F Staphylococcus and biofilms. Mol. Microbiol. 43: Hoang, T. T., R. R. Karkhoff-Schweizer, A. J. Kutchma, and H. P. Schweizer A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212: Horton, R. M., H. D. Hunt, S. N. Ho, J. K. Pullen, and L. R. Pease Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77: Jackson, K. D., M. Starkey, S. Kremer, M. R. Parsek, and D. J. Wozniak Identification of psl, a locus encoding a potential exopolysaccharide that is essential for Pseudomonas aeruginosa PAO1 biofilm formation. J. Bacteriol. 186: Klausen, M., A. Aaes-Jorgensen, S. Molin, and T. Tolker-Nielsen Involvement of bacterial migration in the development of complex multicellular structures in Pseudomonas aeruginosa biofilms. Mol. Microbiol. 50: Matsukawa, M., and E. P. Greenberg Putative exopolysaccharide synthesis genes influence Pseudomonas aeruginosa biofilm development. J. Bacteriol. 186: Nakai, K., and P. Horton PSORT: a program for detecting sorting signals in proteins and predicting their subcellular localization. Trends Biochem. Sci. 24: O Toole, G. A., and R. Kolter Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol. Microbiol. 30: O Toole, G. A., L. A. Pratt, P. I. Watnick, D. K. Newman, V. B. Weaver, and R. Kolter Genetic approaches to study of biofilms. Methods Enzymol. 310: Rahme, L. G., E. J. Stevens, S. F. Wolfort, J. Shao, R. G. Tompkins, and F. M. Ausubel Common virulence factors for bacterial pathogenicity in plants and animals. Science 268: Reynolds, T. B., and G. R. Fink Baker s yeast, a model for fungal biofilm formation. Science 291: Rocchetta, H. L., J. C. Pacan, and J. S. Lam Synthesis of the A-band

9 VOL. 186, 2004 PSEUDOMONAS AERUGINOSA BIOFILM MATRIX 4465 polysaccharide sugar D-rhamnose requires Rmd and WbpM: identification of multiple AlgA homologues, WbpW and ORF488, in Pseudomonas aeruginosa. Mol. Microbiol. 29: Romling, U., Z. Bian, M. Hammar, W. D. Sierralta, and S. Normark Curli fibers are highly conserved between Salmonella typhimurium and Escherichia coli with respect to operon structure and regulation. J. Bacteriol. 180: Romling, U., M. Rohde, A. Olsen, S. Normark, and J. Reinkoster AgfD, the checkpoint of multicellular and aggregative behaviour in Salmonella typhimurium regulates at least two independent pathways. Mol. Microbiol. 36: Romling, U., W. D. Sierralta, K. Eriksson, and S. Normark Multicellular and aggregative behaviour of Salmonella typhimurium strains is controlled by mutations in the agfd promoter. Mol. Microbiol. 28: Sauer, K., A. K. Camper, G. D. Ehrlich, J. W. Costerton, and D. G. Davies Pseudomonas aeruginosa displays multiple phenotypes during development as a biofilm. J. Bacteriol. 184: Simon, R., J. Quandt, and W. Klipp New derivatives of transposon Tn5 suitable for mobilization of replicons, generation of operon fusions and induction of genes in gram-negative bacteria. Gene 80: Spiers, A. J., J. Bohannon, S. M. Gehrig, and P. B. Rainey Biofilm formation at the air-liquid interface by the Pseudomonas fluorescens SBW25 wrinkly spreader requires an acetylated form of cellulose. Mol. Microbiol. 50: Spiers, A. J., S. G. Kahn, J. Bohannon, M. Travisano, and P. B. Rainey Adaptive divergence in experimental populations of Pseudomonas fluorescens. I. Genetic and phenotypic basis of wrinkly spreader fitness. Genetics 161: Stevenson, G., R. Lan, and P. R. Reeves The colanic acid gene cluster of Salmonella enterica has a complex history. FEMS Microbiol. Lett. 191: Stover, C. K., X. Q. Pham, A. L. Erwin, S. D. Mizoguchi, P. Warrener, M. J. Hickey, F. S. Brinkman, W. O. Hufnagle, D. J. Kowalik, M. Lagrou, R. L. Garber, L. Goltry, E. Tolentino, S. Westbrock-Wadman, Y. Yuan, L. L. Brody, S. N. Coulter, K. R. Folger, A. Kas, K. Larbig, R. Lim, K. Smith, D. Spencer, G. K. Wong, Z. Wu, I. T. Paulsen, J. Reizer, M. H. Saier, R. E. Hancock, S. Lory, and M. V. Olson Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature 406: Sutherland, I. W The biofilm matrix an immobilized but dynamic microbial environment. Trends Microbiol. 9: Whitchurch, C. B., T. Tolker-Nielsen, P. C. Ragas, and J. S. Mattick Extracellular DNA required for bacterial biofilm formation. Science 295: Wozniak, D. J., T. J. Wyckoff, M. Starkey, R. Keyser, P. Azadi, G. A. O Toole, and M. R. Parsek Alginate is not a significant component of the extracellular polysaccharide matrix of PA14 and PAO1 Pseudomonas aeruginosa biofilms. Proc. Natl. Acad. Sci. USA 100: Yildiz, F. H., and G. K. Schoolnik Vibrio cholerae O1 El Tor: identification of a gene cluster required for the rugose colony type, exopolysaccharide production, chlorine resistance, and biofilm formation. Proc. Natl. Acad. Sci. USA 96: Zogaj, X., M. Nimtz, M. Rohde, W. Bokranz, and U. Romling The multicellular morphotypes of Salmonella typhimurium and Escherichia coli produce cellulose as the second component of the extracellular matrix. Mol. Microbiol. 39: Downloaded from on January 31, 2019 by guest