Supporting Information

Transcription

1 Supporting Information Crystal Structure of a Mycoestrogen-Detoxifying Lactonase from Rhinocladiella mackenziei: Molecular Insight into ZHD Substrate Selectivity Yingying Zheng, 1, Wenting Liu, 1,2, Chun-Chi Chen, 1, Xiangying Hu, 1,3 Weidong Liu, 1 Tzu-Ping Ko, 4 Xueke Tang, 1,5 Hongli Wei, 1 Jian-Wen Huang, 1 Rey-Ting Guo 1, * 1 Industrial Enzymes National Engineering Laboratory, Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences, Tianjin , China. 2 College of Biotechnology, Tianjin University of Science and Technology, Tianjin , China. 3 School of Biotechnology, Jiangnan University, Wuxi , China. 4 Institute of Biological Chemistry, Academia Sinica, Taipei 11529, Taiwan. 5 School of Life Sciences, University of Science and Technology of China, Anhui , China. *Correspondence guo_rt@tib.cas.cn (RTG). These authors contributed equally to this work. S1

2 Experimental methods Cloning, mutagenesis, protein expression and purification The gene (Rmzhd) encoding a 266-residue protein from Rhinocladiella mackenziei CBS (NCBI reference sequence: XP_ ) was chemically synthesized and cloned into the vector pet-46 Ek/LIC. The Escherichia coli strain BL21(DE3) were transformed with pet-46 Ek/LIC-Rmzhd and grown in LB media at 37 C to an OD600 of 0.6. The media was then cooled to 16 C and then the expression of the protein was induced for 36 hours by adding 0.2 mm IPTG. The recombinant protein RmZHD with an N-terminal His-tag (MAHHHHHHVDDDDK) was purified via metal-affinity and ion-exchange chromatography by using Ni-NTA and DEAE-Sepharose Fast Flow columns. After dialyzed in a buffer of 25 mm Tris, ph 7.5, 150 mm NaCl, the protein was concentrated to 10 mg/ml by using Amicon Ultra-10k. All mutants were produced by using QuikChange Site-Directed Mutagenesis Kit (Strategene, La Jolla, CA) with the mutagenic oligonucleotides listed in Table S1. When verified by sequencing, the correct plasmids were transformed into E. coli for expression. The purification procedure of mutant proteins follows that of wild type RmZHD. Crystallization, data collection and structure determination The recombinant protein of inactive S105A mutant was first crystallized by using the Crystal Screen Cryo Kit (Hampton Research, Laguna Niguel, CA) and the sitting-drop vapor diffusion method. The reservoir solution (No. 15) containing 0.17 M ammonium sulfate, M sodium cacodylate ph 6.5, 25.5% w/v polyethylene S2

3 glycol 8000 and 15% v/v glycerol. Better crystals were obtained by optimizing the reservoir composition to 0.2 M ammonium sulfate, M sodium cacodylate ph 6.5, 25-28% w/v polyethylene glycol 8000 and 15% v/v glycerol. All crystals were stored at 25 C for 7 days to reach suitable size for X-ray diffraction. The other S105A mutant crystals were obtained under the same conditions. Data collection was carried out at beam line of the National Synchrotron Radiation Research Center, Hsinchu, Taiwan. The S105A/ZEN and S105A/α-ZOL complex crystals were obtained by soaking the S105A crystals in mother liquid containing 10 mm ZEN or α-zol for 7 hours. The diffraction intensities were integrated and scaled by using HKL The RmZHD in apo-form was solved by using the molecular replacement (MR) method with the Phaser program 2, using ZHD101 (PDB code: 3WZL) as a search model. The 2F o F c difference Fourier map showed clear electron densities for most amino acid residues. Further refinements by incorporating water molecules and ligands were carried out by using Coot 3, Phenix 4 and Refmac5 5. The ZEN or α-zol complex structures and S105A/Y160A structures were solved by MR using the refined RmZHD structure as a searching model and refined as described above. Some statistics can be found in Table 1. The program PyMOL ( was used in figure preparation. Measurement of enzyme activity The enzyme activity was determined by monitoring substrate degradation as previously described 6-7. Reaction mixture (210 μl) containing 5 μl substrate (5 mg/ml substrate) and 5 μl enzyme (0.25 mg/ml) in 150 mm NaCl, 25 mm Tris-HCl, ph 7.5 buffer was incubated at 30 C for 10 minutes. The reaction was terminated by adding S3

4 50 μl 1 M HCl and 300 μl methanol. Then the reaction mixture was filtered and 20 μl was analyzed by using a high-performance liquid chromatography system (HPLC; Agilent 1200) equipped with a Welch Ultimate XB-C18 column (4.6 mm X 250 mm, 5 μm; Welch Materials, Inc., Shanghai, China). Samples were eluted with 60% acetonitrile at a flow rate of 0.6 ml/min, and the absorbance was monitored at 254 nm. The amounts of remaining substrate were calculated from the peak areas under the HPLC curves. Isothermal titration calorimetry (ITC) assay All samples of the ITC experiments were prepared in a buffer of 40 mm PBS, ph 7.4, 5% DMSO and freshly degassed right before use. All titrations were performed at 25 C and a stirring speed of 700 rpm, using MicroCal itc200 (GE Healthcare Life Science). The reaction cell was filled with 200 μl protein solution at a concentration of 60 μm (for S105A) or 40 μm (for S105A/Y160A and S105A/Y160G). The titrated α-zol concentration was 500 μm. Raw data were processed and fitted by using the software Origin supplied with the instrument, and a best fit of the data was obtained by using a single set of independent binding model. The background was subtracted using the average data points of the last few sample injections, which approximated saturation. The dilution heat of titrant was also assessed by injecting the ligands into the buffer. In both cases it was relatively small and constant (data not shown). S4

5 References 1. Otwinowski, Z.; Minor, W., Processing of X-ray diffraction data collected in oscillation mode. Methods Enzymol. 1997, 276, McCoy, A. J.; Grosse-Kunstleve, R. W.; Adams, P. D.; Winn, M. D.; Storoni, L. C.; Read, R. J., Phaser crystallographic software. J. Appl. Crystallogr. 2007, 40, Emsley, P.; Cowtan, K., Coot: model-building tools for molecular graphics. Acta Crystallogr. Sect. D: Biol. Crystallogr. 2004, 60, Adams, P. D.; Afonine, P. V.; Bunkoczi, G.; Chen, V. B.; Davis, I. W.; Echols, N.; Headd, J. J.; Hung, L. W.; Kapral, G. J.; Grosse-Kunstleve, R. W.; McCoy, A. J.; Moriarty, N. W.; Oeffner, R.; Read, R. J.; Richardson, D. C.; Richardson, J. S.; Terwilliger, T. C.; Zwart, P. H., PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr. Sect. D: Biol. Crystallogr. 2010, 66, Murshudov, G. N.; Vagin, A. A.; Dodson, E. J., Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr. Sect. D: Biol. Crystallogr. 1997, 53, Xu, Z.; Liu, W.; Chen, C.-C.; Li, Q.; Huang, J.-W.; Ko, T.-P.; Liu, G.; Liu, W.; Peng, W.; Cheng, Y.-S.; Chen, Y.; Jin, J.; Li, H.; Zheng, Y.; Guo, R.-T., Enhanced S5

6 α-zearalenol hydrolyzing activity of a mycoestrogen-detoxifying lactonase by structure-based engineering. ACS Catal. 2016, 6, Hui, R.; Hu, X.; Liu, W.; Liu, W.; Zheng, Y.; Chen, Y.; Guo, R. T.; Jin, J.; Chen, C. C., Characterization and crystal structure of a novel zearalenone hydrolase from Cladophialophora bantiana. Acta Crystallogr., Sect. F: Struct. Biol. Commun. 2017, 73, Sievers, F.; Wilm, A.; Dineen, D.; Gibson, T. J.; Karplus, K.; Li, W.; Lopez, R.; McWilliam, H.; Remmert, M.; Soding, J.; Thompson, J. D.; Higgins, D. G., Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 2011, 7, Gouet, P.; Robert, X.; Courcelle, E., ESPript/ENDscript: Extracting and rendering sequence and 3D information from atomic structures of proteins. Nucleic Acids Res. 2003, 31, S6

7 Supporting Table Mutant S105A N134L N134A Y160G Y160A Y160F Y160W Table S1. The oligonucleotides for site-directed mutagenesis Forward sequence (5 3 ) ATCGCTTCCGTTTGGGGTTGTGCGTCAGGAGCTTCTACCGTTCTG CCACACGAAGTCCCAACCGAACTGCCAGACATTCTGTTGCACATCCAC CCACACGAAGTCCCAACCGAAGCCCCAGACATTCTGTTGCACATCCAC ATGGCAGCTAACTCCAGAGCTGGCTCCGGTAACGTTGAAGCTTGG ATGGCAGCTAACTCCAGAGCTGCGTCCGGTAACGTTGAAGCTTGG ATGGCAGCTAACTCCAGAGCTTTCTCCGGTAACGTTGAAGCTTGG ATGGCAGCTAACTCCAGAGCTTGGTCCGGTAACGTTGAAGCTTGG S7

8 Supporting Figures Figure S1. Hydrolytic activity of ZHD101 and RmZHD. The specific activity of ZHD101 and RmZHD in hydrolyzing ZEN and α-zol was measured. All assays were performed in triplicate and the results are presented as average ± SD. S8

9 Figure S2. Protein sequence alignment of RmZHD and ZHD101. The overall protein sequences of two ZHDs were aligned by Clustal Omega 8. The secondary structural elements of RmZHD are indicated above. The residues consisting of enzyme catalytic triad were indicated by green dots. The most variable part Region between two enzymes are in cyan color. Red background, strictly conserved residues; boxed, conservatively substituted residues. The figure was prepared by ESPript 3 9. S9

10 Figure S3. Electron density maps of ligands in complex structures. The 2F o -F c electron density maps of ligands are contoured at 1.0 σ (grey) and 2.0 σ (orange) levels. The ligands are shown in sticks. S10

11 Figure S4. The β6-α5 loop conformation in ZHD structures. (A) Apo-form (gray color) and ZEN-complex (green color) RmZHD structures are superimposed. The loop conformation change was observed. (B) RmZHD (green color) and ZHD101 (orange color) in complex with ZEN are superimposed. Dash lines indicate the distance of 2.6 Å. S11

12 Figure S5. Substrate-enzyme interaction networks of RmZHD Y160A variant. The stereo view of enzyme-substrate interaction networks in (A) S105A-Y160A/α-ZOL and (B) S105A-Y160A/ZEN were shown. The protein and substrates are shown in cartoon and stick models, respectively. Orange labels, catalytic triad; black labels, residues providing hydrophobic interactions; magenta labels, residues providing hydrophilic interactions. Dash lines indicate distances within 3.5 Å. S12

13 Figure S6. Substrate-enzyme interaction networks of wild type and Y160A RmZHD. (A) Structure superimposition of S105A/ZEN (green) and DM/ZEN (cyan). (B) Structure superimposition of S105A/α-ZOL (green) and DM/α-ZOL (cyan). In both panels, the protein of RmZHD S105A, substrate and active site residues are shown in cartoon, stick and line models. The different residues in the 160 th position are labeled. The potential H-bonds formed between substrates and proteins that are shown in Figures 2 and S5 are omitted here to avoid confusion. S13

14 Figure S7. ITC results of wild type and mutant RmZHD binding to α-zol. S14