ZBED6 the birth of a transcription factor in placental mammals. Wild Boar X domestic pig intercross initiated 1989

Transcription

1 the birth of a transcription factor in placental mammals Wild Boar X domestic pig intercross initiated 1989 X Göran Andersson F1 X F1 Swedish University of Agricultural Sciences ALLBIO- Scilife-UPPNEX-BILS course 15 May F 2 QTL mapping of fatness traits in the Wild Boar intercross, a model for mild obesity in humans Strong selection for lean growth in commercial lines of pigs has enriched for mutations reducing fat deposition Wild boars have the capacity to store excess food as fat QTL analysis revealed two major loci on chr. 2 and chr. 4 controlling a large proportion of the difference in fat deposition between the Wild Boar and Large white domestic pigs. A paternally expressed QTL affecting skeletal and cardiac muscle mass in pigs maps to the IGF2 locus F ratio Pig Chromosome 2 0.1% 5% 5% Lean meat in ham Lean meat mass in ham Longissimus muscle area Heart Average back fat depth Birth weight Abdominal fat 0.1 % Genome wide significance 5 % Genome wide significance 5 % Suggestive significance The QTL allele from domestic Large White pig increases muscle content with 3-4%, reduces subcutaneous fat and increase the size of the heart

2 Comparative sequencing of TH-INS-IGF2 in pigs, human and mice The paternally expressed IGF2 QTL has major phenotypic effects Trait W/W D/D % of variance % Meat in ham Subcutaneous fat (mm) Heart weight (gr) b VISTA-plot IGF-II gene structure Ten exons, 1-7 non-coding Four promoters, P1-P4 IGF2 P1 E1 P2 P3 P4 E2 E3 E4 E4b E5 E6 E7 E8 E9 E7 - E9 are Coding exons IGF2-AS E5 E4 * E3 E2 E1 a b c E3 E2b d 30 kb

3 Resequencing of 15 chromosomes classified as «Q» or «q» identified the Quantitative Trait Nucleotide (QTN) The QTN located in IGF2 intron 3 is part of an Evolutionary Conserved Region Pig.q CCTGCCCGCGGCGGCAGCCGGGCCGCGGCTTCGCCTAGGCTCGCAGCGCGGGAGCGCGTGGGGCGCGGCGGCGGCGGGGAG Pig.Q...A... Bovine...TC...A... Horse...G...C..T... Dog...C...AT... Rabbit...C...G...C...A...A.T... Human...T.C...T...G..TC...AG...A...A.T...AG... Mouse T...C...T...T...C..A...G...TCT...A.G... Rat T...C...C...C...C..A...G...CT...A.G...A.T...A 16 bp around the QTN is 100% identical among 18/18 placental mammals Inpigsthatcarrythemuta1on Electrophore1cMobilityShiEAssay!!!!!!Postnatally: 36fold!ofIGF2% mrnainskeletal muscleandheart, butnotliver. mrna, IGF2/GAPDH Mutant Wild-type 1.5 * * ** 1 * 0.5 * 0 fetal 3 w 2 m 4 m 6 m 3 w 4 m 3 w 4 m Muscle heart liver C2C12 cell (myoblast) nuclear extracts q Q Whatisthisprotein? Does!the!muta/on!affect!binding!with!some!transcrip/on!factor?! Nature 425 (2003) Wild boar (q) Large white (Q) CTAGGCTCGCAGCGCGG CTAGGCTCA CAGCGCGG Nature 425 (2003)

4 Identification of a novel protein! Stable Isotope Labeling with AA in Cell Culture 13C66L6Arg Naturalisotopes 13C6,15N26L6Lys Light bead CTAGGCTCGCAGCGCGG Large white (Q) CTAGGCTCACAGCGCGG Heavy nuclearextracts A Wild Boar (q) G bead wildtype mutated Liquid Chromatography Mass Spectrometry (LCMS) PLoS Biology 7 (2009) belongstothehatsuperfamily! Domes1catedDNAtransposon Performsimportantfunc1onsinplacentalmammals. Recentlyiden1fiednovelmammaliantranscrip1onfactor. RepressorofIGF2P3andP4transcrip1oninskeletal muscle (Anderssonetal.,!2010)(VanLaereetal.,2003)(Markljungetal.,2009)! hatc dimerization domain Zn2+ finger BED domain (hobo from Drosophila, Activator from maize and Tam3 from snap-dragon) Human Chromosome 1 PLoS Biology 7 (2009)

5 Known!ZBED!Genes! Func/ons!of!other!ZBEDs! DHRSX Y Intron 1 ZBED1! Zc3h11a Intron 1 CD96 Intron 6 3 ZBED2! ZBEDS! 1! ZBED5! 11 5 ZBED3! 22 ZBED4! ZBED1playsanimportantroleincellprolifera1onandregulates transcrip1onofdnapolgeneanddifferentgenesencoding ribosomalproteins(yamashitaetal,2003) ZBED3bindswithaxinandisinvolvedinwnt/βcateninsignaling (Chenetal.,2009) ZBED26>? ZBED4isexpressedinhumanre1naandactsasregulatorof nuclearhormonereceptor(saghizadehetal.,2009). ZBED5(buster1/charlie6liketransposon)6>? ZBED!domains! Protein Tree BUSTER Family BE D hatc ZBED1 ZBED4 ZBED2 & 3 AC Family ZBED5 ZBED2 ZBED1 ZBED3

6 isadomes1catedtransposonthat hitch6hikes onthezc3h11apromoter The DNA binding BED domain in is extremely well conserved among mammals bp ZC3H11A Intron retention: Normal intron splicing: ZC3H11A PLoS Biology 7 (2009) is an innovation in placental mammals Immunohistochemistry shows that has a broad tissue distribution during development and in adult mice and a nuclear localization ZC3H11A

7 isenrichedinthenucleolus Efficient silencing of Zbed6 in mouse C2C12 cells Nucleophosmin Merge PLoS Biology 7 (2009) Luciferase assay provides conclusive evidence that is the nuclear factor interacting with the CpG island in IGF2 intron 2 Luciferase assay provides conclusive evidence that is the nuclear factor interacting with the CpG island in IGF2 intron 2 pigf2 P3 Luciferase pigf2 P3 Luciferase pigf2 - q pigf2 P3 Luciferase pigf2 - q pigf2 P3 Luciferase pigf2 - Q pigf2 P3 Luciferase pigf2 - Q pigf2 P3 Luciferase Rela/ve!Luciferase!Units,!firefly/renilla! 45! 40! 35! 30! 25! 20! 15! 10! 5! 0! P3!promoter! WildJtype! 185bp! WildJtype! 145bp! Mutant!185bp!Mutant!145bp! Rela/ve!Luciferase!Units,!firefly/renilla! 16! 14! 12! 10! 8! 6! 4! 2! 0! P3!promoter!!siRNA!50nm! WildJtype! 185bp! WildJtype! 145bp! Mutant!185bp! Mutant!145bp!

8 repressionisnotpromoter6specific Relative luciferase units Mouse, myoblast SV40 + enhancer SV40 + enh + wild-type qtn SV40 + enh + mutant QTN ChIP-sequencing reveals about 2,500 Zbed6 binding sites in C2C12 cells Relative Luciferase Units Human, rhabdomyosarcoma SV40 + enhancer SV40 + enh + wild-type qtn SV40 + enh + mutant QTN Zbed6 binds preferentially to the vicinity of start of transcription sites (TSS) and CpG islands Gene Ontology classifications show a striking overrepresentation of certain biological functions The results suggest that has an important regulatory role in placental mammals

9 Figure!1.!RNA!sequencing!of!Zbed6Jsilenced!myoblast!cells.! How does mediate transcriptional regulation of downstream targets? Modulates the Transcription of Myogenic Genes in Mouse Myoblast Cells. Jiang L, Wallerman O, Younis S, Rubin C-J, et al. (2014) Modulates the Transcription of Myogenic Genes in Mouse Myoblast Cells. PLoS ONE 9(4): e doi: /journal.pone Figure!2.!Muscle!proteins!were!significantly!enriched!among!the!differen/ally!expressed!(DE)!genes.! Table!2.!Analysis!of!the!correla/on!between!differen/al!gene!expression!(DE)!a]er!Zbed6!silencing!and!the! presence!of!!binding!sites!within!5!kb!of!the!transcrip/on!start!site!(tss).! Jiang L, Wallerman O, Younis S, Rubin C-J, et al. (2014) Modulates the Transcription of Myogenic Genes in Mouse Myoblast Cells. PLoS ONE 9(4): e doi: /journal.pone Jiang L, Wallerman O, Younis S, Rubin C-J, et al. (2014) Modulates the Transcription of Myogenic Genes in Mouse Myoblast Cells. PLoS ONE 9(4): e doi: /journal.pone

10 Figure!5.!!modulates!the!expression!of!Igf2!and!Myogenin!during!differen/a/on!of!C2C12!cells.! The mutation at the binding site at the CpG site in pig IGF2 intron 3 - does not alter the status of imprinting - does not lead to gross changes in DNA methylation patterns Jiang L, Wallerman O, Younis S, Rubin C-J, et al. (2014) Modulates the Transcription of Myogenic Genes in Mouse Myoblast Cells. PLoS ONE 9(4): e doi: /journal.pone Figure!4.!Histone!modifica/ons!associated!with!!target!sites!and!other!sites!in!C2C12!myoblast!cells.! ChIP6seqdataforandsixhistone modifica1onsinc2c12myoblastcells Average coverage! Active promoters Enhancers Repression Jiang L, Wallerman O, Younis S, Rubin C-J, et al. (2014) Modulates the Transcription of Myogenic Genes in Mouse Myoblast Cells. PLoS ONE 9(4): e doi: /journal.pone Zbed6 Distance to Zbed6 binding sites!

11 G Modelforfunc1on IGF2 G Wild boar GCTCG Repressed state Chinese Meishan A Mutation at target site Epigenetic activation Downregulation Loss-offunction A Hampshire Pietrain X Me GCTCA GCTCG GCTCG GCTCG Active state PLoS Biology 7 (2009) Acknowledgements Elizabeth Gilbert, Lin Jiang, Awaisa Ghazal, Shady Yunis, Carl-Johan Rubin, Ola Wallerman, Anna-Maja Molin, Rajesh Gupta, Elisabeth Sundström, Anders Lindroth, Göran Hjälm, Leif Andersson Broad Institute: Li Wang, Xiaolan Zhang, Tarjei Mikkelsen, Kerstin Lindblad-Toh, and the Broad Institute Epigenomics Initiative