Supplementary Information

Transcription

1 Supplementary Information

2

3 Supplementary Figure 1: Xenopus model of missense mutations. A mutation equivalent to MCIDAS R381H/G355D was introduced in the Xenopus mcidas (R370H, G355D) by PCR, sequenced and cloned into the CS2 MT vector. We first determined whether the R370H and G355D mutation affected mcidas stability by injecting equivalent amounts of RNA (0.15ng) encoding myc-tagged wildtype and mcidas R370H/G355D into embryos at the two cell stage, and preparing protein lysates at stage 13 from animal caps isolated at stage 10. Lysates were separated by SDS-PAGE on a 10% gel, transferred to a nylon membrane, and probed with a mouse monoclonal against the myc-epitope (Sigma 9E10) and to beta-actin as a loading control Antibody staining was detected and quantitated using Li-Cor Odyssey scanning. Essentially equivalent amounts of wildtype and mutant mcidas protein were detected (e/j).we next examined the activity of the mcidas R370H/G355D mutant in a gain-of-function experiment. 2-4 cell stage Xenopus embryos were injected with RNA encoding wildtype or mcidas R370H/G355D, along with RNA encoding membrane-rfp (red) or chibby-gfp (green) to label cell boundaries and basal bodies, respectively. Embryos were fixed at stage 28 and stained for cilia using an acetylated tubulin antibody (blue) (a-c/f-h). As shown previously, MT-mcidas readily induced the formation of ectopic multiciliate cells (b/g). However, mcidas R370H or G355D injected embryos did not induce ectopic multiciliate cells, but caused a reduction in cell number (d/i) and an increase in cell size (d/i), a phenotype essentially the same as we saw previously, when embryos express a form of mcidas lacking the conserved C-terminal TIRT domain, mcidasδ Scale bar= 10 microns in a-c/f-h. Data in panel d/i were obtained from 12 fields (126 microns 2 ) from 6 embryos. Percentage of cells that are multiciliated per field is not significantly different between control and mcidas R370H or G355D expressing embryos (p=0.8) but differs significantly between control and mcidas expressing embryo (p<0.01). Cell size in mcidas mutant expressing embryos both differ significantly from control (p<0.01). P-values were generated by two-tailed t-test. Error bars, standard deviation.

4 Supplementary Figure 2: Expression of MCIDAS, CCNO and CDC20B during ciliogenensis. (a) Graphical overview. Time-dependent expression of MCIDAS (b), CCNO (c) and CDC20B (d). PCR was performed on cdna from 3 control patients and at different time points during ciliogenesis. Time points included during PCR are 1) one week after start of the monolayer culture, 2) 14 days after start of the monolayer, 3) 21 days after start of the monolayer, or just before the cells were brought into suspension, 4) 3 days after start of suspension culture, 5) 7 days after start of suspension culture, 6) 10 days after start of suspension culture, 7) 14 days after start of suspension culture, 8) 21 days after start of suspension culture or at the end of suspension culture when the cilia were clearly visible and mature. Ciliogenesis starts between 4-6 days after start of suspension culture 11. Expression of the 3 genes was weak during the monolayer phase, and increased dramatically after start of the ciliogenesis, when de novo growth of cilia is induced. (e) MCIDAS (350 bp), CCNO (200bp), CDC20b (330bp) corresponds to timepoint 6 of (b), (c), (d). PPIA, beta2m (endogenous housekeeping genes). Error bars are +/-1 standard deviation.

5 Supplementary Table 1: Summary of exome sequencing and filtering process of mutations. Total number of reads (100%) Mapped reads to hg (98.2%) Mapped reads in captured Target Region (53.3%) (SeqCap EZ Human Exome Library v3.0) Average read depth in captured Target Region 85.5x Percent of Target Region having read depth of 85,51% at least 5x Percent of Target Region having read depth of 82,73% at least 10x Percent of Target Region having read depth of 74,37% at least 25x Variants in RefSeq genes (a) 8961 Variants in RefSeq genes not found in the 8708 snp137common database (b) Not common nonsynonymous variants and 1867 splice variants in RefSeq genes (b) Not common nonsynonymous variants and 514 splice variants in RefSeq genes and not found in in-house determined exomes (c) Not reported rare nonsynonymous variants and 258 splice variants in RefSeq genes and not found in in-house determined exomes (d) Nonsense mutations (e) 2 NM_ :c[441C>A];[441C>A] NM_ :p.[Cys147*];[Cys147*] NM_024106:c.[855T>A];[=] NM_024106:p.[Cys285*];[=] (a) Filtering for variants located in the coding region and flanking 30 intronic nucleotides of RefSeq genes ( (b) Further filtering for variants that are not common (against the snp137common database; (c) Further filtering against mutations not found in in-house characterized exomes of 12 PCD patients. (d) Further filtering for not reported rare variants (against the snp137 database; (e) Further filtering for nonsense mutations did result in 2 nonsense mutations, one found in heterozygous state and one found in homozygous state.

6 Supplementary Table 2: Overview of clinical details of the affected individuals with MCIDAS mutation. Family Individual Situs RDS Bronchiectasias Pneumonia Sinusitis Otitis nno (ppb) Lungfunction FEV1 FVC Years* (%) (%) OI-116 II1 SS y y y y n OI-116 II2 SS y y y - n OP-34 II1 SS - y y y OP-34 II2 SS y y y y UCL-128 II1 SS y y y y y UCL-128 II2 SS y y y y y BEL-1785 II1 SS y y y y y BEL-1790 II1 SS y y y - y BEL-1790 II3 SS y y y - y * Age when lung function testing has been performed SS: Situs solitus Supplementary Table 3: Primers used for PCR Gene Sequence MCIDAS Forward: 5 -AAGGGAGTGCAGGGTGTG-3 (5 UTR) Reverse: 5 -CCGAGTAGCGAAGAGCAGTC-3 (exon3) CCNO Forward: 5 -TCTACAGACCTTCCGCGACT-3 (exon1) Reverse: 5 -TCCAGAGTGTTCACCGTCAG-3 (exon2) CDC20B Forward: 5 -GAAAACCAGAGGCAGTCGAG-3 (5 UTR) Reverse: 5 -CCCAAAGGAATCAGAGGACA-3 (exon3) MCIDAS Ex.1/2/3 F caacctctggctggcttc Ex.1/2/3 R gacccgagaggagcttttg Ex 4 F gggggacttaggggtacaag Ex 4 R tcacaccgatcccagataaag Ex 5 F acaccctacacccagagtgg Ex 5 R ccagtcagtccactggttcc Ex 6 F tccccagttcctgatgagac Ex 6 R gttcggagcgtgcaaaag Ex 7 R ggagaggagagtaccgctgag Ex 7 R agtgtttcagggtggcattc