Samples. Initially, 46 routine liquid-based cervical cytology samples were tested with three HPV

Transcription

1 Supplementary Information Supplementary Materials and Methods Samples. Initially, 46 routine liquid-based cervical cytology samples were tested with three HPV consensus primer sets. These samples had tested positive with the Digene HC2 High-Risk HPV Test (Qiagen). Sequencing and linear array (LA) HPV Genotyping Test (1) were compared with 105 unselected, liquid-based, cervical cytology samples. These samples had tested positive with the Digene HC2 High-Risk HPV Test or the cobas 4800 HPV Test (Roche Diagnostics). Cell Culture. HPV-positive CaSki (CRL-1550, ATCC) and HeLa (CCL-2, ATCC) cell lines were cultured in Dulbecco s modified Eagle s medium (Life Technologies) supplemented with 10% fetal bovine serum (Atlanta Biologicals), penicillin (100 U/mL, Cellgro), and streptomycin (100 µg/ml, Cellgro). All cells were maintained in a 5% CO 2 incubator at 37 C. Cells were counted with a Beckman Coulter Z2 Coulter Particle Count and Size Analyzer. DNA extraction, PCR, and sequencing. DNA was extracted from HPV-positive cell lines with the Maxwell 16 instrument using the Maxwell Blood DNA Kit (Promega). DNA from endocervical samples was extracted with the cobas 4800 HPV Test (Roche Diagnostics) on a cobas x 480 instrument (Roche Diagnostics). HPV DNA was then PCR amplified with HPV consensus primers, GP5+/6+ (2) or MY09/11 (8) at 300nM or PGMY09/11 (5) at 200 nm, using the FastStart PCR Master mix (1). The PGMY09/11 primer set consists of 5 forward and 13 reverse primers and has been shown to improve the number of mixed infections detected over other primer systems (5). Amplification conditions were 4 min at 95 C, 40 cycles of 30 s at 95 C, 30 s at 55 C, and 60 s at 72 C, followed by 7 min extension at 72 C. PGMY09/11 PCR reactions (2.5 µl of a 35 µl reaction) were also subjected to second round amplification with 1

2 either the GP5+/6+ or PGMY09/11 primers. PGMY09/11 primers flank the GP5+/6+ primer set and both can be used in a nested format (3). PCR products were isolated with the QIAquick PCR Purification Kit (Qiagen) including an additional wash step to improve removal of PCR primers. PCR product (60 ng) and primer concentrations (10 pmol of each oligonucleotide in PGMY09/HMB01 or PGMY11 primer mixes) were optimized for sequence quality. Sequencing was performed at the University of Utah Sequencing Core Facility. Plasmid. The HPV E6E7 coding sequence of HPV16 and HPV18 were cloned from CaSki (HPV16) and HeLa (HPV18) DNA. HPV16 E6E7 or HPV18 E6E7 were PCR amplified with primers (HPV16-E6E7-FOR, CCCGGATCCCCATGCACCAAAAGAGA; HPV16-E6E7-REV, CCCGGATCCCCTTATGGTTTCTGAGAAC; HPV18-E6E7-FOR, CCCGGATCCCCATGGCGCGCTTTGAGG; and HPV18-E6E7-REV, CCCGGATCCCCTTACTGCTGGGATGCAC) and cloned into pcr2.1-topo (Life Technologies) resulting in plasmids phpv16 and phpv18. In addition, a ~450-bp fragment of the L1 region was cloned from an HPV52-positive sample using PGMY09/11 primers. The resulting PCR product was gel purified using the QIAquick Gel Extraction Kit (Qiagen) and cloned into pcr2.1-topo producing plasmid phpv52. All plasmids were confirmed by sequencing. Plasmid concentrations were determined in triplicate with a NanoDrop 8000 Spectrophotometer (Thermo Scientific). HPV Copy Number Determination. HPV16 and HPV18 copy numbers in DNA extracted from CaSki and HeLa cells were determined by quantitative PCR (qpcr) using standard curves of serially diluted phpv16 or phpv18. Amplifications were performed in triplicate using an ABI 2

3 7900 thermocycler (Applied Biosystems) and the following primers and probes (Applied Biosystems): HPV16 probe, 5'-FAM-AATCATGCATGGAGATACACCTACATTGCATGA-3'- TAMRA; HPV16 forward primer, TTGCAGATCATCAAGAACACGTAGA; HPV16 reverse primer, CAGTAGAGATCAGTTGTCTCTGGTTGC; HPV18 probe, 5'-FAM- TCCTGTCGTGCTCGGTTGCAGC-3'-TAMRA; HPV18 forward primer, AGAGGCCAGTGCCATTCGT; and HPV18 reverse primer, GTTTCTCTGCGTCGTTGGAGT (7). qpcr reactions were performed in a final volume of 25 µl using Taqman Universal PCR Master Mix (Applied Biosystems), 900 nm forward primer, 900 nm reverse primer, 250 nm probe, and 125 ng of DNA. Amplification conditions were 2 min at 50 C, 10 min at 95 C, followed by 45 cycles of 15s at 95 C and 60 s at 60 C. Quantified phpv52 was used as the source of HPV52 DNA. Reference database. The RipSeq Mixed reference database was initially populated with 67 sequences from the Los Alamos HPV sequence database (Table S1). In addition, up to six HPV reference sequences were added for each genotype detected by the LA assay to represent sequence diversity for a total of 160 reference sequences covering 75 different HPV genotypes. Interpretation of chromatograms. Bidirectional sequence chromatograms were interpreted with the RipSeq Mixed web application (isentio) and the custom reference database. Criteria for positive identification with the RipSeq Mix program have been described previously (6). Sequence chromatograms were initially analyzed with a signal cutoff of 50 (y-coordinate). If RipSeq Mixed indicated additional genotype results below this signal cutoff, it was dropped further in an iterative fashion to a point where RipSeq Mixed was still capable of interpreting 3

4 chromatograms. Occasionally, samples with more than three genotypes required the signal cutoff to be raised above 50, as the software cannot accurately resolve more than three genotypes. Linear array genotyping. LA testing was performed as described by the manufacturer with the exception of DNA extraction, which was performed with the cobas 4800 HPV Test and a cobas x 480 instrument. DNA was stored at 4 C for up to 55 days. The cobas assay extraction control was assayed on the LA to ensure sample integrity. Because the cobas HPV extraction uses a different elution buffer, the ph of the activated LA master mix was adjusted with 10 µl of 1M Tris buffer at ph 7.4 (44). The LA uses biotinylated PGMY09/11 consensus primers to amplify a ~450-bp fragment of the L1 region. The PCR product is hybridized to immobilized oligonucleotide probes. Results are interpreted by comparing blue lines to a reference guide. The assay can identify 37 HPV genotypes including 14 HR HPV types. 4

5 SUPPLEMENTAL TABLES Table S1. Resolution of mixed chromatograms resulting from two or three HPV genotypes at various concentrations. HPV16 Copy Number HPV18 Copy Number HPV52 Copy Number RipSeq Genotype Result 1X10 5 1X10 5 HPV16, HPV18 1X10 5 1X10 4 NA HPV16, HPV18 1X10 5 1X10 3 HPV16 1X10 5 1X10 5 HPV16, HPV18 1X10 4 1X10 5 NA HPV18 1X10 3 1X10 5 HPV18 1X10 6 1X10 6 1X10 6 HPV18, HPV52 1X10 6 1X10 6 1X10 5 HPV18, HPV16 1X10 6 1X10 6 1X10 4 HPV18, HPV16 1X10 6 1X10 6 1X10 6 HPV18, HPV52 1X10 6 1X10 5 1X10 6 HPV18, HPV52 1X10 6 1X10 4 1X10 6 HPV16, HPV52 1X10 6 1X10 6 1X10 6 HPV18, HPV52 1X10 5 1X10 6 1X10 6 HPV18, HPV52 1X10 4 1X10 6 1X10 6 HPV18, HPV52 5

6 Table S2. HPV sequences used in the custom RipSeq Mixed reference database. HPV Genotype Accession Number 3 X X M FR751338, FR751336, FR X M X X FN907959, FN907963, M14119, HE X X X K02718, EU918764, FJ006723, FJ X GQ180791, AY262282, GQ180789, X X U U U U U X X74472, NC_ X U U X HQ537683, HQ537666, J04353, HQ X EU918766, HQ537706, HQ537704, M X HQ537730, HQ537728, HQ537726, M U U U U45901, U45905, U45903, M HE793055, HE793059, X74478, HE X A28090, GQ472847, M U EF202163, X74479, EF202167, EF M

7 Continued HPV Genotype Accession Number 48 U X U45917, AB438954, AB438955, M HQ537742, X74481, HQ537736, HQ EF546481, NC_001593, X74482, GQ AF436129, NC_001676, U12501, U U12494, U EF177180, EF177178, X74483, EF X HQ537776, EU918765, D90400, HQ U45933, DQ486471, X77858, EU U U12500, EU779753, U U12499, AY395706, EF X U X70829, X EF177191, EF177184, U31794, EF177190, EF177186, EF HQ537784, HQ537781, U12492, D FR751039, GQ472851, DQ080079, EU AB027020, U U22461, U21941, EF AY330621, AY330622, AY330623, AB X94164, X EF626590, EF626590, GQ288792, AJ AJ831565, AB027021, AF AF AF D X R Not Yet in Genbank 1A V B D D M B X00203 CP6108 U12478, AF

8 Table S3. Frequency of HPV genotypes identified in either the sequencing or LA assay. LA, Linear Array; HPV, human papillomavirus. *HPV32 is not targeted by LA HPV Genotype RipSeq (n) LA (n) * CP IS

9 References LINEAR ARRAY HPV Genotyping Test. Roche Molecular Systems, Branchburg, NJ. 2. de Roda Husman, A. M., J. M. Walboomers, A. J. van den Brule, C. J. Meijer, and P. J. Snijders The use of general primers GP5 and GP6 elongated at their 3' ends with adjacent highly conserved sequences improves human papillomavirus detection by PCR. J Gen Virol 76 ( Pt 4): Fuessel Haws, A. L., Q. He, P. L. Rady, L. Zhang, J. Grady, T. K. Hughes, K. Stisser, R. Konig, and S. K. Tyring Nested PCR with the PGMY09/11 and GP5(+)/6(+) primer sets improves detection of HPV DNA in cervical samples. Journal of virological methods 122: Gage, J. C., M. Sadorra, B. J. Lamere, R. Kail, C. Aldrich, W. Kinney, B. Fetterman, T. Lorey, M. Schiffman, and P. E. Castle Comparison of the cobas Human Papillomavirus (HPV) test with the hybrid capture 2 and linear array HPV DNA tests. J Clin Microbiol 50: Gravitt, P. E., C. L. Peyton, T. Q. Alessi, C. M. Wheeler, F. Coutlee, A. Hildesheim, M. H. Schiffman, D. R. Scott, and R. J. Apple Improved amplification of genital human papillomaviruses. J Clin Microbiol 38: Kommedal, O., B. Karlsen, and O. Saebo Analysis of mixed sequencing chromatograms and its application in direct 16S rrna gene sequencing of polymicrobial samples. J Clin Microbiol 46:

10 7. Lindh, M., S. Gorander, E. Andersson, P. Horal, I. Mattsby-Balzer, and W. Ryd Real-time Taqman PCR targeting 14 human papilloma virus types. J Clin Virol 40: Manos, M. M., Y. Ting, D.K. Wright, A.J. Lewis, T.R. Broker, and S.M. Wolinsky The use of polymerase chain reaction amplification for the detection of genital human papillomaviruses. Cancer Cells 7: