SUPPLEMENTARY INFORMATION

Transcription

1 6 Relative levels of ma3 RNA LN MG SG PG Spl Thy ma3 ß actin Lymph node Mammary gland Prostate gland Salivary gland Spleen Thymus MMTV target tissues Fig. S1: MMTV target tissues express ma3. RNA was extracted from selected MMTV target tissues (lymph nodes, mammary, prostate, and salivary glands, spleen and thymus) and subjected to semi-quantitative radioactive RT-PCR. ma3 and b actin transcript levels were quantified by phosphorimager analyses. Shown are the relative levels of ma3 expression normalized to β actin for each tissue, expressed in arbitrary units. 1

2 E4f pgex917 E5r gene trap 45 bp 9 kb Ex4 βgal pa Ex5 WT 8 bp Ex4 Ex5 E4f-E5r E4f-pGex917 M +/+ +/- -/- +/+ +/- -/ E4f-E5r (8bp) E4f-pGex917 (45bp) Fig. S2. Generation of ma3 -/- mice. Top: Scheme of targeted insertion of gene trap vector pgt2lxf into the ma3 intron 4. Positions of primers and sizes of PCR products are indicated. Bottom: 8 bp PCR product was amplified from wild type ma3 +/+ (+/+) and heterozygous ma3 +/- (+/-) genomic DNA with primers designed in exon 4 (E4f; CCTTCACCATGGGGTCTTTA) and exon 5 (E5r; TGAAGAGCTGGAAGGGACCGAGATGTAGCAAGG). In heterozygous ma3 +/- (+/-) and homozygous ma3 -/- (-/-) samples, 45 bp fragment was amplified with forward the primer from exon 4 (E4f) and the reverse primer from the gene trapped vector (pgex917; CCACAACGGGTTCTTCTGTT). 2

3 14 12 CDA activity (cpm) mock ma3 ma3(1-197) GST pull down WB ma3 ma3(1-197) Fig. S3. N-terminal mutant ma3(1-197) protein is enzymatically inactive. The deaminase activities of ma3 and mutant ma3(1-197) proteins were examined by the in vitro scintillation proximity assay 16. Equal amounts of GST pull down proteins were used in the assay and analyzed by Western blotting with anti-gst antibodies. Mutant ma3(1-197) protein containing only the N-terminal 197 residues does not have any deaminase activity. 3

4 25 HIV-1ΔVif MMTV Luciferase activity Relative Infection pcdna3.1 ha3g ha3gq259e ma3 pcdna3.1 ha3g ha3gq259e ma3 WB:V5 A3 proteins Fig. S4. Inhibition of MMTV and HIV-1ΔVif infection by a deaminase-negative ha3g protein. Effects of wild type ha3g, ma3 and mutant ha3gq259e proteins were assessed on the mutant HIV-1ΔVif (panel on left) and MMTV (panel on right) infections. Equal amounts of virus and A3 proteins were co-expressed in 293T cells and normalized viral titers were used to infect GHOST-R3/X4/R5 cells (HIV-1ΔVif) and TRH3 cells (MMTV). Western blotting of V5 epitope-tagged A3 proteins is presented below the bar graphs. SEM are denoted by error bars. 4

5 Relative quantity (dr)1 WT ma3 -/- Fig. S5. No wild type m3a transcripts are present in ma3 -/- mouse. The absence of wild type ma3 RNA in the spleen was confirmed by real time PCR using forward and reverse primers in exons 2 (CCTTCACCATGGGGTCTTTA) and 7 (GCTCCATGGACCGAATCTT), respectively. PCR products were normalized to β-actin (TGGAATCCTGTGGCATCCATGAAAC and TAAAACGCAGCTCAGTAACAGTCCG). Values represent three independent measurements where levels of the wild type ma3 transcripts were set to one. 5

6 A %Vβ2+CD4+/total CD %CD69+B22+/total B /- +/- +/+ -/- +/- +/+ B 12 %Vβ1+CD4+/total CD ma3 -/- WT D ND infected D ND -/- +/+ un-infected Fig. S6. Analysis of lymphocyte activation in ma3 -/-, heterozygous ma3 +/- and wild type ma3 +/+ mice. A) Sag-specific Vβ2 T cell and B cell activation at 4 days post-inoculation in the draining lymph nodes of ma3 -/-, ma3 +/- and ma3 +/+ mice. Four mice of each genotype were used in the experiment. B) Analysis of non-cognate Vβ1+CD4+ T cells in lymph nodes and periphery of MMTV-infected and -uninfected mice. See legend of Fig. 3 for details. 6

7 Fig. S7. ma3 does not induce G to A hypermutation in wild type mice. Sequences are of a 67 bp region of MMTV DNA amplified from DNA isolated from the spleens of MMTV(RIII)-infected ma3 -/-, wild type ma3 +/+, and heterozygous ma3 +/- mice. Eight clones from ma3 +/-, 13 clones from ma3 +/+ and 1 clones from ma3 -/- mice were analyzed. A single G to A nucleotide difference at position 624 was detected in all clones compared to the sequence deposited with Genbank (Accession no. AF136899) 18. The red font indicates identity to the Genbank sequence while the blue font highlights differences from the wild type sequence. Presented are sequences where differences from the wild type sequence were identified. Of the 31 clones analyzed, 24 were identical, 4 had single nucleotide changes and 3 had 2 nucleotide changes. 7

8 Supplementary Methods HIV virion production and infectivity assay. HIV-1 virions were produced from 293T cells. Typically, the pnl4.3 ΔVif luc and APOBEC plasmids were used to transfect cells using Fugene 6 (Roche, Nutley, NJ). HIV-1 production was quantitated by p24 Gag enzyme-linked immunosorbent assay (ELISA). Equal amounts of viruses were used to infect GHOST-R3/X4/R5 cells. Twenty four hours later, cells were lysed in CAT lysis buffer. After removing the nuclei, the cytosolic fraction was used to determine the luciferase activity using a luciferase assay kit (Promega, Madison, WI). RNA Expression Analysis. MMTV target tissues were analyzed for ma3 RNA using reverse transcription-pcr (RT- PCR). Total RNA was isolated from tissues using RNeasy Mini Kit (Qiagen, Valencia, CA), treated with DNase I (Qiagen) and reverse transcribed using Mo-MLV Reverse Transcriptase (Invitrogen, Carlsbad, CA) and random primers. The cdna was amplified with ma3- or mouse β-actin-specific primers in the presence of.5 μcurie of α 32 P- datp, the products separated on a 1 % agarose gels and subjected to phosphorimager analyses (Molecular Dynamics STORM scanner 86). Bands were quantified using ImageQuant 5.2 (GE Healthcare, Piscataway, NJ). Data are presented as relative levels of ma3 normalized to the β-actin. Construction of ma3 -/- mice. 8

9 ES cell line XN45 with the gene trap vector in intron 4 of the ma3 gene was obtained from BayGenomics Gene Trap Project ( and injected into the blastocysts by Transgenic Knockout Shared Resource at UC Davis Mouse Biology Program, Davis, CA, to create chimeric mice. Chimeric mice were backcrossed to C57BL/6J mice (Jackson Laboratory, Jackson, ME) for nine generations and heterozygotes were crossed with each other to generate A3 -/- mice. Heterozygous mice for were generated by crossing A3 -/- to C57BL/6J mice. All mice were housed according to the policies of the Institutional Animal Care and Use Committees of the University of Pennsylvania and the University of California at San Francisco. Genotyping ma3 -/- mice The genotype of mice was determined by two parallel PCRs, using the same forward primer from exon 4, but different reverse primers: one primer from exon 5 and the other from the gene trap vector (Fig. S2). Genomic DNA was isolated with the Tissue genomic DNA isolation kit (Qiagen) and FastTaq polymerase (Roche) was used to amplify PCR products. PCR conditions were 5 min denaturation at 95 C and 3 cycles at 94 C for 1 min, 55 C for 3 sec, and 72 C for 1 min with final extension at 72 C for 1 min. ma3 Real-time PCR The absence of wild type ma3 product was confirmed by SyBr Green Real Time PCR performed with primers designed from exon 2 and exon 7. Total RNA from spleen was isolated with TRIZOL (Invitrogen), DNase I-treated (Qiagen) and reverse transcribed 9

10 using Moloney Murine Leukemia Virus Reverse Transcriptase (Invitrogen) and random primers. For the real-time PCR reaction 2x SybrGreen PCR Master Mix (Stratagene, La Jolla, CA) was supplemented with approximately 1 ng of cdna in addition to the appropriate primers (exon2 and 7 of ma3, mouse β-actin) and run on Mx35P (Stratagene). Primer sequences are available upon request. Real time PCR conditions were 1 min denaturation at 95 C and 45 cycles at 95 C 3 sec, 61 C 3 sec, 72 C 35 sec with 7 min final extension at 72 C. Samples without reverse transcriptase were run in parallel reactions to assay for genomic contamination. Data are presented as the relative levels of ma3 normalized to β-actin (Supplementary Fig. 3C). Cytidine deaminase assay The N-terminal region (197 aa) was amplified from a previously described ma3 construct 3 and linked to GST. The deaminase activity of GST purified mutant protein was measured by an in vitro deaminase assay as previously described 16. In vivo viral sequence editing assays Following DNA isolation from the spleens of MMTV(RIII)-infected ma3 -/- (n=3), ma3 +/- (n=1), and ma3 +/+ (n=2) mice using a DNeasy tissue kit (Qiagen), a 7 bp MMTV LTR fragment was PCR amplified using an MMTV(RIII)-specific primer pair (AATTCGGAGAACTCGACCTTCC and GAAGATCTTCAAGGGCAATGCCTTAATACTA). Amplified fragments were purified by agarose gels and cloned into pcr2.1-topo vector (Invitrogen). At least eight clones 1

11 from each group of mice were sequenced. Sequences were aligned using Multiple sequence alignment with hierarchical clustering 3. References in Supplementary Methods 3. Corpet, F. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res. 16, (1988). 11