Transcriptional Regulation (Gene Regulation)

Transcription

1 Experimental Techniques in Biomedical Sciences 의생명과학실험기법 Transcriptional Regulation (Gene Regulation) 4/17/13 Jeong Hoon Kim Department of Health Sciences and Technology, SKKU Graduate School 성균관대학교융합의과학과 & 의학과

2 I. Methods to Study Transcriptional Regulation 1. DNA-protein interactions In vitro assays - Gel shift assays (EMSA: Electro Mobility Shift Assay) - DNA affinity precipitation assays - Protein dot blot assays using DNA probes In vivo assays - Chromatin Immunoprecipitation (ChIP) assays 2. Protein-protein interactions In vitro assays - GST pull-down assays In vivo assays - Coimmunoprecipitation (CoIP) assays - Mammalian two-hybrid assays - Yeast two-hybrid assays - ChIP & ReIP (sequential ChIP) assays 3. Transcriptional activation function - Reporter gene assays - RNAi & gene regulation II. Application of the Techniques

3 Regulation of Gene Expression Transcriptional regulation Flow of Genetic Information DNA RNA Protein Transcription Translation All biological processes Coordinated gene expression Gene products Cellular function Normal physiology Dysregulation of gene expression Diseases (e.g. Cancers) Abnormal physiology

4 Regulation of Transcription Transcriptional regulation in eukaryotic cells is complex!! Important factors for transcriptional regulation 1. Transcription factors 2. Coregulators (= coactivators + corepressors) 4. Chromatin structure 3. Basal transcription machinery

5 Activation Pathway of Transcription Factors Transcription factor: a protein that binds to specific DNA sequences and thereby controls the transcription. AD DBD DBD: DNA binding domain AD: activation domain AD DBD 1. Activation by post-translational modifications or by binding to their ligands 2. Nuclear localization Cytoplasm CoA Nucleus AD DBD AD DBD TFRE TFIID Pol II TFRE RNA 3. Target DNA binding 4. Coactivators & basal transcription machinery recruitment and transcriptional activation

6 Estrogen receptor () pathway (an example model of transcriptional activation) Estrogen Hormone binding H H Dimerization H H Cytoplasm (or Transcription Factor of Interest) H H Nuclear localization H H DNA binding Nucleus E E (estrogen response element): GGTCANNNTGACC MED1 Recruitment of coactivators and basal transcription machinery and histone modification CoCoA AIB1 E p3 GTFs TFIIB TBP RNA Pol II RNA

7 1. Methods to Examine DNA-Protein Interactions In vitro assays - Gel shift assays (EMSA: Electrophoretic Mobility Shift Assay) - DNA affinity precipitation assays - Protein dot blot assays using DNA probes AF-1 AF- 2 AF- 2 AF-1 In vivo assays - Chromatin Immunoprecipitation (ChIP) assays H NR NR H Nucleus HRE DNA-protein interaction on the chromatin

8 1-1. Gel Mobility Shift Assay (Eletrophoretic Mobility Shift Assays, EMSA) Procedure Labeling of a double-stranded oligonucleotides or DNA fragments 5 end labeling with - 32 P ATP or 3 end labeling with Digoxigenin-11-ddUTP (DIG-ddUTP) Example: DNA binding activity of in GSA In vitro translated + DIGlabeled E Non-denaturing PAGE POI Protein of interest (e.g. ): purified or in vitro translated proteins, or nuclear extracts IB w/ anti-dig antibody POI Native (non-denaturing) PAGE & autoradiography or IB Competitor - + P -DNA complex P Unbound DNA probe

9 1-1. Gel Mobility Shift Assay (Eletrophoretic Mobility Shift Assays, EMSA) DNA probes: 2~5 bp Labeling: 5 -end labeling using - 32 P ATP Protein:DNA complexes migrate more slowly than free linear DNA fragments. DNA migration is shifted or retarded when bound to protein. Gel shift or gel retardation assay

10 Biotin-labeled dsdna B 1-2. DNA affinity precipitation assay (DAPA) Avidin-Biotin Complex (ABC) assay + Procedure POI Protein of interest (e.g. ) Example: DNA binding activity of in DNA affinity precipitation assays B POI Incubate Biotin-labeled oligo with a purified protein, in vitro translated protein, or Nuclear extracts Streptavidin-beads MCF-7 NE ( source) + Biotinylated E DNA affinity precipitation w/ Streptavidin BDs SDS PAGE & Immunoblot with anti- antibody E (min) POI IB w/ anti- Wash B Boiling & SDS PAGE Removal of DNA Detect DNA-bound POI by SDS-PAGE & immunoblots DNA affinity precipitation IB w/ anti- Detect DNA-bound

11 1-4. Chromatin Immunoprecipitation (ChIP) - Method to examine in vivo protein-dna interactions in the native chromatin environment. - Providing snapshots of in vivo DNA-protein interaction at a particular time point. NR NR HRE GTFs TFIIB TBP RNA Pol II Chromatin DNA-protein interaction under physiological condition Chromosome Cell

12 General Principle of Chromatin Immunoprecipitation DNA-bound TF in chromatin environment Nucleus Nucleus Endogenous TF TF TFRE Native target promoter Cross-linking w/ formaldehyde TF TFRE Cell lysis & Sonication IP w/ anti-tf Ab TF TFRE Reverse Cross-linking TF TFRE Purification of IPed DNA TFRE PCR to quantify IPed target DNA TFRE

13 Standard ChIP procedure (example: Estrogen receptor ChIP) Q: Is endogenous recruited to its target promoter in a hormone-dependent manner? E GTFs TFIIB TBP RNA Pol II -positive MCF-7 cells ps2 gene TF TFRE Hormone treatment Treat cells (-positive breast cancer cells) with E2 (estradiol) for 45-6 min. E GTFs TFIIB TBP RNA Pol II Hormone-bound s are recruited to its target promoters. Cross-linking Treat cells with formaldehyde to cross-link protein-dna and protein-protein complexes in vivo. (DNA-binding proteins are cross-linked to DNA with formaldehyde in vivo) Preparation of chromatin fraction and sonication Isolate the chromatin and shear chromatin by sonication into small fragments Sonicated chromatin fractions (size of chromatin fragments:.2 ~ 1 kb) E Size does matter!!! - IP efficiency - Resolution

14 Estrogen receptor () pathway (an example model of transcriptional activation) Estrogen Hormone binding H H Dimerization H H Cytoplasm (or Transcription Factor of Interest) H H Nuclear localization H H DNA binding Nucleus E E (estrogen response element): GGTCANNNTGACC MED1 Recruitment of coactivators and basal transcription machinery and histone modification CoCoA AIB1 E p3 GTFs TFIIB TBP RNA Pol II RNA

15 Standard ChIP procedure- continued Anti- antibody + protein A/G-beads E ps2 gene Chromatin IP Immunoprecipitate protein-dna complexes with specific antibodies. Reverse cross-linking and Purification of DNA from immunoprecipitated protein-dna complexes Wash immunoprecipitated complexes and reverse cross-link to release DNA from the complexes. Purify the coimmunoprecipitated DNA fragments. E ps2 promoter Quantitation by PCR (regular PCR or QPCR) PCR to amplify specific DNA sequences to see if they were precipitated with the antibody Quantitative real time PCR (QPCR) Semi-quantitative PCR (regular PCR) % of input recruitment to ps2 promoter E2 (-) E2 (+) recruitment to GREB1 promoter 16 % of input E2 (-) E2 (+) % of input p53 recruitment to p21 promoter Eto (-) Eto (+)

16 Availability of highly specific antibodies for ChIP Validation of antibodies for ChIP Selection of good antibodies 1 % of input E2 (-) E2 (+) H E DBC1 H DBC1 432 DBC1 433 DBC1 434 IgG Antibody (2 ug) Titration of ChIP antibody.6 E2 (-) % of input.4.2 E2 (+) 1 ug 2 ug 4 ug 8 ug antibody 27

17 2. Methods to study protein-protein interactions In vitro assays - GST pull-down assays p16 CoCoA In vivo assays - Coimmunoprecipitation (CoIP) assays - Mammalian two-hybrid assays - Yeast two-hybrid assays AF-1 AF- 2 AF- 2 AF-1 - ChIP & ReIP (Sequential ChIP) assays Protein-protein interaction on the chromatin CoCoA p16 H NR NR H CARM1 Nucleus HRE

18 2-1. Sequential ChIP assays (ChIP & ReIP or ChIP & ReChIP) - Method to examine in vivo protein-protein interactions in the native chromatin environment. interacts with in GST-PD and CoIP assays. Where? H H Q: Does this interaction occur on the target promoters in nucleus? p16/grip1 Nucleus HRE

19 Sequential ChIP procedure Q: Does the interaction occur on the target promoters in nucleus? Example: - complex formation on the target promoter 1st Chromatin IP w/ anti- Wash and elution of IPed chromatins E 1st Chromatin IP w/ anti- E ps2 gene 2nd Chromatin IP w/ anti- Wash and purification of IPed DNA qpcr Sequential ChIP/ MCF-7/ ps2 promoter/ E2 (6 min) Elution of immunoprecipitated complexes and 2nd Chromatin IP w/ anti- % of input E2 (-) E2 (+) E Reverse cross-linking and Purification of DNA 2 nd ChIP 1 st ChIP IgG HRE QPCR and are present in the same complex on ps2 promoter.

20 3. Methods for Functional Studies (Functional Analysis of Trpxn) Reporter gene assays: Applications: promoter structure, gene regulation, and signaling pathways E Luciferase A technique to study regulation of a gene of interest p53 p53 p53re Luciferase RNAi (RNA interference): A technique to study physiological role of your protein of interest in transcriptional regulation

21 Methods to study the function of transcription factors and coregulators in cells 3-1. Reporter Gene Assays - useful method to study the regulation of a gene of interest. - powerful tools for a variety of applications: promoter structure, gene regulation, and signaling pathways Regulatory elements Enhancer or RE Promoter Reporter gene Luciferase Test the transcriptional activity of your TFs and coactivators by transient transfections TF binding sites GTF binding sites Transfection of mammalian cells with reporters and transcription factor expression plasmids + Transfection hr Cell lysis and reporter gene assays using luminometer Reporter Expression vector for TF

22 Luciferase Reporter Vector

23 3-1. Reporter gene assays 1. The reporter and TF-expressing plasmids are transfected in the cells. 2. mrna is transcribed from active promoters once the plasmid in the nucleus. E Luciferase Reporter Expression vector for TF mrnas 3. mrna is translated into active proteins in the cytoplasm. 4. goes into nucleus.

24 3-1. Reporter gene assays E Luciferase 5. binds to its target DNA sequence (E) on the reporter plasmid and activates transcription. LUC Reporter Expression vector for TF LUC LUC LUC LUC mrnas LUC 6. Luciferase (reporter) mrna is transcribed and translated into active luciferase proteins. The amount of luciferase is dependent on the activity of TF or promoter.

25 3-1. Reporter gene assays RGA in CV-1 cells expression vector E--LUC E2 (-) or (+) Relative LUC activity E E2 (-) E2 (+) Luciferase E--LUC (ng) E2 (-) E2 (+) -LUC Luciferase p53 RGA in p53 null H1299 cells p53 p53 p53 p53 p53 expression vector p53re-luc p53re Luciferase Luciferase 15 p53re--luc 15 -LUC p53 (ng) Relative LUC activity Relative LUC activity

26 Methods to study the function of transcription factors and coregulators in cells 3-2. RNAi (RNA interference) and gene function - A technique to study physiological role of your protein of interest in transcriptional regulation - Principle: Double stranded RNA suppresses expression of a target protein by stimulating specific degradation of the target mrna. Complete shut-off of target gene expression Knockdown!! Various methods for introduction of sirnas or shrnas into mammalian cells

27 RNAi (RNA interference) Application of RNAi can be mediated through two types of molecules; The chemically synthesized double-stranded small interfering RNA (sirna) or Vector-based short hairpin RNA (shrna). sirna (small interfering RNA or short interfering RNA) Conventional sirnas: chemically synthesized double-stranded sirnas, 19 nucleotide paired duplex with two nucleotide overhangs at the 3 ends si GGCCUUACCACACAAACUCTT TTCCGGAAUGGUGUGUUUGAG Transient K/D shrna (small hairpin RNA or short hairpin RNA): DNA-based shrna expression sirna is converted into a DNA sequence which codes for the sense strand, a loop, and the antisense strand. sh Sense Loop Antisense Sense 5 -GATCCCGGCCTTACCACACAAACTCTTCAAGAGAGAGTTTGTGTGGTAAGGCCTTTTTGGAAA-3 plko.1 U6 or H1 promoter shrna TTTTT CMV Puromycin transcribed GGCCUUACCACACAAACUC U U UUCCGGAAUGGUGUGUUUGAG A G C A A G A Dicer GGCCUUACCACACAAACUCUU UUCCGGAAUGGUGUGUUUGAG

28 RNAi (RNA interference) GGCCUUACCACACAAACUCUU UUCCGGAAUGGUGUGUUUGAG RISC: RNA-induced silencing Complex, sirna-directed endonuclease RISC denatures sirna duplex and cleaves sense strand of sirna duplex Antisense strand guides RISC to target mrnas. Cellular message is destroyed by RISC.

29 Examples of knockdown using different K/D methods Transient K/D: protein levels are transiently depleted in MCF-7 cells by transfection of sins (non-specific) or si duplexes. sins GAGCAUACGAAACACGAGCUU UUCUCGUAUGCUUUGUGCUCG si GGCCUUACCACACAAACUCUU UUCCGGAAUGGUGUGUUUGAG Transfection MCF-7 cells 72 hr after transfection Cell lysis and immunoblots Transient K/D of

30 Examples of knockdown using different k/d methods Constitutive K/D: protein levels are constitutively depleted in MCF-7 cells by infection with shns or sh lentiviruses. plko.1-sh lentiviral vector U6 promoter sh TTTTT CMV Puromycin pmd.g (encoding G envelope) pcmv 8.91 (encoding gag-pol) plko-sh (encoding sh) Transfection 293T packaging cell line Lentivirus amplification and packaging sh encoding lentiviruses Infection Puromycin selection MCF-7 cells Cell lysis and immunoblots Constitutive K/D of

31 Examples of knockdown using different k/d methods Inducible K/D: protein levels in MCF-7 tts cell clones infected with tet-inducible shns or sh lentiviruses plko.1-to-sh lentiviral vector U6 promoter TO sh TTTTT CMV Puromycin TO: Tet Operator sh encoding lentiviruses Infection Puromycin selection MCF-7 tts cells Cell lysis and immunoblots Tet-inducible K/D of

32 Consideration of undesirable side effects Off-target effects: unintended effects on gene expression mediated by RNAi - Specific off-target effects: mediated by partial sequence complementarity of the RNAi construct to mrnas other than the intended target - Non-specific off-target effects: a wide variety of immune and toxicity related effects that are intrinsic to the RNAi construct itself or its delivery vehicle. Ways to ensure valid RNAi data - Suitable design of the sirna - Use a scramble sirna control. - Titrate sirnas and use at the lowest effective concentration. - Confirm results with multiple independent sirnas to the same target. - Rescue the RNAi effect by expressing an sirna-resistant form of the gene. - Monitor both mrna and protein levels.

33 Validation of RNAi data with multiple independent sirnas to the same target DBC1 E IB sidbc1 sins E2 DBC1 Tubulin qrt-pcr Relative mrna level ps2 E2 (-) E2 (+) sins sidbc1#1 sidbc1# DBC1 E2 (-) E2 (+) sins sidbc1#1 sidbc1#2 RNAi using different sirnas to the same target gene

34 II. Applications of the techniques You identified as a CoCoA and binding protein. CoCoA p16/grip1 : Estrogen receptor, an estrogen-dependent transcription factor CoCoA: an coactivator. E Hypothesis: functions as an coactivator. WIKIPEDIA Definition of coactivator: A coactivator is a protein that increases gene expression by binding to an activator (or transcription factor) which contains a DNA binding domain. The coactivator is unable to bind DNA by itself.

35 Preliminary data - was identified as a CoCoA binding protein. - binds to and CoCoA in protein-protein interaction assays. CoCoA Questions: Is an coactivator? Can enhance function? Is required for activity? Hypothesis: is an coactivator that enhances -mediated transcription by binding to and being recruited to target promoters. Reporter gene assays is required for function (target gene expression and cell proliferation). RNAi + (RGA, qrt-pcr, or MTT assays) Chromatin IP Protein-protein interaction assays

36 How to prove whether or not is an coactivator - Does interact with? - Does interact with CoCoA? Protein-protein interaction assays GST-PD and CoIP - Does enhance activity? - Does cooperate with CoCoA to enhance activity? Reporter gene assays (RGA) Physiologically relevant assays - Is required for activity? - Is recruited to target promoters? - Is required for -positive breast cancer cell growth? RNAi & qrt-pcr Chromatin IP (ChIP) RNAi & MTT assay - Is required for other factors recruitment to target promoters? RNAi & ChIP

37 Q: Does enhance activity? Method: Reporter gene assay (RGA) Reporter: MMTV(E)-LUC, 2E--LUC, or 2E-TK-LUC Expression vectors: (or use endogenous ) Transfection CV-1 ( 2 ng) E2 (-) E2 (+) MCF-7 (endogenous ) E2 (-) E2 (+) MMTV(E) -LUC E E2 treatment Cell lysis and reporter gene assay using luminometer Luciferase Luciferase activity 3 (1 RLU) E2 (-) E2 (+) E2 (-) E2 (+) E2 (-) E2 (+) E2 (-) E2 (+) 2E- -LUC 2E-TK -LUC - - Conclusion: functions as an coactivator in reporter gene assays.

38 Q: Are endogenous coactivators including recruited to native target promoters in a hormone-dependent manner? Method: Chromatin Immunoprecipitation (ChIP) HRE CoCoA p16 HRE GTFs TFIIB TBP RNA Pol II ps2 gene E2 (-) E2 (+) Anti- antibody Anti-CoCoA antibody Chromatin IP Anti- antibody CoCoA p16 CoCoA p16 CoCoA p16 HRE HRE HRE Estrogen response element ( binding site) Estrogen response element ( binding site) Estrogen response element ( binding site)

39 Q: Are endogenous coactivators including recruited to native target promoters in a hormone-dependent manner? Method: Chromatin Immunoprecipitation (ChIP) MCF-7 / E2 45 min / ps2 promoter CoCoA p16 E GTFs TFIIB TBP RNA Pol II ps2 gene Negative region (No binding site) Estrogen response element ( binding site) qpcr qpcr % of input kb upstream region (-493 ~ -469) E2 (-) E2 (+) % of input ps2 promoter (-353 ~ -3) E2 (-) E2 (+) AIB1 CoCoA IgG AIB1 CoCoA IgG Conclusions: coactivators are specifically recruited to the E2-responsive ps2 promoter in a hormone-dependent manner.

40 Q: Are and CoCoA associated with each other in the same complex on the ps2 promoter? CoCoA p16 E GTFs TFIIB TBP RNA Pol II Method: ChIP and ReIP (sequential ChIP) ps2 gene 1st Chromatin IP w/ anti-.16 ChIP E2 (-) CoCoA p16 qpcr % of input E2 (+) E IgG CoCoA p16 E Elution of immunoprecipitated complexes and 2nd Chromatin IP w/ anti-cocoa qpcr % of input Re-ChIP E2 (-) E2 (+) 2 nd ChIP CoCoA IgG 1 st ChIP Conclusion: -CoCoA complexes form on the ps2 promoter.

41 Q: Is required for activity? Loss of function Methods: K/D & RGA si si Cell line: MCF-7 (-positive breast cancer cell) Reporter: 2E-TK-LUC sirna: sins or si E Luciferase Transfection MCF-7/ K/D/ RGA E2 treatment Cell lysis and reporter gene assay using luminometer Relative LUC activity sirna transfection RGA or RNA prep 72 hr 18 hr E2 treatment E sins + ++ si + ++ Actin Conclusions: is required for the transcriptional activity of in RGAs.

42 Q: Is required for activity? Loss of function ps2 Methods: K/D & qrt-pcr Cell line: MCF-7 (-positive breast cancer cell) sirna: sins or si Transfection sirna transfection 18 hr E2 treatment RNA prep 72 hr Relative mrna level E2 treatment.1.5 RNA prep and qrt-pcr si si E sins + si + Mock Tf HRE ps2 gene Conclusions: is required for native target gene expression. ps2 (Reduction %) R 2 = (Reduction %)

43 Q: Is required for estrogen-dependent growth of -positive breast cancer cells? Methods: K/D & cell growth assays Tet-inducible knockdown cell lines Physiological consequence of E2- signaling Cell proliferation IB E2 Dox CCAR 1 MCF-7 tts sh MCF-7 tts shns si Actin si HRE Repressed target gene expressions Inhibition of cell growth?? Cell number (x1 4 ) MCF-7tTS sh 6-4 E2(-), Dox(-) E2(-), Dox(+) E2(+), Dox(-) E2(+), Dox(+) Days MCF-7tTS shns4 E2(-), Dox(-) E2(-), Dox(+) E2(+), Dox(-) E2(+), Dox(+) Days Conclusion: is required for E2-dependent growth of MCF-7 cells.

44 Q: Is required for the optimal recruitment of other coactivators to ps2 promoter? Methods: knockdown and ChIP CoCoA MED1 p3 AIB1 HRE RNA Pol II si depletion si si MED1 CoCoA p3 AIB1 RNA Pol II HRE

45 Q: Is required for the optimal recruitment of other coactivators to ps2 promoter? Methods: knockdown and ChIP CoCoA p3 AIB1 MED1 RNA Pol II HRE.3 AIB1 p3 CoCoA % of input % of input sins si sins si sins si MED1 MED sins sins - + si si - + IB E2 % of input sins si RNA Pol II sins si.2.1 sins si BRM sins si sins si IgG sins si AIB1 CoCoA p3 TRAP22 MED6 PolII BRM Tubulin

46 SUMMARY: Techniques to study transcriptional regulation Protein (TF, transcription factor)-dna (TF response element) interaction TF TFRE In vitro DNA-protein interaction - Gel shift assays - DNA affinity precipitation assays - Dot blot assays In vivo protein-dna interaction in native chromatin environment - Chromatin immunoprecipitation (ChIP) assays TF Nucleus CoA TF TFRE TFRE - DNA-TF interaction - Coactivator recruitment - Post-translational modification of chromatin-associated proteins

47 SUMMARY: Techniques to study transcriptional regulation Protein-protein interaction TF Coactivator In vitro protein-protein interaction - GST pull-down assays Cell TF Coactivator In vivo protein-protein interaction -CoIP - Mammalian two-hybrid assays - Yeast two-hybrid assays Protein-protein interaction on the chromatin - Sequential ChIP Nucleus CoA2 CoA1 TF TFRE

48 SUMMARY: Techniques to study transcriptional regulation Transcriptional activation function Reporter gene assays Overexpression of coactivators TF CoA TF CoA TFRE Luciferase TFRE Luciferase RNAi sicoa CoA sicoa CoA K/D of CoA TF TF TFRE Luciferase TFRE K/D & RGA K/D & qrt-pcr K/D & cell growth assay K/D & ChIP