Biol 321 Spring 2013 Quiz 4 25 pts NAME

Transcription

1 Biol 321 Spring 2013 Quiz 4 25 pts NAME 1. (3 pts.) a. What is the name of this compound? BE EXPLICIT deoxyribose 5 b. Number the carbons on this structure: (4 pts.) Circle True or False. If there are two sentences, the first sentence is true and you are to determine if the second sentence is T or F. Indicate false is any part of the statement is false. No credit if no explanation. False The tumor suppressor class of genes (often found mutated in cancer cells) are named for their loss-of-function phenotype. One sentence explanation: These genes are named for their normal function since LoF mutations in this class of genes result in an increased rate of cell proliferation. True Gain-of-function mutations in a gene named survivin are often found in cancers. From this info you can conclude that the wild-type function of this gene would be to promote survival (via inhibiting entry into a programmed cell death pathway). Defend your answer with a one-two sentence explanation Since GoF mutations (which result in increased or accelerated gene activity) prolong survival of cancer lineages, then the wildtype function of the gene must be to promote survival by inhibiting enter into a programmed cell death pathway. 1

2 C 3. (8 pts.) a. (1 pt.) Carefully inspect this diagram. On part b, draw an arrow to the site to which RNA polymerase would bind to initiate mrna synthesis. b. (1 pt.) What is the name of the site described in a?_promoter c. (1 pt.) What is the name of the process described in a? transcription d. (1 pt.) Name the part of the gene indicated by the arrow labeled c. intron e. (2 pt.) Why are some boxes white and some boxes black (or black & white) and what determines the boundary? Use proper terminology here and name the process that is important here. 1-2 sentences max. The black boxes indicate regions of the spliced mrna that are translated while the white boxes indicate untranslated exons or stretches of exons. The boundaries are defined by the translational start (AUG) and stop (UGA in this example) codons. f. (1 pt.) What is a nonsense mutation and why is it labeled truncating? A single base-pair substitution that converts an amino-acid specifying codon to a stop codon produces a nonsense mutation at the protein level. Translation will terminate prematurely at this site resulting in a truncated polypeptide. g. (1 pt.) What is meant by an in-frame indel and why is it labeled non-truncating? An inframe indel is an insertion or deletion of contiguous base-pairs that are a multiple of 3. Since this type of mutation does not shift the translational reading frame, translation termination will occur normally. The polypeptide will be more of less of normal length-- one or a couple amino acids longer or shorter. 2

3 4. ( 10 pts.) Examine the information on pgs 1 & 2 of the INFO/DATA sheet. The pedigree represents a family segregating an X-linked dominant form of polycystic kidney disease. The mutation causing this syndrome in this family is a C à T transition in the PKD2 gene. A partial sequence of this gene is shown below. GAGTGTATCTTCACTCAATTCCGTATCATTTTGGGCGATATCAACTTTGCAGAGATTGAGGAAGCTAATC GAGTTTTGGGACCAATTTATTTCACTACATTTGTGTTCTTTATGTTCTTCATTCTTTTGAATATGTTTTT GGCTATCATCAATGATACTTACTCTGAAGTGAAATCTGACTTGGCACAGCAGAAAGCTGAAATGGAACTC TCAGATCTÌ TATCAGAAAGGGCTACCATAAAGCTTTGGTCAAACTAAAACTGAAAAAAAATACCGTGGA ACATTTCAGAGAGTCTGCGGCAAGGAGGAGGCAAGTTAAACTTTGACGAACTTCGACAAGATCTCAAAGG GAAGGGCCATACTGATGCAGAGATTGAGGCAATATTCACAAAGTACGACCAAGATGGAGACCAAGAACTG ACCGAAÌ CATGAACATCAGCAGATGAGAGACGACTTGGAGAAAGAGAGGGAGGACCTGGATTTGGATCA GTTCTTTACCACGTCCCATGAGCAGCCGAAGTTTCCCTCGAAGCCTGGATGACTCTGAGGAGGATGACGA TGAAGATAGCGGACATAGCTCCAGAAGGAGGGGAAGCATTTCTAGTGGCGTTTCTTACGAAGAGTTTCAA GTCCTGGTGAGACGAGTGGACCGGATGGAGCATTCCATCGGCAGCATAGTGTCCAAGATTGACGCCGTGA Part A (3 pts ALL or NOTHING since one correct and one incorrect primer in a PCR reaction will give you zero amplification). For each individual that you need to genotype you will set up a PCR reaction amplifying the region (201 base pairs) between the Ì s. The PCR product should include all (but not extend beyond) the designated region. List the first five bases of each primer. Your primer sequences must read in the 5 to 3 direction. Primer A: TATCA Primer B: TTCGG Part B (7 pts.) Examine the info on the extra sheet. For each numbered individual match the predicted genotype with the appropriate lane of the gel on the extra sheet. If there is more than one possible genotype, be sure to indicate this. No explanation needed. You will obviously need to use a given lane of the gel more than once. Individual Genotype based on pedigree and X-linkage Define allele symbols here: K + = normal K= diseased I -1 K + K 3 II-1 K + Y 2 II-2 K Y 1 II-4 K + K 3 Lane(s) of gel corresponding To genotype 3

4 Problem (pts) 1-3 ( 7 pts) Score 4 ( 8 pts) 5 (10 pts) Total (25) 4

5 S13 Biol 321 Quiz 4 DATA/INFO Sheet Name? YOU MUST HAND THIS SHEET IN WITH YOUR QUIZ Lane # Normal allele: 5 CTTCGACAAG 3 Taq1 restriction enzyme Recognition sequence Mutant allele: 5 CTTTGACAAG 3 The data below the pedigree represent PCR products treated with the restriction enzyme Taq1 and analyzed by agarose gel electrophoresis. 1