R r. R r. R r. R r. R r. R r. R r

Transcription

1

2

3

4

5 R r R r R r R r R r R r R r

6 The Gurdon experiment: Does every cell in an organism contain all the genetic information to make a complete individual?

7 Host egg Unfertilized egg Ultraviolet radiation of egg to destroy nucleus Enucleated egg

8 Host egg Donor nucleus

9 Host egg Donor nucleus

10 How is genetic information copied every time a cell divides? The two strands separate and each strand is used as a template for the synthesis of a new strand.

11 How is genetic information copied every time a cell divides? DNA polymerase is the enzyme (protein) that carries out DNA replication.

12 Bacteria have about 5 million basepairs of DNA. Bacteria can divide every 20 minutes. DNA polymerase replicates bacterial DNA at a rate of 4200 basepairs/second.

13 What is a gene? Genes are the basic units of inheritance. Genes are information to make proteins. one gene one protein

14 Most higher organisms have 15,000-35,000 different genes These organisms have the information (DNA) to make 15,000-35,000 different proteins

15 How is genetic information stored in DNA? As a sequence of bases (ATGCATTCGCAATT )

16 The sequence of bases in DNA determines the sequence of amino acids in a protein. The sequence of amino acids in a protein determines the 3-D shape of the protein. The 3-D shape of the protein determines the function of the protein.

17 Hemoglobin

18 DNA Polymerase

19 DNA cutting enzyme

20 Receptor protein

21 Genes are arranged on chromosomes like beads on a string DNA Gene 1 Gene 2 Gene 3 Gene 4 Gene 5

22 Chromosome Gene 1 Gene 2 Gene 3 Gene 4 Gene 5 A typical chromosome has thousands of genes Humans have 23 pairs of chromosomes (46 total) Fruit Flies have 4 pairs of chromosomes (8 total) Arabidopsis has 5 pairs of chromosomes (10 total)

23 Genes code for proteins chromosome Gene 1 Gene 2 Gene 3 Gene 4 Gene 5 Protein 1 Protein 2 Protein 3 Protein 4 Protein 5

24 Central Dogma of Biology

25 Transcription: DNA RNA nucleus cytoplasm DNA RNA

26 RNA is transported to cytoplasm nucleus cytoplasm DNA RNA RNA

27 Translation: RNA protein nucleus cytoplasm DNA RNA protein

28 DNA RNA protein nucleus cytoplasm DNA RNA RNA protein

29 Properties of DNA Double stranded Deoxyribonucleic acid Bases: A, G, C and T Properties of RNA Single stranded Ribonucleic acid Bases: A, G, C and U (U = uracil)

30 Central Dogma of Biology DNA RNA protein GGC TGT GGC TAG CCG ACA CCG ATC transcription GGC UGU GGC UAG DNA (bases) RNA (bases) transcription

31 transcription translation The code in RNA is read three bases at a time

32 Central Dogma of Biology DNA RNA protein GGC TGT GGC TAG CCG ACA CCG ATC GGC UGU GGC UAG Gly transcription translation DNA (bases) RNA (bases) Protein (amino acids) transcription translation

33 Central Dogma of Biology DNA RNA protein GGC TGT GGC TAG CCG ACA CCG ATC GGC UGU GGC UAG Gly - Cys transcription translation DNA (bases) RNA (bases) Protein (amino acids) transcription translation

34 Central Dogma of Biology DNA RNA protein GGC TGT GGC TAG CCG ACA CCG ATC GGC UGU GGC UAG Gly - Cys - Gly transcription translation DNA (bases) RNA (bases) Protein (amino acids) transcription translation

35 Central Dogma of Biology DNA RNA protein GGC TGT GGC TAG CCG ACA CCG ATC transcription GGC UGU GGC UAG translation DNA (bases) RNA (bases) transcription translation Gly - Cys - Gly Stop Protein (amino acids)

36 The Genetic Code is Universal AUG codes for the amino acid methionine in all organisms (bacteria, fungi, plants, and animals) GGC codes for the amino acid glycine in all organisms (bacteria, fungi, plants, and animals)

37 The Genetic Code is Universal This fact proves one of Darwin s most remarkable predictions: All life forms evolved from a common ancestor.

38 What is a mutation? A mutation is a change in the base sequence in DNA that results in a change in the amino acid sequence of a protein.

39 normal GGC TGT GGC TAG CCG ACA CCG ATC transcription DNA mutant GGC TAT GGC TAG CCG ATA CCG ATC transcription GGC UGU GGC UAG translation RNA GGC UAU GGC UAG translation Gly - Cys - Gly Stop Protein Gly - Tyr - Gly Stop

40 A gene is composed of two parts: ON OFF regulatory region (on/off switch) coding region (codes for amino acids)

41 Transcription factors turn genes on and off. Transcription factors are proteins that bind to a specific base sequence in DNA. AGCCTACCAAAAAAGGTTCCACG TCGGATGGTTTTTTCCAAGGTGC

42 - Some transcription factors are activators: They turn genes ON. regulatory region (on/off switch) coding region (codes for amino acids)

43 - Some transcription factors are activators: They turn genes ON. - Some transcription factors are repressors: They turn genes OFF. regulatory region (on/off switch) coding region (codes for amino acids)