Isolation of human ips cells using EOS lentiviral vectors to select for pluripotency

Transcription

1 nature methods Isolation of human ips cells using EOS lentiviral vectors to select for pluripotency Akitsu Hotta, Aaron Y L Cheung, Natalie Farra, Kausalia Vijayaragavan, Cheryle A Séguin, Jonathan S Draper, Peter Pasceri, Irina A Maksakova, Dixie L Mager, Janet Rossant, Mickie Bhatia & James Ellis Supplementary figures and text: Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Figure 4 Supplementary Figure 5 Supplementary Figure 6 Supplementary Figure 7 Supplementary Figure 8 Supplementary Figure 9 Supplementary Figure 1 Supplementary Figure 11 Supplementary Figure 12 Supplementary Table 1 Supplementary Table 2 Sequence of the Oct-4 core enhancer element (CR4) and Sox2 core enhancer element (SRR2) EOS lentiviral vectors specifically express in mouse ES cells but not in fibroblasts EOS vectors extinguish upon in vitro differentiation of mouse ES and ips cells EOS vectors extinguish upon in vitro differentiation of human ES cells EOS lentiviral vectors are not expressed in primary human dermal fibroblasts (HDFs) and cell lines Co-expression of EOS and pluripotency markers in H1 human ES cells Morphology and EOS- expression of established mouse ips cell lines EOS vector integration and copy number in mouse ips cell lines by Southern blot analysis EOS vector integration and copy number in mouse ips cell lines by Southern blot analysis In vitro differentiation of mouse ips cell lines into the three germ layers In vivo differentiation of mouse ips cell lines into teratomas Endogenous pluripotency marker expression in human ips cell lines Primers used in the study Antibodies used in the study

2 Supplementary Fig. 1, Sequence of the Oct-4 core enhancer element (CR4) and Sox2 core enhancer element (SRR2). Oct-4 enhancer: Conserved Region 4 (CR4) Oct-4 locus DE PE 1kb CR4 CR3 CR2 CR1 GGGTGTGGGGAGGTTGTAGCCCGACCCTGCCCCTCCCCCCAGGGAGGTTGAGAG Sp1 TTCTGGGCAGACGGCAGATGCATAACAAAGGTGCATGATAGCTCTGCCCTGGGGG Oct Sox CAGAGAAGATGGTTGGGGAGGGGTCCCTCTCGTCCTAG Sox2 enhancer: Sox Regulatory Region 2 (SRR2) Sox2 locus 1kb SRR1 SRR2 CCAGTCCAAGCTAGGCAGGTTCCCCTCTAATTAATGCAGAGACTCTAAAAGAATTTC CCGGGCTCGGGCAGCCATTGTGATGCATATAGGATTATTCACGTGGTAATGAGCAC AGTCGACAGTTCTTGC Sox Oct Solid bar indicates Oct-4 or Sox2 transcript, and box indicates exons. Known Sp1, Oct-4 and Sox2 binding sites are indicated. DE:distal enhancer, PE:proximal enhancer.

3 Supplementary Fig. 2, EOS lentiviral vectors specifically express in mouse ES cells but not in fibroblasts. Mouse ES MEF Virus 1 µl Virus 1 µl PL-PGK 92.4%.5% PL-EF1! 94.2% 86.8% PL-Oct4 31.9%.1% PL-Nanog 49.6% 3.2% C(3+) 73.% 2.% S(4+) 82.% 3.5% Lentiviral vectors were infected into J1 mouse ES cells or MEFs separately and simultaneously. expression was analyzed by flow cytometry 3 days after infection. Mouse ES cells were infected with 1 µl of concentrated virus (left panel) and MEFs were infected with 1 µl of concentrated virus (right panel).

4 a Supplementary Fig. 3 EOS vectors extinguish upon in vitro differentiation of mouse ES and ips cells. Differentiated ES cells b Residual undifferentiated ES cells EOS3F-28 EOS3F-29 EOS3F-24 S(4+) S(4+) C(3+) C(3+) PL-PGK PL-PGK c Differentiated ips cells (a) Fluorescent microscopy shows that EOS expression in mouse ES cells is extinguished upon in vitro differentiation, whereas the control PGK vector retains its expression. J1 mouse ES cells were infected with 1 µl of the indicated lentiviral vector and differentiated as described in the Methods section. Scale bars,!m. (b) EOS- positive cells after in vitro differentiation of mouse ES cells show continued ES-like colony morphology indicating that the vectors mark pluripotent cells that fail to differentiate. Scale bars,!m. (c) EOS3F-24 mouse ips cell line shows continued EOS- expression and ES-like colony morphology indicating that the vectors mark pluripotent cells that fail to differentiate. Scale bars,!m.

5 Supplementary Fig. 4, EOS vectors extinguish upon in vitro differentiation of human ES cells. PL-PGK, 1 µl PL-EF1!, 1 µl PL-Oct4, 1 µl PL-Nanog, 1 µl C(3+), 1 µl S(4+), 1 µl Fluorescent microscopy analysis shows that EOS expression in human ES cells is extinguished upon in vitro differentiation by retinoic acid for 9 days, whereas control PGK and EF1! vectors retained their expression. We infected CA-1 human ES cells with 1 µl of lentivirus for PGK and EF1a vectors, and 1 µl for the other vectors. Scale bars,!m.

6 Supplementary Fig. 5, EOS lentiviral vectors are not expressed in primary human dermal fibroblasts (HDFs) and cell lines. a b PL-PGK PL-EF1! PL-Oct4 PL- Nanog C(3+) % % % %.5% PL-EF1! PL-PGK C(3+) S(4+) % T 48.%.6% % HeLa 28.9% % % 4.9% K % % % % S(4+) 1.8% (a) Primary HDFs were isolated from a skin biopsy and infected with 1 µl (flow cytometry) or 1 µl (microscope image) of concentrated lentiviral vectors. Mockinfected HDFs were used as a negative control for flow cytometry (red line). Scale bars,!m. (b) 293T (human embryonic kidney cell line), HeLa (human epithelial carcinoma cell line), and K562 (human erythromyeloblastoid leukemia cell line) cells were infected with 1 µl of concentrated lentiviral vectors. Red lines indicate mockinfected negative control of each cell type.

7 Supplementary Fig. 6, Co-expression of EOS and pluripotent markers in H1 human ES cells. a IGF-1R hesc-cic Frequency of 1 in 1, Passage P1 P2 Analysis b SSC SSEA-3 SSC IGF-1R SSEA-3 SSEA-3 + IGF-1R IGF-1R (a) H1 human ES cells transduced with the C(3+)- vector were used to isolate the subset of primitive IGF-1R expressing cells that co-express EOS- (indicated by a box). Sorted cells were then subjected to clonogenic analysis for hescolony initiating cells (CIC). The frequency of hes-cics was 1 in 1, selected cells demonstrating a comparatively high enrichment for the most primitive self-renewing cells identifiable within hes cell cultures (normally 1 in 5,). To ensure appropriate numbers of cells and colonies were analyzed, these human CICs were passed twice (2 weeks, 1 passage/week) on Matrigel. (b) The pluripotent marker IGF-1R correlates with EOS- expression. The same cultures from the hes-cic assay were analyzed by flow cytometry for expression of primitive hes cell pluripotency markers that include SSEA-3 and IGF-1R.

8 Supplementary Fig. 7, Morphology and EOS- expression of established mouse ips cell lines. WT4F-1, p12 EOS3F-24, p8 WT3F-6, p1 EOS3F-28, p1 EOS4F-3, p12 EOS3F-29, p9 The phase contrast (left) and EOS- fluorescent (right) images are shown for representative ips cell lines. Each passage number (p) is indicated beside the line name. Scale bars,!m.

9 Supplementary Fig. 8, Endogenous pluripotent marker expression in mouse ips cell lines. Mouse ips cell line EOS3F-28 SSEA-1 Nanog DAPI DAPI Established mouse ips cell lines selected with puromycin for EOS expression have ES-like morphology and are positive for endogenous pluripotent markers such as SSEA-1 and Nanog, coincident with EOS- expression.

10 Supplementary Fig. 9, EOS vector integration in mouse ips cell lines by Southern blot analysis. a BamHI EOS IRES PuroR Probe b CD-1 MEFs EOS3F-28 ips EOS3F-29 ips J1 ES cells EOS3F-24 ips Copy number: (a) Genomic DNAs were digested by BamHI and integrated EOS vector was detected by probe. (b) EOS3F-24 and EOS3F-28 lines have 4 copies and EOS3F-29 line has 2 copies of the EOS vector.

11 Supplementary Fig. 1, In vitro differentiation of mouse ips cell lines into the three germ layers. EOS3F-24 DAPI "III-tubulin DAPI!-actinin DAPI AFP EOS- EOS- EOS- EOS3F-28 DAPI "III-tubulin DAPI!-actinin DAPI AFP EOS- EOS- EOS- EOS3F-29 DAPI "III-tubulin DAPI!-actinin DAPI AFP EOS- EOS- EOS- Representative mouse ips cell lines were differentiated in vitro by dissociation of EBs and examined by staining for three germ layer markers, "III-tubulin (ectoderm),!-actinin (mesoderm), and!-fetoprotein (endoderm).

12 Supplementary Fig. 11, In vivo differentiation of mouse ips cell lines into teratomas. Ectoderm Mesoderm Endoderm EOS3F -24 Keratinizing epithelium Cartilage Ciliated epithelium EOS3F -29 EOS3F -28 Keratinizing epithelium Cartilage Endodermal epithelium Neuron Cartilage Gut-like epithelium Mouse ips cell lines were injected into the testes of NOD/SCID mice and pathology performed after 5 weeks. Note that a single injection of each line gave rise to a teratoma indistinguishable from those derived from the mouse ES cell control. The teratoma contains a variety of typical structures from all three germ layers, such as neural tissue (ectoderm), cartilage (mesoderm), and ciliated epithelium (endoderm).

13 Supplementary Fig. 12, Endogenous pluripotent marker expression in human ips cell lines. a Phase EOS- b DAPI DAPI c PE-Cy hesc hipsc TRA pmxs-mrfp1 Alexa 647 TRA-1- SSEA-3 TRA (a) Morphology and expression of an established human ips cell line (BJ-EOS- 4YA) by EOS-puro selection. (b) Established human ips cell line (BJ-EOS-4YA) selected with EOS- and puromycin selection has human ES-like morphology and is positive for endogenous pluripotent markers such as TRA-1- and SSEA-3, whereas the pmxs-mrfp1 retroviral transgene is silenced. (c) Flow cytometry analysis of EOS- expression and human ES cell marker expression in established human ips cell line (BJ-EOS 4YA). CA-1 human ES cells were used as a positive control for TRA-1- and TRA-1-81 staining.

14 Supplementary Table 1 Supplementary Table 1 List of primers used in this study Primer name ETn-pA-Mu-s ETn-pA-Mu-a RVP3 (Promega) GLP2 (Promega) Nanog-fwd (NcoI) Nanog-ref (BamHI) moct4-cr4-s (EcoRI) moct4-cr4-a (XhoI) msox2-srr2-s (EcoRI) msox2-srr2-a (XhoI) oimr3912 (common forward) oimr3913 (WT allele reverse) oimr3914 (MUT allele reverse) RTT-fwd RTT-rev Sequence 5'-TAGTGTCGCAACtATAAAATTTGAGC-3' 5'-GCTCAAATTTTATaGTTGCGACACTA-3' 5'-CTAGCAAATAGGCTGTCCC-3' 5'-CTTTATGTTTTTGGCGTCTTCC-3' 5 -gcccatggtgttagtatagaggaagagg-3 5 -taggatccaaaagtcagcttgtgtgg-3 5'-ggaGAATTCGGGTGTGGGGAGGTTGTA-3' 5'-aagCTCGAGCTAGGACGAGAGGGACCCCT-3' 5'-attGAATTCCCAGTCCAAGCTAGGCAGGT-3' 5'-ctaCTCGAGAGCAAGAACTGTCGACTGTGCT-3' 5'-AACGGGGTAGAAAGCCTG-3' 5'-TGATGGGGTCCTCAGAGC-3' 5'-ATGCTCCAGACTGCCTTG-3' 5'-CGCTCTGCCCTATCTCTGAC-3' 5'-AGTCCTTTCCCGCTCTTCTC-3'

15 Supplementary Table 2 Supplementary Table 2 List of antibodies used in this study Antibody Mouse IgM anti SSEA-1 Rabbit polyclonal anti Nanog Mouse IgG anti #III Tubulin Mouse IgG anti "-Fetoprotein (AFP) Mouse IgG anti "-Actinin Rabitt IgG anti Nestin Rabitt IgG anti GATA4 Mouse IgG anti Myosin (smooth) Mouse IgG anti SSEA-4 Rat IgM anti SSEA-3 Mouse IgM anti TRA-1- Mouse IgM anti TRA-1-81 Cat. numbrer MC-4 REC- RCAB2PF MAB1637 MAB1368 sc AB5922 SC-953 M-7786 MC813-7 MC Company Developmental Studies Hybridoma Bank CosmoBio Chemicon (Millipore) R&D Systems Santa Cruz Chemicon (Millipore) Santa Cruz Sigma Developmental Studies Hybridoma Bank Developmental Studies Hybridoma Bank Invitrogen Invitrogen Rhodamine conjugated anti rabbit Cy3 conjugated anti mouse IgM Cy3 conjugated anti mouse IgG Alexa 647 conjugated anti rat IgM PE-Cy5.5 conjugated anti mouse IgM A Jackson ImmunoResearch Jackson ImmunoResearch Jackson ImmunoResearch Invitrogen ebioscience