AGROBACTERIUM - MEDIATED TRANSFORMATION OF SECONDARY SOMATIC EMBRYOS FROM ROSA HYBRIDA L. AND RECOVERY OF TRANSGENIC PLANTS

Transcription

1 AGROBACTERIUM - MEDIATED TRANSFORMATION OF SECONDARY SOMATIC EMBRYOS FROM ROSA HYBRIDA L. AND RECOVERY OF TRANSGENIC PLANTS A. Borissova, T. Hvarleva, I. Bedzhov, V. Kondakova, A. Atanassov, I. Atanassov AgroBioInstitute, Sofia, Bulgaria ABSTRACT A genetic transformation protocol, based on co-cultivation of Rosa hybrida L. secondary embryos with Agrobacterium was established. Transgenic phosphinothricin (ppt) - resistant plants were obtained through application of interrupted selection procedure. Following the Agrobacterium inoculation step, the somatic embryos were initially cultivated on ppt - free media containing cefatoxim for elimination of the bacteria and later transferred on media containing the selective agent. The ppt - resistant secondary somatic embryos were matured and regenerated on ppt - free media and the putative transgenic plants were subsequently selected on media contained ppt and chlorphenol red. The performed PCR - and PAT protein - assays demonstrated presence and expression of bar gene encoding the phosphinothricin acetyltransferase (PAT) in part of the selected plants. The possibilities for application of the established transformation protocol are discussed. Introduction Contemporary commercial requirements on roses are focused on a change of decorative qualities including color, size, shape, hue, higher yield, longer vase life, as well as biotic and abiotic stress resistance (1). Rose improvement through the classical genetic and breeding is limited because the complex structure of rose genome and difficulties for recovery of the desired phenotype, changed at crossing. Recently established technologies for genetic transformation of Rosa sp. offer an attractive alternative for introducing of genes of interest (2, 3). Both transformation approaches co-cultivation with Agrobacterium (4) and biolistic transformation (5) were successfully applied. In spite of the obtained results, the reported transformation protocols are genotype dependent and confer relatively low transformation efficiency. That s why the development of new transformation procedures based on different genotype and regeneration system, as well as utilization of easy reproducible starting plant material will further enhance the application of gene transfer technology in rose improvement. In the previous studies on rose somatic embryogenesis at AgroBioInsitute, we developed efficient system for reproducible secondary somatic embryogenesis and plant regeneration for two R. hybrida cvs. Anny and Saltze Gold. In this paper we report the development of efficient transformation protocol based on co-cultivation of secondary somatic embryos with Agrobacterium and recovery of the ppt -resistant transgenic plants through interrupted selection scheme. Materials and Methods Plant material The transformation experiments were performed on the two garden rose, R. hybrida Biotechnol. & Biotechnol. Eq. 19/2005/1 70

2 cvs. Anny and Saltze Gold. Secondary somatic embryos at globular stage were used as starting material for co - cultivation with Agrobacterium. The embryos were maintained on MS medium containing 2 mg/l 2,4D, embryo maturation was hold on half straight MS media supplemented with 0.3 mg/l ABA and plantlet development was continued on MS media supplemented with BAP 0.7 and 0.3 mg/l GA3 as described (6). Bacterial strain and plasmid Agrobacterium tumefaciens strain LBA 4404 harboring the plasmid pcambia3301, carrying bar gene driven by the cauliflower mosaic virus (CaMV) 35S promoter, was used for co - cultivation. The bar gene codes the enzyme Phosphinothricin Acetyltransferase (PAT), which catalyzes the conversion of L - phosphinothricin (ppt) into N - acetyl - L - phosphinothricin Thus, the expression of bar gene in transgenic cells, embryos and plants confers ppt resistance and allows their selection through culturing on media containing ppt, (7). Dose curves Secondary somatic embryos and in vitro plantlets were cultivated on media containing different concentrations (1, 2, 3, 4, 6, 8, 10 and 12 mg/l) of the selective agent ppt. The frequency of secondary somatic embryo development and rooting of the transferred plants were determined. Transformation and selection of transgenic embryos and plants An overnight - grown bacterial culture of Agrobacterium was centrifuged for 8 min at 2500 rpm and the pellet was re - suspended in a MSD medium containing half - strength MS medium with full vitamins (8) supplemented with 3% sucrose, 0.5 mg/l folic acid and 2 mg/l 2,4D. Sixty embryogenic groups of cv. Anny and thirty of cv. Saltze Gold were used in each transformation experiments. One embryogenic group contains twenty embryos average. The somatic embryos were minced with a scalpel and inoculated for 30 min in bacterial suspension (OD600 = 0.6), then co - cultivated for 48 h with А. tumefaciens on a solid MSD medium with 2,5 mg/l Gelrite (Duchefa). After co - cultivation, the explants were rinsed with sterile distilled H 2 O, dried on sterile filter paper and cultivated for one month on MSD medium supplemented with 500 mg/l cefotaxim. After that, the proliferating embryos were transferred for two months on MSD selective media supplemented with 8 mg/l ppt. The explants were sub - cultured on fresh medium every 2 weeks, throughout the two cultivation steps. Tissue parts carrying newly regenerated ppt - resistant secondary embryos were separated from the necrotic non-transformed background and transferred on fresh selective media during each subculture. The embryos survived the ppt - selection were transferred for one month on ppt - free MSD medium containing 6% sucrose and 3 g/l active charcoal for embryo maturation. After that the embryos were transferred on MS media containing 2% sucrose, 0.7 mg/l BAP and 0.5 mg/l GA 3, solidified with 2.5 mg/l Gelrite for a period of 3-4 months to promote embryo conversation to whole plants. Regenerated plantlets with 2 3 leaves were sub-cultured for a month on a MS media with 1 mg/l BAP, 0.3 mg/l GA 3 and 0.2 mg/l NAA. Well - developed plantlets were cultivated onto selective PC medium (half MS (8) containing 3% sucrose, 2.5 mg/l Gelgite, 3 mg/l ppt and 50 mg/l chlorphenol red) for a period of one month with sub - culturing on a fresh PC medium at two weeks after the inoculation. Rooted ppt - resistant plants were transferred in soil and grown at standard greenhouse conditions. PCR analysis Genomic DNA was isolated according to the protocol of Murray (9). The PCR was performed for 30 cycles as follows: 3 min at 94 ºC, 30 sec at 94 ºC, 1 min at 50 ºC, 1 min at 72 ºC and 7 min at 72 ºC. The forward primer 35F (5 - gtctcagaagaccaaagggc) and the reverse primer 35R (5-71 Biotechnol. & Biotechnol. Eq. 19/2005/1

3 tcttgcgaaggatagtggga) were used for amplification of the 35S promoter sequence. Respectively, BF (5 - gaatgcaccatcgtcaacc) and BR (5 - gtctgcaccatcgtcaacc) primers were used for amplification of the bar coding sequence. PAT protein assay The presence of PAT protein in tissues of PCR - positive plants was determined by using of Trait LL Lateral Flow Test Kit (Strategic Diagnostics Inc., USA), according to the recommendations by the manufacturer. Results and Discussion The cultivation of secondary embryos on media containing different concentrations ppt showed that addition of 8 mg/l ppt into media completely suppresses the secondary embryogenesis, Fig. 1a. similarly, the addition of 2 mg/l ppt inhibits root formation of planted in vitro shoots from the both cultivars, Fig. 1b. The both determined ppt concentrations were further used for selection of transgenic embryos and plants. The performed preliminary experiments showed that injuring or mincing of embryos do not influence negatively their multiplication ability. Contrary, the addition of 500 mg/l cefotaxim, necessary for bacteria elimination after co - cultivation with Agrobacterium, reduced two to three times the frequency of formation of secondary somatic embryos. No formation of secondary embryos was observed in several initial experiments in which selection agent ppt was applied together with the cefotaxim immediately after the co-cultivation step. This result suggested further application of interrupted selection procedure. As a first step, the secondary somatic embryos Fig. 2a, co - cultivated with Agrobacterium were cultivated for one month on medium for secondary somatic embryogenesis contained 500 mg/l cefotaxim, Fig. 2b. The accomplishment of this step results in elimination of the bacteria from the in vitro culture. The cultivated somatic embryos Fig. 1. Secondary somatic embryogenesis (a) and root formation of the in vitro plantlets (b) cultivated on selective media containing different concentrations of ppt. were subsequently cultivated for two months on selective media contained only 8 mg/l ppt. Transferring of the cultures on fresh media each two weeks was performed within the both steps. During the first cultivation step, an initiation of secondary embryogenesis was observed and only small sectors from the embryo cultures become necrotic as a result from embryo mincing and Agrobacterium infection. Contrary the entire embryo clusters become brown and necrotic during the second cultivation step, Fig. 2c. Small white sectors of secondary embryos start to be formed on the surface of most of the clusters. Parts of the clusters containing such newly regenerated white somatic embryos were separated carefully and transferred on fresh selective media every two weeks. Entirely white clusters of secondary embryos, actively growing on selective media were obtained at the end of Biotechnol. & Biotechnol. Eq. 19/2005/1 72

4 d) Fig. 2. Agrobacterium - mediated transformation of secondary somatic embryos from R. hybrida L. and selection of the transgenic plants. (a) secondary somatic embryos prior co-cultivation with Agrobacterium; (b) secondary somatic embryogenesis on media with cefatoxim one month after inoculation with bacteria; (c) selection of ppt - resistant (cream - white) secondary somatic embryos; (d) selection of putative transformants following the change of the color of the selective media. the second selection step. All initial attempts to regenerate plants from the obtained ppt - resistant secondary embryos under the continuous presence of the selective agent were not successful. That s why the obtained within the second selection step clusters of somatic embryos, survived the ppt - selection were cultivated on ppt - free media for embryo maturation and development to whole plants. The regenerated plantlets were initially transferred on ppt - free MS medium containing 1 mg/l BAP for a month and then subsequently planted on PC selective medium containing 3 mg/l ppt and 50 mg/l chlorphenol red. The cultivation on this selective medium allows more efficient screening of the putative transgenic plants since the cell proliferation under ppt selection changed ph in the medium from 6.0 to 5.0. The ph change results to color shift from red to orange - yellow within 7 14 days after the cultivation, Fig. 2d. In parallel experiment, the non - transformed control plants did not change the color of the selective medium, become necrotic and died a month after the transfer. Totally 11 putative transgenic plants from cv. Saltze Gold and 16 from cv. Anny were obtained after application of the described Agrobacterium transformation protocol to approximately 120 secondary embryos per cultivar. The followed PCR analysis confirms the presence of 35S promoter and bar gene sequences in 3 among 11 analyzed plants of cv. Saltze Gold and respectively 10 among 16 plants of cv. Anny. The identified PCR positive plants were further tested with Trait LL Lateral Flow Test Kit. Expression of the PAT protein was detected in four plants from cv. Anny and one plant from cv. Saltze Gold, Fig. 3. The identified trans- 73 Biotechnol. & Biotechnol. Eq. 19/2005/1

5 term maintained in vitro, the described transformation protocol could be easily scale up for large transformation experiments involved higher number of transformation vectors or directed to generation of large number of transgenic plants per transformation vector. The recently obtained results on induction of secondary somatic embryogenesis in other rose cultivars suggest the possible extending of the developed transformation protocol to the broad range of R. hybrida genotypes. Fig. 3. Assay of the presence of PAT protein in tissues of the ppt - resistant plants by using of Trait LL Lateral Flow Test Kit. (K+) - positive control from transgenic tobacco carrying bar gene; А91, А73, А59, А6, ZG12 ppt - resistant rose transgenic plants; (K-) wild type rose plant; ( ) The presence / absence of PAT protein are pointed by arrow. genic ppt - resistant plants were transferred in soil. All of them were found to be morphologically identical to the non-transgenic control plants. Thus, six to eight months after initial co - cultivation of secondary embryos with Agrobacterium, transgenic in vivo plants expressed PAT protein was obtained. Since the employed secondary embryos are efficiently multiplied and long REFERENCES 1. Broertjes C., Van Harten A.M. (1988) Applied Mutation Breeding for Vegetatively Propagated Crops. Elsevier, Amsterdam. 2. Dohm A., Ludvig C., Schilling D., Debener T. (2001) Acta Hort., 547, Marchant R., Davey M., Lucas J., Power J. (1996) Plant Science, 120, Firoozabady E., Moy Y., Courtney-Gutterson N., Robinson K. (1994) Bio/Technology, 12, Marchant R., Power J.B., Lucas J.A., Davey M.R. (1998) Annals of Botany, 81, Borissova A., Tsolova V., Atanasov A. (2000) Plant Biotechnology Facing the New Millenium, International Conference, De Block M., Botterman J., Vandevielde M., Dockx J., Thoen C., Gossele V., Movva N.R., Thompson C., Van Montagu M., Leemans J. (1987) EMBO J., 6, Murashige T., Skoog F. (1962) Phisiol. Plant, 15, Murray M.G., Thompson W.F. (1980) Nucleic Acids Res., 8, Biotechnol. & Biotechnol. Eq. 19/2005/1 74