Heat and SDS insensitive NDK dimers are largely stabilised by hydrophobic interaction to form functional hexamer in Mycobacterium smegmatis

Transcription

1 Suplementary Materials Vol. 60, No 2/ on-line at: Regular paper Heat and SDS insensitive NDK dimers are largely stabilised by hydrophobic interaction to form functional hexamer in Mycobacterium smegmatis Muthu Arumugam # and Parthasarathi Ajitkumar * Department of Microbiology and Cell Biology, Indian Institute of Science, Bangalore , Karnataka, India. The primary structure and function of nucleoside diphosphate kinase (NDK), a substrate non-specific enzyme involved in the maintenance of nucleotide pools is also implicated to play pivotal roles in many other cellular processes. NDK is conserved from bacteria to human and forms a homotetramer or hexamer to exhibit its biological activity. However, the nature of the functional oligomeric form of the enzyme differs among different organisms. The functional form of NDKs from many bacterial systems, including that of the human pathogen, Mycobacterium tuberculosis (MtuNDK), is a hexamer, although some bacterial NDKs are tetrameric in nature. The present study addresses the oligomeric property of MsmNDK and how a dimer, the basic subunit of a functional hexamer, is stabilized by hydrogen bonds and hydrophobic interactions. Homology modeling was generated using the three-dimensional structure of MtuNDK as a template; the residues interacting at the monomer-monomer interface of MsmNDK were mapped. Using recombinant enzymes of wild type, catalytically inactive mutant, and monomer-monomer interactive mutants of MsmNDK, the stability of the dimer was verified under heat, SDS, low ph, and methanol. The predicted residues (Gln17, Ser24 and Glu27) were engaged in dimer formation, however the mutated proteins retained the ATPase and GTPase activity even after introducing single (MsmNDK- Q17A, MsmNDK-E27A, and MsmNDK-E27Q) and double (MsmNDK- E27A/Q17A) mutation. However, the monomer monomer interaction could be abolished using methanol, indicating the stabilization of the monomer-monomer interaction by hydrophobic interaction. Key words: nucleoside diphosphate kinase, Mycobacterium smegmatis, oligomerisation, dimer, hexamer, homology modeling, hydrophobic interaction, ANS fluorescence assay Received: 24 January, 2013; revised: 14 May, 2013; accepted: 03 June, 2013; available on-line: 17 June, 2013 * ajit@mcbl.iisc.ernet.in # Present Address: Scientist, Biotechnology division, National Institute for Interdisciplinary Science and Technology (NIIST), CSIR, Industrial Estate (PO), Trivandrum , Kerala, India Abbreviations: NDK, nucleoside diphosphate kinase; CCP4, collaborative computational project, 1994; ANS, 1-anilinonaphthalene- 8-sulfonic acid; CD, circular dichroism; PVDF, polyvinylidene fluoride; ECL, enhanced chemiluminescent and Hepes, N-2-Hydorxyethylpiperazine-N -2-ethansulfonic acid.

2 Supporting information: Figures A B C Fig. S1. Homology modelling of MsNDK using already crystal structure solved MtNDK as template. A. Homology model of MsNDK monomer. B. Ramachandran plot for modeled MsNDK. C. Modeled MsNDK as hexameric form.

3 Fig. S2. Multiple sequence alignment of NDK proteins from diverse bacterial and eukaryotic genera were carried out using clustalw ( EcNDK: NDK from Escherichia coli(k12), PaNDK: NDK from Pseudomonas aeruginosa (PAO 1), MxNDK: NDK from Myxococcus xanthus (DK 1522), MlNDK: NDK from Mycobacterium leprae (TN), MtNDK: NDK from Mycobacterium tuberculosis (H37Rv), MsNDK: NDK from Mycobacterium smegmatis (mc 2 155), DdNDK: NDK from Dictyostelium discoideum, AtNDK: NDK from Arabidopsis thaliana (NDPK1), ScNDK: NDK from Saccharomyces cerevisiae(ynk1) and DmNDK: NDK from Drosophila melanogaster (awd). The residues which predicted to be having surface contact with another monomer were indicated within box.

4 NDK-Q17A/E27A Marker NDK wt NDK-H117Q NDK-Q17A NDK-E27Q NDK-E27A kda Fig. S3. MsNDK wild type and its catalytically inactive and structural mutants purification profile.

5 A Pi released (CPM) 9,000 8,000 7,000 6,000 5,000 4,000 3,000 2,000 1, Fig. S4. ATPase activity (S4A) or GTPas (S4B) of MsNDK and its mutants. The Pi released (S4A) or GDP formed (S4B) by MsNDK wild type and its mutants radioactive spots were scarped and read using Scintillation counter the results were expressed as Counts Per Minute (CPM). Standard deviations are shown as error bars. Lane, 1. [γ- 32 P]-ATP alone, Lane; 2. MsNDK wt; Lane, 3. MsNDK- H117Q; Lane, 4. MsNDK-Q17A; Lane, 5. MsNDK-E27Q; Lane, 6. MsNDK-E27A and Lane, 7. Double mutant MsNDK Q17A /E27A.

6 A. MsNDK Wild Type B. MsNDK-H117Q C. MsNDK-Q17A kda M M M D M Fig. S5. Oligomerisation of recombinant MsNDK and its mutants in the presence of chemical cross-linker glutaraldehyde. Crosslinking experiment was carried out using 2 μg of purified recombinant MsNDK in 1 x PBS at 37ºC. The cross-linking reaction was initiated with the addition of glutaraldehyde, and the reaction was continued for 30 min and then stopped. The samples were resolved on 12% SDS-PAGE. A. MsNDK wild type, B. MsNDK-H117Q, C. MsNDK-Q17A. Lane, M. Protein size marker; Lane, 1. Without Glutaraldehyde; Lane, % Glutaraldehyde; Lane, % Glutaraldehyde; Lane, % Glutaraldehyde; Lane, % Glutaraldehyde; Lane, % Glutaraldehyde. D dimer; M monomer.

7 D. MsNDK-E27A E. MsNDK-E27Q F. MsNDK-Q17A/E27A M M M kda D M Fig. S5. Oligomerisation of recombinant MsNDK and its mutants in the presence of chemical cross linker Glutaraldehyde. Crosslinking experiment was carried out using 2 μg of purified recombinant MsNDK in 1x PBS at 37ºC. The cross linking reaction was initiated with the addition of glutaraldehyde, and continued the reaction for 30 min and then stopped. Then the samples were resolved on 12% SDS-PAGE. D. MsNDK-E27A, E. MsNDK-E27Q and F. MsNDK Q17A on E27A. Lane, M. Protein size marker; Lane, 1. Without Glutaraldehyde; % Glutaraldehyde; Lane, % Glutaraldehyde; Lane, % Glutaraldehyde; Lane, % Glutaraldehyde; Lane, % Glutaraldehyde. D dimer; M monomer.

8 Fig.S6. Oligomerisation of MtuNDK in the presence of chemical cross linker. Cross-linking experiment was carried out using 2 μg of purified recombinant MtuNDK in 1X PBS at 37ºC for 30 min. The corss linking reaction was terminated by addition of stop buffer, and then the samples were resolved in 12% SDS-PAGE. A. Silver stained profile of MtuNDK with 0.01% (Lane, 3), without Glutaraldehyde cross linker (Lane, 2), and Lane 1 protein size marker. B. Western blot profile of MtuNDK with (Lane, 3) or without 0.01% Glutaraldehyde (Lane, 2).

9 Supporting information: Table Table S1. List of Primers used in this study Name Sequence Used at (Temp) for the generation of Msndk-f2 5' cggggtaccgtgactgagcggaccctcgtacttatcaagcc 3' MsNDK ORF PCR Msndk-r2 5' ccggaattcggcggtggcctcgccggg 3' MsNDK ORF PCR MsNDK-H117Qf: 5' cacgcaggacaatctcgtgcagggttccgattc 3' MsNDK-H117Q MsNDK-H117Qr: 5' ctcgggcgaatcggaaccgtccacgagattg 3' MsNDK-H117Q MsNDK-Q17Af: 5' gtgaagcgcgccctcgtgggggag 3' MsNDK-Q17A MsNDK-Q17Ar: 5' ccacgagggcgcgcttcacaccg 3' MsNDK-Q17A MsNDK-E27Af: 5' cggatcgcccgcaagggcctg 3' MsNDK-E27A MsNDK-E27Ar: 5' ccttgcgggcgatccggctgag 3' MsNDK-E27A MsNDK-E27Qf: 5' ctcagccggatccagcgcaagggcctg 3' MsNDK-E27Q MsNDK-E27Qr: 5' ccttgcgctggatccggctgagg 3' MsNDK-E27Q Bold letter indicates nucleotides which yield mutated amino acid residues