SUPPLEMENTARY INFORMATION

Transcription

1 doi:.38/nture126 Supplementry Tle 1. Oligonucleotides used in this study Nme Sequence ( -3 ) Construction of ptx hld Delt Bm CTAGATCACAGAGATGTGATGGATCCTAGTTGATGAGTTG Delt Mlu GTTGGGATGGCTTAATAACGCGTACTTTTAGTACTATACG Construction of S. epidermidis hld mutnt GGGGACAAGTTTGTACAAAAAAGCAGGCTTGGTACTTCTGGTTC HLDATT1 GTCAAAGTAAGAGGCACA GGGGACCACTTTGTACAAGAAAGCTGGGTGGCACTTCTGGTTCG HLDATT2 TCAAAGTAAGAAGCACA HLD1 CGAAAGGAGTGAAGTTATAATAGCAGCAGATATC HLD2 GATATCTGCTGCTATTATAACTTCACTCCTTTCG Integrtion of P3-lux in the S. ureus genome P3prEco CAATTTTACACCACTCTCCTCACTGGAATTCCATTATACG P3prBm ATGCGGATCCCTCATCAACTATTTTCCATCACATCTCTGT luxbmhi ATGCGGATCCTGCAGATGAAGCAAGAGGAG luxsli ATGCGTCGACGCAGCGGTATTTTTCGATCA luxarvseq AAGGCGCGACTGTTATTCAT 1

2 -hexosminidse (%) c Control DNP-IgE DNP-IgE+DNP Ionomycin FSMCs compound 48/8 ATP Stphylococcus strin -hex ctivity (%) S.ureus (Newmn) 7.62 ± 6.12 S.ureus (Newmn lgt) 9.8 ± 3.11 S.ureus (832-4) ± 1.9 S.ureus (832-4 ) ± 1.9 S.ureus (SA113) 7.27 ±.3 S.sprophyticus ± 1.46 S.epidermidis 11.9 ± 1.72 * S.xylosus 8.38 ±.3 S.sciuri 4.1 ±.6 S.cohnii.7 ±.1 S.succinus 6.4 ± 1.38 S.lentus.76 ±.38 S.fleuretti.73 ±.28 unstimulted MCs 6.24 ±.18 ** MC/9 Supplementry Figure 1. Culture superntnt from S. ureus induces MC degrnultion. () -hexosminidse ctivity from superntnts of fetl skinderived MC (FSMC) cultures stimulted with medium lone (Control), DNP-IgE lone, DNP-IgE plus DNP, ionomycin, ATP nd indicted concentrtions of culture superntnt from S. ureus (832-4). () -hexosminidse ctivity from superntnts of MC/9 cell cultures stimulted with indicted stimuli. (c) - hexosminidse ctivity from superntnts of MC/9 cells stimulted with % culture superntnt of indicted Stphylococcus species. Dt represent mens ± s.d. of triplicte cultures. *P <.; P <.1, two-tiled Student s t-test. (d) MC/9 cells were incuted 6 min in medium (Control), % S. ureus culture superntnt (832-4) or medium contining Nigericin ( M, used s positive control). Percentge of propidium iodide (PI) positive cells were mesured y flow cytometry. Dt re representtive of t lest two independent experiments S.. sup (%) -hexosminidse (%) 4 3 d PI positive cells (%) Control Ionomycin S.. sup (%) 2

3 MC-degrnultion ctivity (%) 8 ml culture superntnt (2% Yest Extrct chemicl medium) BHI sup +cteril pellet BHI sup 1 Wshed cteril pellet 7.2 sonicted cteril pellet CM-cellulose purifiction Amicon Ultr Centrifugl filter RPMI sup 17 superdex TSB sup chemicl medium sup 13 chemicl medium + 2%Yest Extrct sup 48 oiling ( C 3min) 7 ( C over night) cid (ph3) 63 lkline (ph12) 2 c Protein Nme Amicon Ultr Centrifugl filter LC-tndem MS AA totl independent spectr cover length (%) phenol/chloroform 1 -toxin protense K Chromtogrphy DEAE-cellulose inding Yes CM-cellulose inding Yes gel filtrtion (ph 7.4) void frction isoelectric ph (pi) ph cysteine protese precursor, puttive hypotheticl protein SAOUHSC617 4 lipse precursor hypotheticl protein SAOUHSC Supplementry Figure 2. Chrcteriztion, purifiction nd mss spectrometry identifiction of -toxin. () -hexosminidse ctivity compred with tht of BHI culture superntnt (sup) nd cteri pellet (%). () Purifiction scheme for identifiction of -toxin. (c) Proteins identified in the purified smple. The summrized totl independent spectr is indictive of the reltive undnce of specific protein in the purified smple. Full length of mture form -toxin sequence were detected (MAQDIISTIGDLVKWIIDTVNKFTKK). (BHI; rin hert infusion, TSB; tryptic soy roth, DEAE; Diethylminoethyl, CM; Croxymethyl. 3

4 c -hexosminidse (%) 2 1 Control Ionomycin NS * LAC wt LAC hld MW2 wt MW2 hld wt Asorption (28 nm) -toxin (N-form.) -toxin (N-deform.) Supplementry Figure 3. Amount of -toxin in S. ureus superntnt. () MC degrnultion ctivity of superntnts of MC/9 cells stimulted with 2% of culture superntnt of S. ureus strins. Dt represent mens ± s.d. of triplicte cultures. NS; no significnt, *P <.; P <.1, two-tiled Student s t-test. () -toxin expressions of filtrted superntnts from S.ureus strins (SA113, LAC nd 832-4) detected y RP- HPLC/ESI-MS. ND; not detected. Brs represent the mens. (c) -toxin expressions of superntnts from S. ureus wild-type (LAC (ptx Δ16)), -toxin deletion (LAC Δhld (ptx Δ16)) nd complemented strin (LAC Δhld (ptx Δhld)) detected y extrcted ion chromtogrms. Chromtogrphy ws performed s descried previously 1. Dt re representtive of three independent experiments. 4

5 Cytotoxicity (% LDH relese) c Cont fpsmα2 fpsmα3 fδ-toxin δ-toxin Ctrl 1 min 6 min -hexosminidse (%) Ctrl fpsmα2 fpsmα3 -hexosminidse (%) 1 -hexosminidse (%) d 1, Ctrl toxin f -toxin 3 Ctrl 1 3 -toxin 1 3 Ctrl peptide 1, IL-8 (pg/ml) Ctrl fpsmα2 fpsmα3 f -toxin -toxin purified -toxin (.1%) Supplementry Figure 4. MC degrnultion ctivity of -toxin is independent of formyltion. () % LDH relesed from MC/9 cells stimulted y medium lone (Ctrl) nd indicted concentrtions ( g ml -1 ) of PSMs for 1 or 6 min. () -hexosminidse ssy from superntnts of MC/9 cells stimulted with indicted concentrtions ( g ml -1 ) of formylted PSM s. (c) -hexosminidse ssy from superntnts of MC/9 cells stimulted with indicted concentrtions ( g ml -1 ) of unformylted -toxin ( -toxin) or formylted -toxin (f -toxin) (left pnel). -hexosminidse ssy from superntnts of MC/9 cells stimulted with indicted concentrtions ( g ml -1 ) of unformylted - toxin ( -toxin) or control peptide (right pnel). (d) IL-8 secretion in cultured superntnt of humn neutrophils stimulted y indicted concentrtions ( g ml -1 ) of phenol-solule modulins (PSMs). Dt represent mens ± s.d. of triplicte cultures. Dt re representtive of three independent experiments.

6 Supplementry Figure. Cell toxicity of -toxin. BMCMCs, BMM one mrrow derived mcrophges), one mrrow neutrophils nd primry kertinocytes isolted from mice were stimulted with PSM ( g ml -1 ) or -toxin ( or g ml -1 ) for indicted times. Cell toxicity ws mesured y LDH ssy. Dt represent mens ± s.d. of triplicte cultures. NS; no significnt, P <.1, one-wy ANOVA with Tukey's post-hoc test for multiple comprisons. Dt re representtive of two independent experiments. 6

7 -toxin toxin (ng) 1 S.ureus S.epidermidis MW2 LAC 147 wt Δhld wt Δhld wt Δhld -hexosminidse (%) Ctrl ** ** wt Δhld S.ureus LAC S.epidermidis 147 ** ** * Supplementry Figure 6. MC degrnultion ctivity of -toxin in superntnt from S. ureus nd S. epidermidis. () Immunolot nlysis of culture superntnts of S. ureus wild-type (LAC), -toxin deletion (LAC Δhld), S. epidermidis wild-type (147) nd - toxin deletion (147 Δhld)(.2 l per well). Representtivee of two experiments. () - hexosminidse from MC/9 cells stimulted y medium lone (Control), culture superntnts of from S. ureus wild-type (LAC), -toxin deletion (LAC Δhld), S.epidermidis wild-type (147) nd -toxin deletion (147 Δhld). Dt represent mens ± s.d of triplicte cultures. *P <., **P <.1, P <.1, two-tiled Student s t-test. Dt re representtive of three independent experiments. 7

8 Medium LAC wt ** ** LAC Δhld SA113 Supplementry Figure 7. δ-toxin in S. ureus culture superntnt induces MC degrnultion in vivo. () C7BL6 mice were injected intrdermlly into the left nd right ers with 4% S. ureus culture superntnt from LAC wt, LAC Δhld nd SA113 or 4% TSB (s control), respectively. Culture superntnts were diluted y PBS. Three representtive mice for ech group re shown. Representtive of t lest 9 mice per group. () Quntifiction of Evns lue extrcted from skin tissue of C7BL6 mice is shown. Dots represent individul er smples pooled from three independent experiments. **P <.1, P<.1, Kruskl-Wllis test. Brs represent the mens. 8

9 Supplementry Figure 8. Mouse Fpr gene expression. Expression of mouse Fpr genes in BMCMCs, MC/9 nd one mrrow neutrophils. Expression is normlized to tht of Gpdh. Dt represent mens ± s.d. of triplicte cultures. Dt re representtive of two independent experiments. 9

10 -hexosminidse (%) ** * NS c -hexosminidse (%) toxin Ctrl -toxin + CsH ( M) Supplementry Figure 9. MC degrnultion ctivity induced y - toxin is inhiited y FPR ntgonists. () MC degrnultion ctivity (βhexosminidse ssy) of superntnts of MC/9 cells pretreted with WRW4 peptide nd then stimulted with δ-toxin ( μg ml -1 ). () Quntifiction of Evns lue extrcted from skin tissue of C7BL6 mice is shown. Mice were pretreted with or without WRW4 peptides ( M). 1h lter, mice were injected intrdermlly into the ers with 4% culture superntnt from S. ureus. Dots represent individul er smples. (c) β- hexosminidse ssy of superntnts of MC/9 cells pretreted with FPR1 ntgonist (Cyclosporin H) nd then stimulted with δ-toxin ( μg ml -1 ) Dt represent mens ± s.d. of triplicte cultures. In,c, **P <.1, P <.1, two-tiled Student s t-test. In, NS; no significnt, **P <.1, Kruskl-Wllis test. Brs represent the mens. Dt re representtive of three independent experiments.

11 2 -hexosminidse (%) c -hexosminidse (%) Ctrl Ctrl MMK1( M) LipoxinA4 (nm) WT 1 -toxin ( g/ml) -toxin Fpr2-/- Supplementry Figure. Fpr2 is dispensle for MC degrnultion ctivity induced y -toxin. () MC degrnultion ctivity (β-hexosminidse ssy) in superntnts of MC/9 cells treted with indicted concentrtion of FPR2 gonists (MMK1, LipoxinA4). () MC degrnultion ctivity of superntnts of MC/9 cells pretreted with pertussis toxin (PTX; ng ml -1 nd ng ml- 1 ) overnight nd then stimulted with indicted concentrtions of δ-toxin ( g ml -1 ). (c) β-hexosminidse ssy of superntnts of BMCMCs from WT nd Fpr2 -/- mice stimulted with δ-toxin ( μg ml -1 ). Dt represent mens ± s.d. of triplicte cultures. In, *P <., **P <.1, two-tiled Student s t-test. Dt re representtive of three independent experiments. 11

12 No. of S. ureus strins from AD synthetic toxin (ng) SA113 LAC MW2 S. ureus strins c Supplementry Figure 11. Expression of -toxin in S. ureus clinicl smples nd S. ureus RNAIII in the lesionl skin of topic dermtitis ptients. () Immunolot nlysis of culture superntnts of 26 S. ureus strins (.2 l per well) which were isolted from the skin of topic dermtitis skin lesions. Indicted mounts of synthetic - toxin were lso loded s controls. All isoltes were methicillin-sensitive S. ureus except No.23 tht ws community-ssocited methicillin-resistnt S. ureus. Dt re representtive of t lest two independent experiments. () S. ureus RNAIII expression in AD skin otined from lesionl nd non-lesionl skin. Expression ws normlized to S. ureus house keeping gene, gyrb. Normlized RNAIII expression in LAC wt nd LAC gr cultured for 24 hrs re shown s positive (red dot) nd ckground controls (lue dot), respectively. (c) Expression of S. ureus gyrb ws normlized to cteri 16S rrna. Smples tht were negtive for gyrb expression were lso negtive for RNAIII. ND; not detected. NS; no significnt, **P <.1, Wilcoxon test. Dots represent individul ptient smples. Brs represent the mens. Dt re representtive of three independent experiments. 12

13 CPS (counts per second) LAC P3-lux OD 6 Time (hrs) LAC P3_lux Rdince (x p/sec/cm 2 /sr) c Rdince (p/sec/cm2/sr).e+7.e+6.e+.e OD 6 Bcteri numer dy1 dy4 dy7 Luminescence 1.E+9 1.E+8 1.E+7 1.E+6 1.E+ 1.E+4 CFU/cm2 Supplementry Figure 12. -toxin gene expression in vivo. () -toxin gene expression of LAC P3-lux reporter strin in TSB culture. P3-lux expression nd cteril concentrtion (Opticl Density 6; OD6) were mesured with LMx luminometer (Moleculr Devices). () Representtive expression of S. ureus -toxin RNA 4 dys fter S. ureus coloniztion. Expression ws detected y ioluminescence of S. ureus LAC wt nd LAC P3-lux strins on color scle overlid on top of gryscle imge of mice. (c) Luminescence expression nd the numer of S. ureus in the skin of infected mice. Dot ted line mens the ckground of luminescence. Dt represent mens + s.e.m. (dy1; n= mice, dy 4 nd 7; 4 mice pooled from 3 independent experiments.) 13

14 PBS LAC ptx Δ16 LACΔhld ptx Δ16 LACΔhld ptx Δhld * Supplementry Figure 13. δ-toxin-complemented S. ureus strin induces skin inflmmtion. () Skin phenotype nd histopthology of BALB/c mice colonized with S. ureus wild-type (LAC ptx 16), δ-toxin mutnt (LACΔhld ptx 16) or δ- toxin-complemented strin (LACΔhld ptx hld), or treted with PBS. Representtive of 7-13 mice per group. () Skin disese score t 1 week post coloniztion with S. ureus or treted with PBS. Dots represent individul mice pooled from two independent experiments. *P <. ; P <.1, Kruskl-Wllis test. 14

15 NS NS NS NS c Supplementry Figure 14. The numer of cteri nd IL-4 levels in skin colonized with S. ureus. (nd)numer of culturle cteri nd S. ureus in the skin of BALB/c mice 1 week post inocultion with S. ureus. Results re men ±s.e.m. (n=). () Swed smples were plted on TSB nd Bird-Prker gr pltes, nd then colonies were counted 48 h lter (). Swed (surfce) nd skin homogenized (nonsurfce) smples were plted on Bird- Prker gr pltes, nd then colonies were counted 48 h lter. (c) IL-4 levels in skin of Bl/c mice inoculted with or without S. ureus (S.. wt or S.. Δhld) for 1 week. Dots represent individul mice. In,, NS; no significnt, two-tiled Student s t-test. ND; not detected. In c, NS; no significnt; *P <., **P <.1, Kruskl-Wllis test. Dt re representtive of t lest two independent experiments. 1

16 * ** PBS S.. wt 1 wk S.. Δhld PBS S.. wt 3 wk NS ** NS S.. Δhld PBS S.. wt S.. Δhld PBS S.. wt S.. Δhld 1 wk 3 wk Supplementry Figure 1. IgG production in BALB/c mice colonized with S. ureus. Serum levels of IgG1 () nd IgG2 () in BALB/c mice colonized with S. ureus or treted with PBS t 1 nd 3 weeks post coloniztion with S. ureus. Dots represent individul mice. NS; no significnt; *P <., **P <.1,P <.1, Kruskl-Wllis test. Brs represent the mens. Dots represent individul mice pooled from two independent experiments. 16

17 c Supplementry Figure 16. Skin coloniztion of S. ureus without tpe stripping induces inflmmtory disese nd IgE production. () Mice were colonized with 8 CFU S. ureus on shved skin using guze ptch for 1 week. Numer of S. ureus in skin of C7BL6 mice colonized with S. ureus or treted with PBS t 1 week. Smples were homogenized nd plted on Bird- Prker gr pltes, nd then colonies were counted 48 h lter. Results re men ±s.e.m. () Skin disese score in C7BL6 mice t 1 week. (c) Serum levels of IgE in C7BL6 mice t 1 week. *P <., Mnn-Whitney test. Brs represent the mens. Dots represent individul mice. Dt re representtive of t lest two independent experiments. 17

18 1 week 3 week NS NS NS NS PBS S.. wt S.. Δhld PBS S.. wt S.. Δhld Supplementry Figure 17. S. ureus coloniztion fter OVA dministrtion does not induce OVA-IgE. () BALB/c mice were exposed epicutneously with 8 CFU S. ureus (LAC wt nd LAC hld) nd g OVA t the sme time using guze ptch for 1 week. Ser were collected t 1 week. () g OVA ws given epicutneously using guze ptch for 1 week. After 1 week intervl, BALB/c mice were exposed 8 CFU S. ureus (LAC wt nd LAC hld) for 1 week. Ser were collected t 3 weeks. Serum IgE levels were mesured y ELISA. NS; no significnt, Kruskl-Wllis test. Brs represent the mens. Dt re representtive of two independent experiments. 18

19 lood lood skin PBS OVA OVA+ -toxin 1 wk 3 wk 4 wk OVA + -toxin OVA + -toxin HE c d e f Supplementry Figure 18. Synthetic -toxin enhnces llergic skin disese. () OVA sensitiztion protocol with or without -toxin. BALB/c mice were sensitized epicutneously with OVA ( g) with or without synthetic -toxin ( g) for 1 week. After 2 week intervl, mice were chllenged with OVA ( g) with or without synthetic -toxin ( g) t the sme skin site. () Skin phenotype (top pnels) nd histopthology (ottom pnels) of mice. Notice white scly res s well s thickened epidermis nd derml inflmmtory infiltrte in the skin of mice chllenged with OVA plus -toxin. Skin sections were stined with H&E (HE). Representtive of t lest 6 mice per group. Br = m. (c) Skin disese score t 1 nd 4 week. Kruskl-Wllis test. (d-f) Serum levels of OVA specific IgE (d), IgG1(e) nd IgG2 (f) in BALB/c sensitized with OVA with or without -toxin t 1 nd 3 weeks. Dots represent individul mice. NS; no significnt, *P <., **P <.1, P <.1, Kruskl-Wllis test. Brs represent the mens. Dt re representtive of two independent experiments. Nunez_supplementry Figure

20 +BMCMCs PBS HE TB TB (hpf) c B6 S.. wt S.. Δhld PBS S.. wt Kit W-sh/W-sh S.. Δhld +BMCMCs S.. wt S.. Δhld Supplementry Figure 19. Stphyloccocus -toxin promotes IgE production nd inflmmtory skin disese vi mst cells. () The numer of cutneous MCs detected y toluidine lue (TB) stining. Five low power fields (lpf) were counted. A dot represents the verge of MCs per lpf from one mouse. Brs represent the mens. The results were derived from two of the pooled experiments. NS; no significnt, *P <., P <.1, Kruskl-Wllis test. () Skin histopthology of C7BL6 (B6), Kit W-sh/W-sh nd MCreconstituted Kit W-sh/W-sh mice colonized with wild-type S. ureus (S.. wt), -toxin deficient S. ureus (S.. hld) or treted with PBS. Skin sections were stined with H&E (HE) nd toluidine lue (TB). Left 2 files, Br = m. Right pnels show high power imges of degrnulted MCs (yellow rrow heds indicte TB-positive grnules outside MCs). Br = m. Representtive of t lest mice per group. (c) Numer of culturle cteri nd S. ureus in surfce (sw) nd non-surfce skin (remining skin tissue) of B6 nd Kit W-sh/W-sh mice 1 week post inocultion with S. ureus. Results re men ±s.e.m (B6; n=8, Kit W-sh/W-sh ; n=7 ). NS; no significnt, **P <.1, P <.1, two-tiled Student s t-test. Dt re representtive of t lest two independent experiments. Nunez_supplementry Figure 19

21 B6 Kit W-sh/W-sh Kit W-sh/W-sh +BMCMCs Supplementry Figure. The numer of cutneous MCs in the er pin detected y toluidine lue stining. () Er histopthology of C7BL6 (B6), Kit W-sh/W-sh nd MC-reconstituted Kit W-sh/W-sh mice. Skin sections were stined with toluidine lue. Red rrow heds indicte toluidine-positive MCs. Br = mm. Representtive of t lest 8 mice per group. () The numer of cutneous MCs detected y toluidine lue stining. Two low power fields (lpf) were counted per mouse. Ech dot represents the verge of MCs per lpf from one mouse. Brs represent the mens. The results were derived from two of the pooled experiments. **P <.1, Kruskl-Wllis test. Dt re representtive of three independent experiments. 21