gacgacgaggagaccaccgctttg aggcacattgaaggtctcaaacatg

Transcription

1 Supplementary information Supplementary table 1: primers for cloning and sequencing cloning for E- Ras ggg aat tcc ctt gag ctg ctg ggg aat ggc ttt gcc ggt cta gag tat aaa gga agc ttt gaa tcc Tpbp Oct3/4 cardiac actin α-feto protein pax 6 pl 1 Plap Proliferin catgactcctacaatcttcc tttttgcttgcccttgcccc tgggttgaaatattgggtttattt ctaaaaccaaatatccaaccata gacgacgaggagaccaccgctttg aggcacattgaaggtctcaaacatg catgaagtggatcacacccgcaa gccggagcagtcttcttgcgtgaa gcatgcagaacagtcacagcgga actcccgtttatactgggctattt caattgttgctgctggtgtcaagc cttaatgtcagcagcttttttccc ccatgatctcaccatttttagtac tgtcagggacctgagcgttggtgt ccttctttgattcaaccatgctcc tgtttcagaagagctgaatagtg

2 Supplemental table 2 Numbers of total (dapi +), Nonog (+) and Cdx2 (+) cell numbers in two independent experiments (left column and right column). Analysis of Nanog (+) and Cdx2 (+) ratio for experiment 1 is shown in figure 4F. no treat dapi Nanog Cdx2 no PD dapi Nanog Cdx pd treated with PD

3 Supplemental figure S1 Ras induction and cell fate in embryonic stem cells (A and B) titration of Ras induction in irases cells. Expression of activated Ras was induced by adding various concentrations of doxycyclin to the culture media. Cells were harvested after 24 hours after Ras expression was induced and lysed for protein western blot (A) and quantitative real-time reverse-transcriptase polymerase chain reaction (RT-PCR, B). Ras induction is associated with increase in Cdx2 and Gata6 expression, as well as decrease in Nanog and Oct4 expression. (C and D) correlation of Ras expression and ES cell fates in independent ES cell lines by real-time PCR. (C) V6.5 ES cells expressing H-RasQ61L via a retroviral vector. Cells were plated on gelatinized plate and transfected with a MSCV vector expressing GFP or H-Ras61L-ires-GFP. RNA samples were isolated from cells 48 hours after infection and their cdna were used as templates for quantitative PCR. (D and E) Expression of trophectoderm-associated markers in K-Ras G12V knock-

4 in embryonic stem cells (a gift from Tyler Jacks). Ras and phospho-erk2 expression were elevated in K-Ras G12 V knock in cells as show in (E), and the expression levels of trophectoderm markers (Cdx2, Eomes and Hand1) as well as pluripotent cell markers (Nanog and Oct4) were compared by quantitative PCR (D). Primer sequences are available upon request. Supplemental figure S2 The effect of MapK inhibition on Erk1/2 phosphorylation and expression in the 8- cell stage embryos. 8-cell stage mouse embryos were cultured in vitro starting at the 2-cell stage with (+PD) or without (-PD) the MapK inhibitor PD 98059, and stained with antiphospho-erk1/2 (Cell Signaling technology #9106) and DAPI nuclear stain. Two

5 embryos were selected to show in each experiment. Note the presence of zona pellucida in all four pictures, with strong staining by secondary antibody in some images. Phosphorylated Erk1/2 was observed in both the plasma membrane and the cell nucleus at this developmental stage. Supplemental Figure S3 Blastocyst explant assay for MapK inhibitor treated embryos. After removing the zona pellucida, embryos were plated on gelatinized plates and grown in MEF conditioned medium, with and without MapKinase inhibitor treatment. Medium was refreshed daily. Photos were taken 10 days after plating and the total number of giant cells per blastocyst explant was counted. (A) shows photomicrograph of representative culture morphology. (B) Average total numbers of giant cells from each embryo. Error bars indicate standard deviations; p=7.339e-16, two-tailed Student s test.

6 Supplemental Figure 4 Expression of Ap2γ in response to Ras signaling in ES cells. (A) iras ES cells cultured as indicated for 1, 2, 3 and 4 days. Cell lysates were analyzed by immunoblot to detect protein levels of Ras and Ap2γ (Abcam#AB18116). (B) Total RNA was collected from cell lysates after one and two days with and without Ras induction. Expression of Ap2γ was measured by quantitative PCR on cdna templates.

7 Supplemental note1: differentiation efficiency of irases to ES-TS. To determine the efficiency of this apparent trans-differentiation of ES cells into ES-TS cells, irases cells were diluted into 96-well plates to obtain single cell clones, and cultured in the presence of doxycycline, Fgf4, and heparin. 153 out of 156 wells produced colonies of TS morphology, whereas only 3 of 156 maintained the ES morphology, thus demonstrating that the differentiation was robust and occurred in essentially all cells. Supplemental note 2: outcome of ES-TS chimeric embryos in doxycycline-fed surrogates. In doxycycline fed mice (n=3) fostering chimeric embryos, the conceptuses were found significantly delayed when examined at day We did not continue treatment of foster mothers with doxycycline and did not explore this observation further, but presume that continuous induction of activated Ras was deleterious to embryonic development.