Gene Forward (5 to 3 ) Reverse (5 to 3 ) Accession # PKA C- TCTGAGGAAATGGGAGAACC CGAGGGTTTTCTTCCTCTCAA NM_011100

Transcription

1 Supplementary Methods: Materials. BRL37344, insulin, 3-isobutyl-1-methylxanthine, dibutyryl camp (Bt2-cAMP) and 8-Bromoadenosine 3,5 -cyclic monophosphate sodium (8-br-cAMP), cilostamide, adenosine deaminase, (-)-N 6 -(2-phenyl-isopropyl)-adenosine and Type-1 collagenase, free glycerol kit and glycerol kinase were purchased from Sigma (St. Louis, MO). Anti-ATGL, HSL, phospho-hsl, phospho-pka substrate, perilipin and β-actin antibodies were from Cell Signaling, Inc (Danvers, MA). Antibodies against PKA regulatory subunits RIIα and RIIβ, catalytic subunits α or β, PDE3b and α-tubulin were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Anti- comparative gene identification-58 (CGI-58) antibody was purchased from Abnova (Taiwan, China). ATP bioluminescence assay kit was from Biaffin GMbH & Co KG (Kassel, Germany). FFA assay kit was purchased from Wako Diagnostics (Richmond, VA). The Crosslink IP kit was from Thermo Fisher Scientific (Rockford, IL). Mouse endocrine panel multiplex assay kit was from Millipore. Plasmid constructs and generation of adenovirus vectors. Adenovirus encoding mouse adiponectin, Adiponectin receptor 1 (AdipoR1), PKA RIIα, and RIIβ cdnas were created using pad/cmv/v5-dest vector (Invitrogen)(18). Adenoviruses encoding shrna were created using the BLOCK-iT Adenoviral RNAi Expression System (Invitrogen). The sequences are 5 - GGGCTTGCTTCAAGAGCATCT-3 for AdipoR1; 5 - GCCAGGAATCAGACACGTTCA-3 for PKA RIIα. Quantitative RT-PCR Analysis. Real-time PCR was performed using an Mx3P Real-Time PCR system (Stratagene) and SYBR Green dye (Molecular Probes, Eugene, OR). The sequences for the primers are listed in Supplementary Table 1. Adipocyte area measurement. Epididymal fat was fixed with 1% buffered formalin (Fisher Scientific) and embedded in paraffin. 4 μm sections were stained with hematoxylin and eosin. Individual cross-sectional adipocyte area, 4-35 adipocytes per mouse, was measured using the Pixcavator image analysis software (Intelligent Perception Co. Huntington, WV). Supplementary Table 1. Sequences for Real time PCR Primers Gene Forward (5 to 3 ) Reverse (5 to 3 ) Accession # 18S rrna CGAAAGCATTTGCCAAGAAT AGTCGGCATCGTTTATGGTC X686 PKA C- TCTCGGAGTCCTCATCTACGA CTGAAGTGGGATGGGAACC NM_8854 PKA C- TCTGAGGAAATGGGAGAACC CGAGGGTTTTCTTCCTCTCAA NM_111 PKA RII- TGCAGAAACGTTTAACCCTGA TCATCAGTTTTGGGATGAACC NM_8924 PKA RII- TGGCACCAAAGTTTACAATGA AAGAAAGAGTCTGCCAAATCTCC NM_11158 PKA RI- GTAGTGAGGCTGCGAGCTG AGACGCCATGGTTCTCTGA NM_2188 PKA RI- CGGGAGCACTTTGAGAAGTT TCCTCATCGTGGGAATCAC NM_8923 Mgat1 TGCAGTGGGTCCTGTCCT CCAGCATCACCATAATTCCA NM_26713 Dgat2 GGCGCTACTTCCGAGACTAC TGGTCAGCAGGTTGTGTGTC NM_26384

2 Supplementary Figure 1. Reduced adipocyte areas of mice. Epididymal fat tissues from 2 month old regular chow-fed and 8-week HF fed or male mice were fixed and paraffin embedded. Cross-sectional adipocyte areas were measured using H and E stained slides cells were counted for each mouse. Relative adipocyte areas were measured using Pixcavator image analysis software. n=4, data are expressed as means ± SEM. A. Adipocyte area p<.1 Adipocyte area B p<.1

3 Supplementary Figure 2. mrna levels of Mgat1 and Dgat2 in epididymal adipose tissues from and adiponectin overexpressing mice. (A) Total mrna was extracted from epididymal adipose tissue of and control mice. (B) Adenovirus vector encoding adiponectin or GFP was injected into 8-w old C57BL/6 mice through the tail vein. Epididymal fat tissues were collected three days after injection. mrna levels of Mgat1 and Dgat2 were measured by real-time PCR. n=8, Data are expressed as means ± SEM. A. 2.5 Relative mrna levels Mgat1 Dgat2 B. Relative mrna levels Ad-Acrp3 Mgat1 Dgat2

4 Supplementary Figure 3. Serum FFA during fasting and refeeding and the effects of adiponectin on lipolysis in MEF-derived adipocytes. A, blood samples were collected from 1-week old male mice at fed, fasted and 4h refed states. The areas under the serum FFA curves were calculated and compared between and mice (p<.5, n=6). B, FFA was measured using serum samples before and after 8-week high-diet (HF) fed and control mice. C, Fibroblasts were prepared from e14.5 mouse embryos and differentiated into adipocytes. 1 days after adipocyte differentiation (5-6% were positive with multilocular lipid droplets), the cells were treated overnight with adiponectin secreted from Ad-Acrp3-transduced FAO cells. Bt2- camp (1 μm) was added to the culture medium for 1-h to stimulate lipolysis. Medium glycerol was measured. n= 6. Data are expressed as means ± SEM. A FFA (meq/l) fed 12h 24h refed Fasting B 2. p<.5 FFA (meq/l) LF HF C Glycerol (μmol / 1 7 cells) 6 p<.1 Basal camp 4 2 Con Adiponectin Co-culture condition

5 Supplementary Figure 4. Adenoviral vector-mediated adiponectin overexpression and reduced blood FFA in mice. Purified Ad-Acrp3 or viral vectors were injected into 1 weeks old C57BL/6 male mice through the tail vein (1 x 1 9 pfu per mouse). Three days after injection, fasting blood was collected. Total adiponectin protein levels were measured using Western blotting with.2 μl serum sample (A). Serum FFA was measured using a Wako kit (B). The levels of serum adiponectin (A) or FFA (B) were compared between and Ad-Acrp3 treated mice. n=8, data are expression as means ± SEM. A. Ad-Acrp3 Adiponectin 3 kda Serum adiponectin protein 15 p< Ad-Acrp3 B.6 p<.5 FFA (meq/l).4.2. Ad-Acrp3

6 Supplementary Figure 5. Adiponectin reduces HSL Ser66 phosphorylation and inhibits lipolysis in adipose tissue. A, Adiponectin was overexpressed in 8-week old C57BL/6 male mice by Ad- Acrp3 viral vector-mediated in vivo transduction. Control mice were transduced with. Three days after injection, epididymal fat was collected and explant lipolysis was carried out. One hour after BRL stimulation, free glycerol in the medium was measured to represent lipolysis. B, Male and littermates were fed with high fat diet (6%) for 8 weeks. Protein samples were prepared from epididymal fat. Phosphorylation of HSL was measured by Western blot using protein samples from epididymal fat. A. Glycerol (μmol/mg tissue) Ad-Acrp3 Saline p<.5 BRL B. phospho-hsl Ser66 phospho-hsl Ser565 HSL Phosphorylation of HSL Ser66 5 p<

7 Supplementary Figure 6. Adiponectin reduces HSL Ser66 phosphorylation through adiponectin receptor 1. Differentiated 3T3-L1CARΔ1 adipocytes were transduced with adenovirus vectors encoding AdipoR1 or sirna against AdipoR1 for 24h. Cells were incubated overnight in DMEM supplemented with 2% of conditioned medium from Ad-Acrp3 transduced FAO cells to increase adiponectin levels. Some cells were treated with Bt2-cAMP. The studies were repeated 4 times. The graphs represent means ± SEM. * p<.5 vs. -treated cells control cells Ad-AdipoR Ad-AdipoR1siRNA camp phospho-hsl Ser66 HSL GAPDH 37 kda Phosphorylation of HSL Ser camp Saline p<.1 p<.5 * * Ad-AdipoR1 Ad-AdipoR1siRNA

8 Supplementary Figure 7. Increased phosphorylation of PKA substrates in epididymal fat of mice. A, Total protein samples were prepared from epididymal fat from chow-fed and mice after overnight fasting. Phosphorylation of PKA substrates was probed with an antibody (Cell Signaling) specific to the phospho-pka substrate. B, Total camp was extracted from epididymal adipose tissues from 2-month old, heterozygous, and control mice. camp levels were measured using an EIA kit from GE Healthecare. n=8, data are expressed as means ± SEM. phospho-pka sub 1 kda 75 kda 5 kda 4 camp (fmol/mg fat) Adipoq-/+

9 Supplementary Figure 8. PKA RIIα overexpression increases HSL Ser66 phosphorylation in OP9 adipocytes. Differentiated OP9 adipocytes were transducted with adenovirus vectors encoding PKA RIIα, RIIβ or GFP. 24 hours later, protein samples were isolated and phosphorylation of HSL Ser66 and total HSL protein levels were detected by Western blot. n=6, data are expressed as means ± SEM. Ad-PKA RIIα Ad-PKA RIIβ phospho-hsl Ser66 HSL PKA C-α 4 kda PKA RIIα 5 kda α-tubulin 55 kda Phosphorylation of HSL Ser p<.5 Ad-PKA RIIα Ad-PKA RIIβ

10 Supplementary Figure 9. Effects of adiponectin on overall protein ubiquitination. Proteasome inhibitor MG132 (25 μm) was added to the medium of mature 3T3-L1 adipocytes. 3 minutes later, 2% adiponectin-enriched conditioned medium was added for 2 hours. Equal amounts of proteins were resolved using SDS-PAGE. Protein ubiquitination was probed by Western blot using an anti-ubiquitin antibody (Cell Signaling). Adiponectin MG kda 15 kda 1 kda 75 kda 5 kda 37 kda 25 kda