The spa-box for transcriptional activation of subtilin biosynthesis and immunity in Bacillus subtilis

Transcription

1 Blackwell Science, LtdOxford, UKMMIMolecular Microbiology X Blackwell Publishing Ltd, Original ArticleDNA-binding site of the response regulator SpaRT. Stein et al. Molecular Microbiology (2003) 47(6), The spa-box for transcriptional activation of subtilin biosynthesis and immunity in Bacillus subtilis Torsten Stein, Stefan Heinzmann, Peter Kiesau, Bettina Himmel and Karl-Dieter Entian* Institut für Mikrobiologie, Johann Wolfgang Goethe- Universität, Marie-Curie-Str. 9, Frankfurt am Main, Germany. Summary The subtilin gene cluster (spa) of Bacillus subtilis ATCC 6633 is organized in transcriptional units spabtc, spas, spaifeg and spark. Specific binding of the response regulator protein SpaR to spab, spas and spai DNA promoter fragments was shown by means of electromobility shift assays. A repeated pentanucleotide sequence spaced by six nucleotides was identified as SpaR binding motif (spa-box). Saturating mutational analysis of the spa-box by singleand multiple-base-pair substitutions revealed the consensus motif (A/T)TGAT for optimal SpaR binding with the second, third and fifth position being absolutely conservative. Variations in the spacer size between the two pentanucleotide repeats revealed a strong conservation of their relative location. Only DNA with a proximal arrangement of two pentanucleotide repeats showed affinity to SpaR. A 2:1 stoichiometry between SpaR and DNA was obtained by optical biosensor analyses, which corresponds to the binding of two SpaR proteins per spa-box. Introduction Accepted 14 November, *For correspondence. entian@em.uni-frankfurt.de; Tel. (+49) ; Fax (+49) The peptide antibiotic subtilin produced by Bacillus subtilis ATCC 6633 contains a series of unusual structural elements such as intramolecular lanthionine bridges, didehydroalanine and didehydrobutyrine (for review see Entian and de Vos, 1996; Sahl and Bierbaum, 1998; Jack and Jung, 2000; McAuliffe et al., 2001; Diep and Nes, 2002). Subtilin (Gross et al., 1973), a representative of lantibiotics, is ribosomally synthesized as inactive prepeptide and undergoes extensive post-translational modifications (Schnell et al., 1988). The bactericidal activity of lantibiotics is based upon pore formation into the cytoplasm membrane of Gram-positive target organisms (Breukink and de Kruijff, 1999). Specific binding of nisin to the peptidoglycan precursor lipid II (Breukink et al., 1999) coincides with the inhibition of cell wall biosynthesis (Wiedemann et al., 2001). Subtilin biosynthesis in B. subtilis ATCC 6633 is based upon the expression of the spa gene cluster (for summary see Entian and de Vos, 1996), which encompasses the subtilin prepeptide encoding gene spas (Banerjee and Hansen, 1988), spabtc encoding proteins involved in post-translational modification and transport of subtilin (Klein et al., 1992; Gutowski-Eckel et al., 1994), spark encoding a two component regulatory system (Klein et al., 1993), as well as spaifeg involved in immunity against the produced lantibiotic (Klein and Entian, 1994). The subtilin prepeptide physically interacts with a multimeric protein complex consisting of SpaB, SpaC and SpaT (Kiesau et al., 1997) and is matured after proteolytic processing by unspecific B. subtilis serine proteases (Stein and Entian, 2002). Three independent promoters preceding genes spab, spas and spai control the expression of the transcripts spabtc, spas and spaifeg (Stein et al., 2002). Subtilin biosynthesis and subtilin immunity were shown to be under control of the two-component system SpaK/R (histidine kinase/response regulator) and the sigma factor H (Stein et al., 2002). For lantibiotic nisin (Buchman et al., 1988; Kaletta and Entian, 1989; Dodd et al., 1990; Engelke et al., 1992; 1994) a similar autoregulatory regulation mechanism for the biosynthesis (Siegers and Entian, 1995) and immunity (Kuipers et al., 1995; de Ruyter et al., 1996; Stein et al., 2003) has been discussed in the light of a quorum-sensing (Kleerebezem et al., 1997; Kleerebezem and Quadri, 2001). Until now, the binding site for the response regulator protein SpaR was unknown. Here we report on the identification of the SpaR binding site, a pentanucleotide repeat ( spa-box ) spaced by six nucleotides. The spa-box was characterized by saturating mutational analysis and the influence of different spacer sizes on SpaR affinity was investigated. The stoichiometry of DNA-bound SpaR was examined by optical biosensor analyses. Results Functional analyses of promoters spab, spas and spai Expression of the transcriptional units of the subtilin gene cluster spabtc, spas and spaifeg are under control of 2003 Blackwell Publishing Ltd

2 1628 T. Stein et al. promoters P spab, P spas and P spai respectively (Fig. 1A). To identify regulatory elements, spa promoters fragments with different sizes were tested in transcriptional lacz fusions after chromosomal integration into the amye locus of B. subtilis ATCC 6633 (Fig. 1B). Fragments of at least 166 base pairs (bp) of P spab were necessary for efficient transcription. For the spas promoter full activity was obtained for fragments encompassing at least 211 bp. A promoterless lacz gene integrated into the amye locus showed no lacz activities (not shown). The in vivo expression of spa genes is dependent on the response regulator protein SpaR (Stein et al., 2002). Double stranded (ds) DNA fragments derived from spa promoters were analysed for possible SpaR binding by means of electrophoretic mobility shift assays (EMSAs). SpaR was able to interact only with dsdna which contain the repeated pentameric sequence WTGAT (W = A or T) spaced by six base pairs present in all spa promoters (Fig. 1C). Truncation of one repeat or its flanks showed either reduced or no affinity to SpaR. The SpaR binding motif within the spab promoter is localized upstream of the transcriptional start site (-39 to -24). Thus, spab promoter fragments lacking the second pentanucleotide motif showed no affinity to SpaR (Fig. 1C). As indicated in Fig. 1B, a 119 bp fragment of the spab promoter lacked both, the -35 region and the SpaR binding motif and thus, showed no b-galactosidase activity. For the spas promoter the SpaR binding motif was identified downstream of the transcriptional start site (+17 to +32). Only dsdna containing the repeated pentanucleotide motif were able to interact with SpaR (Fig. 1C). The 106 bp spas promoter fragment including the spa-box showed only weak lacz activity (Fig. 1B). This could be caused by absence of the -35 region. No affinity to SpaR was obtained for fragments containing the -10 to -35 region of the spas promoter without the spa-box (Fig. 1C). Also for the spai promoter the SpaR binding site was identified downstream of the transcriptional start site (+9 to +24). As exemplified in Fig. 2A C, only dsdna from spa promoters B, S and I was specifically retarded by SpaR. Control experiments with an E. coli protein extract without SpaR gave no retardation signal (Fig. 2A, lanes 6 10). Furthermore, the SpaR- DNA complex was confirmed by parallel ESMA (Fig. 2A, lanes 11 13) and Western blot analyses (lanes ). Comparison of SpaR affinities to spa promoter DNA Fig. 1. Transcriptional organization of the subtilin gene cluster and functional analysis of spas and spab promoters A. Schematic representation of the subtilin (spa) gene cluster which is organized in transcriptional units spabtc, spas, spaifeg and spark (Stein et al., 2002). B. Promoter fragments of spas and spab were fused to lacz and integrated into B. subtilis ATCC 6633; b-galactosidase activities of stationary grown cells were determined. Numbers indicate the size of the spa promoter DNA (in bp) upstream of the start ATG. The transcriptional start sites are indicated (+1). Grey boxes represent the repeated pentanucleotide motif (WTGAT, W = A/T). In a control strain expressing promoterless lacz less than five Miller units were obtained. C. Schematic representations of double stranded DNA used for electrophoretic mobility shift assays (EMSAs) are given. Numbers indicate base pairs (bp) up- and downstream of the repeated pentanucleotide motif (grey boxes), which is separated by 6 bp. To investigate the affinities of SpaR to the spa promoter, non-radioactive DNA derived from spab, spas and spai promoters were investigated in EMSAs to replace radioactively labelled spai DNA from its SpaR complex (Fig. 3A). The spas promoter fragment showed the strongest affinity to SpaR (lanes 1 5). Signal intensities for the ( 32 P)PspaI38-SpaR complex were slightly less reduced by the non-radioactive spab promoter fragment (lanes 6 10). In contrast, a fourfold excess of the non-radioactive spai promoter DNA was necessary for competition of the radioactive spai DNA (lanes 11 14). These data clearly show that the affinities of SpaR to spa promoters are in the order spas > spab > spai. Remarkably, this order is in

3 DNA-binding site of the response regulator SpaR 1629 Fig. 2. Binding of SpaR to spa promoter DNA. Double-stranded DNA fragments were reconstituted from complementary oligonucleotides derived from spa promoters and radioactively labelled. For each lane 0.09 pmol (4 ng) 32 P- labelled DNA was used. Binding of SpaR was analysed by EMSAs. A. spai promoter. Lanes 1 5: 0, 2, 5, 10 and 20 ng SpaR containing extract of E. coli (see Experimental procedures); lanes 6 10: 2, 5, 10, 20 and 40 ng from an E. coli protein extract without SpaR. Lanes (11-12 ): 20 or 40 ng protein from an E. coli extract without SpaR; lane 13 (13 ) 20 ng SpaR analysed by EMSAs or Western blotting using SpaR antiserum. B and C. spas + spab promoter. Lanes 1 4: 2, 5, 10 and 20 ng SpaR. I: free DNA; II: retarded DNA. Fig. 3. Competition EMSAs. A. Non-radioactive dsdna derived from spa promoters (see Table S1) were investigated to replace the radioactively labelled spai promoter DNA encompassing 38 bp ( 32 P-PspaI38) from its SpaR complex. Each lane contained 0.09 pmol (4 ng) 32 P-labelled DNA derived from the spai promoter (PspaI38) and 10 ng SpaR. Lanes 1 5: 0, 2, 4, 10 and 20 ng non-radioactive spas promoter DNA (PspaS38); lanes 6 10: 0, 2, 4, 10 and 20 ng non-radioactive spab promoter DNA (PspaB38); lanes 11 14: 2, 4, 10 and 20 ng non-radioactive spai promoter DNA (PspaI38). I: free DNA; II: retarded DNA (SpaR-DNA complex). B. Mutational analyses of the spa-box. Non-radioactive dsdna derived from the spas promoter (38 bp, see Table 1 and Fig. 4A) including specific nucleotide substitutions in position 25, 26 and 27 were tested to replace the radioactively labelled spas promoter DNA encompassing 38 bp ([ 32 P]-Pspas38) from its SpaR complex. Each lane contained 0.09 pmol (4 ng) 32 P-labelled spas DNA (PspaS38), 4.5 ng non-radioactive mutagenised spas DNA and 10 ng SpaR. Native, [ 32 P]-Pspas38 without addition of competitor DNA.

4 1630 T. Stein et al. Table 1. Oligonucleotides (38 nt) derived from spa promoters used in EMSAs. spas spab spal c: AAAGGAAAAAAATGATAAAATCTTGATATTTGTCTGTT n: AACAGACAAATATCAAGATTTTATCATTTTTTTCCTTT c: CTGGGTGGATCTTGATATTTTTTTGATTTTTAGAATGT n: ACATTCTAAAAATCAAAAAAATATCAAGATCCACCCAG c: GAAATGTTTTTTTGATTAAATTTTGATAAAAGTATTCT n: AGAATACTTTTATCAAAATTTAATCAAAAAAACATTTC Sequences are given in 5-3, the repeated pentanucleotide sequence is given in bold face; c, coding and n, non-coding strand. A series of mutagenised oligonucleotides bearing single or double base pair substitutions were derived from these sequences (for summary see also Fig. 4 and the text). good correlation to the activities of spa promoter lacz fusions expressed in B. subtilis. Here a relationship of approximately 6:4:1 for spas:spab:spai was found (Stein et al., 2002). Mutational analysis of the spa-box We used competition EMSAs to analyse the conservation of the nucleotide positions within the spa-box. Double stranded DNA (38 bp) with single- or multiple-base-pair substitutions within the SpaR binding motif was reconstituted from complementary oligonucleotides (Table 1, Fig. 4A). As exemplified in Fig. 3B, mutagenised spas DNA was tested to replace the radioactively labelled spas fragment from its SpaR complex. Promoter fragments with single-base-pair substitutions within the second, third or fifth position of the repeated pentanucleotide sequence (WTGAT, W = A/T) showed drastic reduced affinity to SpaR (summary of the experiments is given in Fig. 4B and C). In contrast, fragments containing singlebase-pair substitutions within the first or the fourth position were still able to bind SpaR (high competition). The high competition of oligonucleotides with double base substitutions in the first and the third position of the spabox, 12 AÆG/15 AÆG, 12 AÆG/23TÆC and 23TÆC/ 26 AÆG, clearly showed that these positions are less conserved. The effect of a variation of the spacer size between both conserved pentanucleotides on SpaR affinity was investigated. dsdna derived from the spai promoter containing a single nucleotide insertion (+ T between position 19 and 20, Fig. 4A) showed reduced affinity to SpaR. In contrast, dsdna with three additional nucleotides (+ AAT between 22 and 23) no affinity to SpaR was observed. dsdna containing nine additional nucleotides (+ TAAATAAAT between 19 and 20) showed significant affinity to SpaR with a similar level as compared to dsdna with a single nucleotide insertion (not shown). These findings suggested that each pentanucleotide sequence represents a binding site for SpaR. Prerequisite for efficient binding is the abundance of two SpaR binding sites on one face of the DNA (six or 15 nt spacer between the repeats) with the possibility for an interaction of two DNA-bound SpaR proteins. Furthermore, we analysed the effect of base pair substitutions on the in vivo activities of the spai promoter. Mutagenised spai promoters were fused to lacz and Fig. 4. Mutational analyses of the SpaR binding motif. A. The coding sequences of 38 nt oligonucleotides derived from the spas, spab and spai promoters are given in 5-3 direction, the spabox is given in large bold faces. Double stranded oligonucleotides derived from spas (B) and spai (C) promoters containing singlebase substitutions for each position of the pentanucleotide repeat (12 16 and 23 27) were investigated for their interaction with SpaR by means of competition EMSAs. Four grades of competition could be differentiated, they are given as high (0 25% of the native signal), middle (25 50%), low (50 75%) and no (75 100%) competition (means of at least three independent experiments).

5 DNA-binding site of the response regulator SpaR 1631 Fig. 5. Functional analysis of mutagenised SpaR box within the spai promoter. Wild-type and mutagenised spai promoters were fused to lacz and integrated into the chromosome of B. subtilis MO1099. At the transition from linear to stationary growth, quantitative b-galactosidase activities of DSM grown cells were determined (means of at least three independent experiments). Mutagenised spai promoter sequences I, 25GÆT; II, 26 AÆG; III, double substitution 12TÆC and 16TÆC; IV: deletion of nt 15 and 16. All numbers refer to the 38 nt sequence given in Fig. 4A. integrated into the amye locus of B. subtilis MO1099. b- Galactosidase activities driven by the mutagenised promoters was strongly reduced as compared to the native spai promoter (Fig. 5). This reduction was in good correlation to the in vitro binding of SpaR to DNA fragments with corresponding base pair substitutions providing its in vivo significance. interact with SpaR in EMSA. If SpaR incubated with the mutagenised dsdna a much weaker response was obtained (Fig. 6B, curve b). A binding curve for specific interaction of SpaR with spas dsdna was calculated by subtraction of the unspecific curve b from curve a (curve c). SpaR binding to spas promoter dsdna was saturated after 5 min. Thereafter, no further mass increase at the binding surface was obtained. From the response signal (85 arc seconds) 0.14 ng SpaR (26 kda) was calculated to be bound on spas promoter dsdna corresponding to a 1:2 stoichiometry between immobilized spas promoter dsdna (2.5 fmol) and bound SpaR protein (5.4 fmol). In control experiments protein extracts without SpaR were analysed with both, the native and mutagenised spas promoter DNA. In both cases the responses were similar to the unspecific binding curve b in Fig. 6 (not shown). Discussion The production of the B. subtilis lantibiotic subtilin is highly regulated. The subtilin production rate is drastically increased when B. subtilis cells enter the stationary phase Stoichiometry of the SpaR dsdna complex The stoichiometry of the SpaR dsdna complex was determined by optical biosensor analyses (Hall and Winzor, 1999; for review see Hall, 2001). After coupling of streptavidin to a biotin-coated resonant mirror cuvette 5 biotinylated dsdna containing the spas promoter (Fig. 6A) was immobilized on the surface of a streptavidin coated cuvette. A signal of 190 (± 30) arc seconds was obtained corresponding to 0.32 ng (2.5 fmol) immobilized dsdna (128.7 kda). If SpaR was incubated with immobilized dsdna carrying the native spas promoter sequence a time-dependent response was obtained (Fig. 6B), which is characterized by a strong increase within the first five minutes, followed by an approximately linear increase. The latter was indicative for unspecific adsorption of protein to the protein/dna on the mirror surface. To calculate the contribution of the unspecific signal, dsdna carrying a single base substitution (mutation GÆC in the obligate second TGAT repeat) was used. As shown in Fig. 4 such dsdna was not able to Fig. 6. Optical biosensor analysis of SpaR binding to spas promoter DNA. Binding of an analyte to the surface of the resonant mirror cuvette was monitored by refractive index changes in the surface layer (units: arc seconds ). From the manufacturer s calculation a response of 600 arc seconds is equivalent to the binding of 1 ng ligand. A. Schematic representation of a 200 bp encompassing oligonucleotide used for optical biosensor analyses. The distance of the spabox (grey boxes) was 170 bp from the biotinylated 5 -end. B. Binding curve of SpaR protein to (a) biotinylated spas promoter DNA with a native SpaR binding motif and to (b) mutagenised spas promoter DNA. (c) The specific binding curve is obtained after subtraction of curve b from curve a.

6 1632 T. Stein et al. (Klein et al., 1993), where spa gene expression is dual controlled by SpaRK and sigma factor H (Stein et al., 2002). The -10 and -35 regions of the spabtc, spas and spaifeg promoters show homology to sigma factor A recognition sites (Stein et al., 2002). However, the space between both regions, 20 nt for spab and 24 nt for spas as well as spai, are significantly larger as compared to the 17 nt space derived for typical s A promoters (Moran, 1993). Such large spacing and less conserved -35 regions, however, are common for promoters which are dependent on additional activators (Jarmer et al., 2001). A good candidate to act as transcriptional enhancer was the response regulator protein SpaR which is necessary for spabtc, spas and spaifeg expression (Klein et al., 1993; Stein et al., 2002). The results described herein clearly show that the promoters of the transcriptional units spabtc, spas and spaifeg (Fig. 1) share a common regulatory element, a direct repeat (A/T)TGAT spaced by six nucleotides the spa-box which represents the binding site for SpaR. Surprisingly, significant variation of the position of the spa-box in relation to the transcriptional start site of spa promoters was found. The spa-box within the spab promoter is localized upstream of the transcriptional start site (- 39 to -24), a typical position of transcriptional enhancer elements, as for example the phosphate-box for binding of the response regulator protein PhoB, which is involved in activation of nearly 40 genes under phosphate depletion conditions (Makino et al., 1988; Wanner, 1996). In contrast, for promoters spas and spai the spabox was found downstream (+ 17 to +32 and +9 to +24, respectively) of the transcriptional start site. For such unusual location of enhancer elements only a few prokaryotic examples are known. In B. subtilis a transcriptional enhancer was found for the SigL- (homologue of the s 54 subunit of the RNA polymerase; Debarbouille et al., 1991) dependent rocg, which is even able to act at distances as far as 15 kb (Belitsky and Sonenshein, 1999). For the divergently transcribed s 54 -dependent genes flan and flbg of Caulobacter crescentus (Mullin and Newton, 1993), as well as for algd of Pseudomonas aeruginosa (Wozniak, 1994), enhancer-like elements were found downstream of the 5 untranslated region or even within the N-terminal coding region of the regulated genes. For both cases a binding site for the integration host factor (IHF) protein was found, one of the prokaryotic equivalents of histone-like proteins (Drlica and Rouviere-Yaniv, 1987). IHF is involved in many cellular processes (Friedman, 1988), including DNA replication, transposition, gene inversion and gene expression (Goosen and van de Putte, 1995). One role of IHF as enhancer of gene expression is architectural, by facilitating the formation of protein DNA complexes through bending of the DNA. It interacts with up- or downstream enhancer elements, which brings an DNA-bound regulator protein into promoter proximity (Wozniak, 1994). It is tempting to speculate that similar structural changes are provoked after binding of SpaR to the spa-box element. Within the 5 -leader of the spai mrna an inverted repeat with a high potential for secondary structure is positioned between +60 to +93. In this case, it is conceivable, that binding of SpaR in this region might change the mrna structure and thus altering the dissociation rate of mrna from the DNA template. Remarkably, the SpaR binding sites overlap with the open promoter complex of the RNA polymerase/sigma factor complex, which covers approximately 90 base pairs from -70 to +20 (Craig et al., 1995; Rivetti et al., 1999). The observed binding affinities of SpaR to its target sites were spas > spabtc > spai (Fig. 3A) and thus in good correlation with the activity of the corresponding promoters (Stein et al., 2002), demonstrating that the strength of the SpaR DNA complex determines the strength of the respective promoter. This strategy allows B. subtilis to produce the substrate (presubtilin) in much higher quantity than the modifying enzymes (SpaBTC) and the immunity system (SpaIFEG) which are only needed in a limited number per cell. Mutational analyses of the spa-box revealed nucleotides 2, 3 and 5 in both repeats as most conservative. Spa-box nucleotides of the repeats are separated by 10 nucleotides suggesting that each pentanucleotide motif represents a binding site for SpaR. Approximately 10.4 bp are present in one DNA-helix of B-form DNA. Variations in the spacer size between the two pentanucleotide repeats revealed strong conservation of their relative location. The necessity of six or 15 nucleotides encompassing spacer region suggests, that prerequisite for efficient SpaR affinity are two tandemly arranged SpaR binding sites on one face of the DNA (Fig. 7A). DNA containing the pentanucleotides on opposite DNA faces showed no affinity to SpaR. This conclusion fits with a stoichiometry of two SpaR proteins bound per biotinylated ds oligonucleotide obtained from optical biosensor measurements (Fig. 6). SpaR belongs to the large family of response regulator transcription factors with OmpR and PhoB as the most prominent members (for recent reviews see Stock et al., 2000; Hoch and Varughese, 2001; Kenney, 2002). These proteins contain a N-terminal regulatory (receiver) domain and a C-terminal DNA-binding (effector) domain. Regulatory domains with a high conservation grade among each other interact with the cognate sensor kinase, accept the activated phosphoryl-group and regulate the activity of the effector domain. The latter binds specifically to DNA motifs of the target promoter, typically direct repeats, followed by recruitment of the respective sigma factor of the RNA polymerase and trigger the initi-

7 DNA-binding site of the response regulator SpaR 1633 Fig. 7. Analysis of the SpaR DNA complex. A. Schematic representation of two SpaR proteins bound to the spa-box. B. Comparison of the SpaR binding site (spabox) with the PhoB binding site (phosphatebox). W, a or T; Y, C or T. C. DNA binding region of response regulator proteins. SpaR is compared to the closely related protein NisR (L. lactis) and PhoB, a representative of the OmpR response regulator subfamily. The secondary structure elements (a-helices and b-strands) of PhoB are indicated (Blanco et al., 2002), the numbering refers to the E. coli PhoB. Black, identical residues; grey, homologous residues. Residues of PhoB involved in base contacts between PhoB and target DNA are indicated with stars. ation of target gene transcription. Interdomain flexibility is provided by a linker of 5 15 residues between receiver and effector domains. DNA-binding domains of members of the OmpR/PhoB family exhibit characteristic secondary structure elements like the central winged helix-turn-helix (HTH) (a1 turn a2, Fig. 7C) for DNA binding. From the solution structure (Okamura et al., 2000) and in particular from the crystal structure of PhoB-DNA complexes (Blanco et al., 2002) a tandem arrangement of DNA-bound PhoB was derived, in which PhoB binds head to tail to successive direct repeat sequences, coating one face of a smoothly bent DNA double helix. Numerous protein DNA contacts of PhoB provide the high specificity of the interaction between PhoB and the phosphate-box. Amino acid residues involved in these interactions are localized in helices a1, a2 and a3, as well as in the wing between b-folds 6 and 7 (Blanco et al., 2002). Additionally, a series of conserved residues involved in protein-protein contacts stabilize the arrangement of secondary structure elements (contacts between helices a1 and a3) involved in DNA recognition. Because of its high homology to PhoB (36% identity), for SpaR bound to the spa-box a closely related structure is highly probable (Fig. 7A). As indicated in Fig. 7B, the DNA binding sites for PhoB and SpaR show some similarities which might explain the high grade of homology of SpaR and PhoB. The putative DNA binding domain of SpaR was aligned to PhoB (Fig. 7C). Remarkably, a series of residues with contact sites to the DNA in PhoB are also highly conserved in both response regulator proteins, SpaR and the closely related NisR involved in regulation of nisin gene expression (Engelke et al., 1994). On the other hand, particularly within helix a2, no counterpart conserved residues were found in SpaR and NisR suggesting their involvement in interaction with their respective cognate DNA binding site. However, mutational and structural analyses are necessary to verify if those residues of SpaR and NisR are also involved in protein-dna contacts. Experimental procedures Bacterial strains, growth conditions and construction of plasmids Recombinant plasmids were amplified in Escherichia coli RR1. Bacillus subtilis strains ATCC 6633 and MO1099 were grown on Difco sporulation medium and TY medium [0.8% tryptone, 0.5% yeast extract (Difco, Detroit, USA), 0.5% NaCl]. Escherichia coli strains were grown on Luria Bertani medium (Gibco, Neu-Isenburg, Germany). The following concentrations of antibiotics were used: ampicillin (40 mg ml -1 ) and chloramphenicol (20 mg ml -1 ) for E. coli, chloramphenicol (5 mg ml -1 ) and kanamycin (10 mg ml -1 ) for B. subtilis. The SpaR encoding gene was PCR amplified using primers Pkspa5 and after NcoI/BamHI cleavage cloned into the T7 expression vector prset6d (24). The resulting SpaR expression plasmid ppkspa5 was transformed into E. coli BL21 DE3 plyss (25). EcoRI-BamHI fragments of spa promoters were amplified by PCR (primer sequences are listed in the Supplementary material), cloned into pdg268 (Antoniewski et al., 1990) and integrated into the genome of B. subtilis ATCC 6633 (for schematic representation of the constructs see also Fig. 1B). Molecular biology techniques Established protocols were followed for molecular biology techniques (Sambrook et al., 1989). DNA was cleaved according to the conditions recommended by the commercial supplier of the restriction enzymes (Boehringer GmbH, Mannheim, Germany). Plasmid isolation and PCR The alkaline extraction procedure (Birnboim and Doly, 1979) was followed for E. coli plasmid isolation. Polymerase chain reaction was carried out following standard procedures (Sambrook et al., 1989) in a Hybaid combi-thermal-reactor R2, Taq DNA polymerase (Boehringer, Mannheim, Germany) was used. SpaR overproduction and enrichment SpaR protein used for DNA binding assays was prepared as

8 1634 T. Stein et al. follows. E. coli BL21 DE3 plyss host (Studier et al., 1990), carrying spar under control of the T7 promoter (ppkspa5), was grown to an optical density of 0.6 and induced for 6 h with IPTG (0.2 mm). Cells harvested from 500 ml culture were suspended in 1 ml buffer containing 200 mm Tris/HCl (ph 8.0), 400 mm (NH 4 ) 2 SO 4, 10 mm MgCl 2, 1 mm EDTA, 7 mm b-mercaptoethanol, 10% glycerol and subsequently disrupted with glass beads (0.1 mm diameter, four times for 30 s). After centrifugation (5 min, g, 4 C) the supernatant was incubated with an equal volume of saturated (NH 4 ) 2 SO 4 solution. The resulting protein pellet was dissolved in 500 ml buffer B (20 mm Hepes, ph 7.8, 5 mm EDTA, 7 mm b-mercaptoethanol, 1 mm phenylmethylsulphonyl fluoride and 10% glycerol) and dialysed against fresh buffer B. A protein extract used as negative control was taken from E. coli BL21 DE3 plyss without spar. For biosensor analyses SpaR was further enriched using a Superdex 75 pg (Pharmacia, Uppsala, Sweden) column (100 cm length; 2 cm diameter) equilibrated with PBS buffer (10 mm sodium phosphate, 2.7 mm potassium phosphate, 138 mm NaCl, ph 7.5). SDS-gel electrophoresis and Western blot analysis The SDS-PAGE and Western blot analysis were performed as described previously (Kiesau et al., 1997). Molecular weight standards for SDS-gel electrophoresis were obtained from Sigma-Aldrich (Deisenhofen, Germany). b-galactosidase assays Bacillus subtilis strains were grown overnight in DSM medium. Strains carrying the native or mutagenised spai promoter integrated within the amye locus of B. subtilis MO1099 and spark under control of the P spac promoter (Stein et al., 2002) were grown to an OD 600 of 1.0. Samples for quantitative b-galactosidase measurements were taken after 3 h of induction with 2 mm IPTG and treated with standard procedures (Stein et al., 2002). Electromobility shift assay (EMSA) The DNA binding activity of a protein fraction containing enriched SpaR was measured by EMSAs. Double stranded DNA (Table 1 and Supplementary material) were radioactively labelled at their 5 -ends with T4-polynucleotide kinase (NEB) in the presence of [g- 32 P]-dATP. EMSAs were carried out as follows: the reaction volume of 30 ml contained 1 mg of DNA poly(di-dc), mg protein (SpaR or protein extract without SpaR as control), binding-buffer (200 mm Tris/ HCl (ph 8.6), 500 mm NaCl, 50 mm MgCl 2 ) and 6% glycerol. Binding was started with the addition of c.p.m. radiolabelled promoter derived dsdna and was performed at room temperature for 30 min. After adding loading-buffer (10% glycerol, 0.1% bromophenol blue) the samples were separated on a 4% non-denaturing polyacrylamide gel. The gel was fixed (10 min, 10% acetate, 10% methanol), dried (1 h 80 C) and subjected to autoradiography. Additionally, the gel was exposed to a SF-phosphoimager and quantified using the ImageQant software (both Molecular Dynamics). For specific or unspecific competition ng DNA derived from spas- and spai-promoter regions carrying single/double base substitutions was used. Optical biosensor, determination of stoichiometry for SpaR-DNA binding 5 -Biotinylated dsdna (size: 200 bp) was obtained by PCR using primers TH7 and PKi162 (native spas promoter), or TH7 and HZ216 (mutagenised spas promoter). The distance of the spa-box was approximately 170 bp from the 5 -biotinylation. The stoichiometry of SpaR bound to DNA was determined using an IAsys biosensor (Affinity Sensors, Cambridge, UK). To immobilize the biotinylated dsdna on the binding surface saturating amounts of streptavidin were added to a biotin-coated resonant mirror cuvette (surface area = 4 mm 2 ) and incubated for five minutes. After washing with PBS buffer a 5 -biotinylated dsdna (200 bp) was added and incubated until equilibrium was observed (5 min). The cuvette was washed with PBS buffer. In initial experiments it was shown, that neither streptavidin nor DNA could be removed from the cuvette surface by washing under harsh conditions (20 mm HCl) after the respective immobilization step (not shown). Typical binding experiments contained 35 ng SpaR and 200 ng DNA from salmon testis, the binding was followed for at least 10 min. Binding was measured in arc seconds which corresponds to the increase of mass within the optical window at the binding surface. During all measurements the reaction vessel was stirred continuously. Acknowledgements S.H. was supported by a stipendium of the Verband der Chemischen Industrie. We thank Jörg Soppa and Karsten Melcher for discussion and Affinity Sensors for the access to their IASys biosensor. Supplementary material The following material is available from blackwellpublishing.com/products/journals/suppmat/mole/ mole3374/mmi3374sm.htm Table S1. Primers used in this work. References Antoniewski, C., Savelli, B., and Stragier, P. (1990) The spoiij gene, which regulates early developmental steps in Bacillus subtilis, belongs to a class of environmentally responsive genes. J Bacteriol 172: Banerjee, S., and Hansen, J.N. (1988) Structure and expression of a gene encoding the precursor of subtilin, a small protein antibiotic. J Biol Chem 263: Belitsky, B.R., and Sonenshein, A.L. (1999) An enhancer element located downstream of the major glutamate dehydrogenase gene of Bacillus subtilis. Proc Natl Acad Sci USA 96: Birnboim, H.C., and Doly, J. (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res 7:

9 DNA-binding site of the response regulator SpaR 1635 Blanco, A.G., Sola, M., Gomis-Ruth, F.X., and Coll, M. (2002) Tandem DNA recognition by PhoB, a two-component signal transduction transcriptional activator. Structure 10: Breukink, E., and de Kruijff, B. (1999) The lantibiotic nisin, a special case or not? Biochim Biophys Acta 1462: Breukink, E., Wiedemann, I., van Kraaij, C., Kuipers, O.P., Sahl, H., and de Kruijff, B. (1999) Use of the cell wall precursor lipid II by a pore-forming peptide antibiotic. Science 286: Buchman, G.W., Banerjee, S., and Hansen, J.N. (1988) Structure, expression, and evolution of a gene encoding the precursor of nisin, a small protein antibiotic. J Biol Chem 263: Craig, M.L., Suh, W.C., and Record, M.T. Jr (1995) HO. and DNase I probing of E sigma 70 RNA polymerase lambda PR promoter open complexes: Mg 2+ binding and its structural consequences at the transcription start site. Biochemistry 34: Debarbouille, M., Martin-Verstraete, I., Kunst, F., and Rapoport, G. (1991) The Bacillus subtilis sigl gene encodes an equivalent of sigma 54 from gram-negative bacteria. Proc Natl Acad Sci USA 88: Diep, D.B., and Nes, I.F. (2002) Ribosomally synthesized antibacterial peptides in gram positive bacteria. Curr Drug Targets 3: Dodd, H.M., Horn, N., and Gasson, M.J. (1990) Analysis of the genetic determinant for production of the peptide antibiotic nisin. J Gen Microbiol 136: Drlica, K., and Rouviere-Yaniv, J. (1987) Histone-like proteins of bacteria. Microbiol Rev 51: Engelke, G., Gutowski-Eckel, Z., Hammelmann, M., and Entian, K.-D. (1992) Biosynthesis of the lantibiotic nisin: genomic organization and membrane localization of the NisB protein. Appl Environ Microbiol 58: Engelke, G., Gutowski-Eckel, Z., Kiesau, P., Siegers, K., Hammelmann, M., and Entian, K.-D. (1994) Regulation of nisin biosynthesis and immunity in Lactococcus lactis 6F3. Appl Environ Microbiol 60: Entian, K.D., and de Vos, W.M. (1996) Genetics of subtilin and nisin biosyntheses: biosynthesis of lantibiotics. Antonie Van Leeuwenhoek 69: Friedman, D.I. (1988) Integration host factor: a protein for all reasons. Cell 55: Goosen, N., and van de Putte, P. (1995) The regulation of transcription initiation by integration host factor. Mol Microbiol 16: 1 7. Gross, E., Kiltz, H.H., and Nebelin, E. (1973) Subtilin, VI: the structure of subtilin. Hoppe-Seyler Z Physiol Chem 354: Gutowski-Eckel, Z., Klein, C., Siegers, K., Bohm, K., Hammelmann, M., and Entian, K.-D. (1994) Growth phasedependent regulation and membrane localization of SpaB, a protein involved in biosynthesis of the lantibiotic subtilin. Appl Environ Microbiol 60: Hall, D. (2001) Use of optical biosensors for the study of mechanistically concerted surface adsorption processes. Anal Biochem 288: Hall, D.R., and Winzor, D.J. (1999) Reassessment of the calibration constant for the IAsys biosensor. J Chromatogr A 844: Hoch, J.A., and Varughese, K.I. (2001) Keeping signals straight in phosphorelay signal transduction. J Bacteriol 183: Jack, R.W., and Jung, G. (2000) Lantibiotics and microcins: polypeptides with unusual chemical diversity. Curr Opin Chem Biol 4: Jarmer, H., Larsen, T.S., Krogh, A., Saxild, H.H., Brunak, S., and Knudsen, S. (2001) Sigma A recognition sites in the Bacillus subtilis genome. Microbiology 147: Kaletta, C., and Entian, K.D. (1989) Nisin, a peptide antibiotic: cloning and sequencing of the nisa gene and posttranslational processing of its peptide product. J Bacteriol 171: Kenney, L.J. (2002) Structure/function relationships in OmpR and other winged-helix transcription factors. Curr Opin Microbiol 5: Kiesau, P., Eikmanns, U., Gutowski-Eckel, Z., Weber, S., Hammelmann, M., and Entian, K.-D. (1997) Evidence for a multimeric subtilin synthetase complex. J Bacteriol 179: Kleerebezem, M., and Quadri, L.E. (2001) Peptide pheromone-dependent regulation of antimicrobial peptide production in Gram-positive bacteria: a case of multicellular behavior. Peptides 22: Kleerebezem, M., Quadri, L.E., Kuipers, O.P., and de Vos, W.M. (1997) Quorum sensing by peptide pheromones and two-component signal-transduction systems in Gram-positive bacteria. Mol Microbiol 24: Klein, C., and Entian, K.D. (1994) Genes involved in selfprotection against the lantibiotic subtilin produced by Bacillus subtilis ATCC Appl Environ Microbiol 60: Klein, C., Kaletta, C., Schnell, N., and Entian, K.-D. (1992) Analysis of genes involved in biosynthesis of the lantibiotic subtilin. Appl Environ Microbiol 58: Klein, C., Kaletta, C., and Entian, K.-D. (1993) Biosynthesis of the lantibiotic subtilin is regulated by a histidine kinase/ response regulator system. Appl Environ Microbiol 59: Kuipers, O.P., Beerthuyzen, M.M., de Ruyter, P.G., Luesink, E.J., and de Vos, W.M. (1995) Autoregulation of nisin biosynthesis in Lactococcus lactis by signal transduction. J Biol Chem 270: Makino, K., Shinagawa, H., Amemura, M., Kimura, S., Nakata, A., and Ishihama, A. (1988) Regulation of the phosphate regulon of Escherichia coli. Activation of psts transcription by PhoB protein in vitro. J Mol Biol 203: McAuliffe, O., Ross, R.P., and Hill, C. (2001) Lantibiotics: structure, biosynthesis and mode of action. FEMS Microbiol Rev 25: Moran, C.P. (1993) RNA polymerase and transcription factors. In Bacillus subtilis and other Gram-positive bacteria. A.L. Sonenshein, J.A. Hoch, and R. Losick (eds). Washington, D.C.: American Society for Microbiology, pp Mullin, D.A., and Newton, A. (1993) A sigma 54 promoter and downstream sequence elements ftr2 and ftr3 are required for regulated expression of divergent transcription units flan and flbg Caulobacter crescentus. J Bacteriol 175:

10 1636 T. Stein et al. Okamura, H., Hanaoka, S., Nagadoi, A., Makino, K., and Nishimura, Y. (2000) Structural comparison of the PhoB and OmpR DNA-binding/transactivation domains and the arrangement of PhoB molecules on the phosphate box. J Mol Biol 295: Rivetti, C., Guthold, M., and Bustamante, C. (1999) Wrapping of DNA around the E.coli RNA polymerase open promoter complex. EMBO J 18: de Ruyter, P.G.G.A., Kuipers, O.P., Beerthuyzen, M.M., van Alen-Boerrigter, I., and de Vos, W.M. (1996) Functional analysis of promoters in the nisin gene cluster of Lactococcus lactis. J Bacteriol 178: Sahl, H.G., and Bierbaum, G. (1998) Lantibiotics: biosynthesis and biological activities of uniquely modified peptides from gram-positive bacteria. Annu Rev Microbiol 52: Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press. Schnell, N., Entian, K.-D., Schneider, U., Götz, F., Zahner, H., Kellner, R., and Jung, G. (1988) Prepeptide sequence of epidermin, a ribosomally synthesized antibiotic with four sulphide-rings. Nature 333: Siegers, K., and Entian, K.-D. (1995) Genes involved in immunity to the lantibiotic nisin produced by Lactococcus lactis 6F3. Appl Environ Microbiol 61: Stein, T., and Entian, K.-D. (2002) Maturation of the lantibiotic subtilin: matrix-assisted laser desorption/ionization time-offlight mass spectrometry to monitor precursors and their proteolytic processing in crude bacterial cultures. Rapid Commun Mass Spectrom 16: Stein, T., Borchert, S., Kiesau, P., Heinzmann, S., Klöss, S., Klein, C., et al. (2002) Dual control of subtilin biosynthesis and immunity in Bacillus subtilis. Mol Microbiol 44: Stein, T., Heinzmann, S., Solovieva, I., and Entian, K.-D. (2003) Function of Lactococcus lactis nisin immunity genes nisi and nisfeg after coordinated expression in the surrogate host Bacillus subtilis. J Biol Chem 278: Stock, A.M., Robinson, V.L., and Goudreau, P.N. (2000) Twocomponent signal transduction. Annu Rev Biochem 69: Studier, F.W., Rosenberg, A.H., Dunn, J.J., and Dubendorff, J.W. (1990) Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol 185: Wanner, B.L. (1996) Phosphorus assimilation and control of the phosphate regulon. In Escherichia coli and Salmonella typhimurium Cellular and Molecular Biology. F.C. Neidhardt, R.I. Curtiss, J.L. Ingraham, E.C. Lin, K.B.J. Low, B. Magasanik, W., et al. (eds). Washington, D.C.: American Society for Microbiology, pp Wiedemann, I., Breukink, E., van Kraaij, C., Kuipers, O.P., Bierbaum, G., de Kruijff, B., and Sahl, H.G. (2001) Specific binding of nisin to the peptidoglycan precursor lipid II combines pore formation and inhibition of cell wall biosynthesis for potent antibiotic activity. J Biol Chem 276: Wozniak, D.J. (1994) Integration host factor and sequences downstream of the Pseudomonas aeruginosa algd transcription start site are required for expression. J Bacteriol 176: