Name: Period: Date: BIOLOGY HONORS DNA REVIEW GUIDE (extremely in detail) by Trung Pham. 5. What two bases are classified as purines? pyrimidine?

Transcription

1 BIOLOGY HONORS DNA REVIEW GUIDE (extremely in detail) by Trung Pham 1. What is the base pair rule for DNA? RNA? 2. What is the sugar found in RNA called? 3. is replaced by the base uracil in RNA? 4. What is the shape of a DNA? RNA? 5. What two bases are classified as purines? pyrimidine? 6. DNA is composed of repeating monomers called? 7. What would be the complementary DNA strand for the following DNA sequences? ATTCGC- CGCATC- ACCGCTGAATGCTAGCTAGGACCTTA- 8. Why can the DNA not leave the nucleus? What is made in order for DNA to give the instructions of making proteins to the ribosomes? 9. What important polymer is the blueprint of life? 10. Label EVERY sugar(s), phosphate (P), and nitrogen base (A, T, C, G) in the diagram below. 11. Examine the objects inside the box labeled #2. What is this called? 12. What type of chemical bond joins the two DNA bases together? 13. What type of chemical bond joins the two nucleotides together?

2 14. What does DNA stand for? Why is it called so? 15. What does RNA stand for? Why is it called so? 16. List the 4 nitrogen-containing bases of DNA? RNA? 17. What two scientists discovered the structure of DNA (they won the Nobel Prize)? 18. DNA is a monomer or polymer? 19. Nucleotide is a monomer or polymer? 20. took diffraction x-ray photographs of DNA crystals? 21. How many hydrogen bonds hold adenine and thymine together? 22. How many hydrogen bonds hold guanine and cytosine together? 23. A five-carbon sugar is also called? 24. A nucleotide is made of what? 25. During what phase does the DNA copy itself? 26. Where are proteins made in the cell? 27. What makes up the backbone of the DNA molecule? 28. Fill in the blank the differences between DNA and RNA?

3 29. Name 3 types of RNA and describe their roles. 30. What is the start codon for protein synthesis? What is the amino acid for that codon? 31. What type of bond is formed between amino acids? 32. What is the difference between an amino acid and a protein? 33. A chain of amino acids is called what? 34. Where does transcription occur? translation? 35. What is a codon? 36. How many codon(s) would code for an amino acid? 37. mrna has codons or anticodons? trna has codons or anticodons? 38. What enzyme breaks the hydrogen bonds of the DNA? 39. What enzyme adds the new nucleotides during DNA replication?

4 40. What is the site of the trna molecule binds to the mrna molecule called? 41. Identify this molecule. 42. Identify this molecule. 43. Identify this organelle. 44. Identify this molecule. 45. Identify these molecules.

5 46. Identify these molecules. 47. What is this called? 48. Put a checkmark underneath or circle any that is a source of protein. 49. How many proteins can our bodies produce? Where do we get the remaining 8 from? 50. Define replication, transcription, and translation. 51. Name the 3 stop codons. 52. What is located on top of trna? 53. How many units make up a ribosome? 54. What is meant by complementary base pairing in DNA? 55. Which of your body s cells contain DNA? a. Only your reproductive cells b. Only your blood cells c. Only your bone cells d. Virtually all your body s cell

6 56. How many codons are needed to specify three amino acids? 57. What must happen to a DNA molecule before RNA polymerase can make RNA? 58. What causes translation to stop? 59. Do all living organisms have DNA? 60. What does the shape of trna look like? 61. What would be the complementary RNA sequence for the following DNA sequence? 5 -GCTAGCGATAGTCGATCGATCGGGAATCAGTTTACGATCGATTTAAGCTTAGGACGATTAGGC Explain why DNA is said to be antiparallel? AP QUESTION PRACTICE (unrequired) 1. Which of the following is a false statement regarding deoxyribonucleic acid (DNA)? a. Each deoxyribonucleic acid molecule is composed of two long chains of nucleotides arranged in a double helix. b. Genes are composed of deoxyribonucleic acid. c. DNA is composed of chemical building blocks called nucleotides. d. DNA is a code for the sequence of amino acids in a protein. e. DNA is an enzyme that puts together amino acids to make a protein. 2. Which of the following types of cells utilize deoxyribonucleic acid (DNA) as their genetic material but do not have their DNA encased within a nuclear envelope? a. Animal b. Plant c. Archaea d. Fungi e. Protists 3. Of the following functions, the major purpose of RNA is to a. transmit genetic information to offspring. b. function in the synthesis of protein. c. make a copy of itself, thus ensuring genetic continuity. d. act as a pattern or blueprint to form DNA. e. form the genes of higher organisms.

7 4. Which of the following best describes the flow of information in eukaryotic cells? a. DNA RNA proteins b. RNA proteins DNA c. proteins DNA RNA d. RNA DNA proteins e. DNA proteins RNA 5. If a DNA sample were composed of 10% thymine, what would be the percentage of guanine? a. 10 b. 20 c. 40 d. 80 e. impossible to tell from the information given 6. Organelles other than the nucleus that contain DNA include a. ribosomes. b. mitochondria. c. chloroplasts. d. B and C only e. A, B, and C