South As. J. Biol. Sci. 2(1): ISSN Molecular Identification of Closely Related Candida Spp. based 18S rrna Markers

Transcription

1 South As. J. Biol. Sci. 2(1): ISSN Molecular Identification of Closely Related Candida Spp. based 18S rrna Markers S.Savetha, D.Kavivanji, M.P.Ayyappadas, R.Renugadevi and P.H.Preethy Department of Biotechnology R.V.S College of Arts and Science, Sulur, Coimbatore. Corresponding author: To cite this article: S.Savetha, D.Kavivanji, M.P.Ayyappadas, R.Renugadevi and P.H.Preethy (2012). Molecular Identification of Closely Related Candida Spp. based 18S rrna Markers. South As. J. Biol. Sci., 2(1): Abstract The importance of opportunistic fungal pathogens is increasing in recent years because of immuno compromised patient and use of broad-spectrum antibiotics, such as anti-neoplastic and immunosuppressive chemotherapies for a large number of oncology and transplantation patients. Candida albicans also known as ( monelia) and related species are the principal causes of human yeast infection. Out of 20 only 18 samples were processed for the entire test which mentioned above but only 12 samples are processed to isolate, characterize and differentiate the Candida spp. from the samples collected from infected patients. The samples were inoculated on SDA and incubated at 37ºC. Once the culture was grown all the cultures will be subjected to basic identification such as biochemical and microbiological test.finally the samples will be subjected to genetical identification using gene specific primers and confirmed for sequencing and the results are analyzed by using bioinformatics software and the species are identified. Key words: Candida spp, primers, SDA, Biochemical and microbiological test 12 South As. J. Biol.Sci. 2(1): Savetha et al

2 Introduction The world of fungi is fascinating comprising of a wide range of macro as well as microorganisms. Candida belongs to the genus of yeasts. candida species are responsible for many life threatening opportunistic infections in immune compromised patients 1. Candida is a member of normal flora of skin, mouth, vagina, and stool. As well as being a pathogen and a colonizer, it is found in the environment, particularly on leaves, flowers, water, and soil. Candida overgrowth can produce a large number of symptoms. Among them are headaches, migraines, bad breath and rectal itching. Other problems are mood swings, canker sores, persistent heartburn, muscle and joint pain, numbness and tingling sensations in the face or extremities 2. The Candida diet is very similar to the gluten-free/casein-free (GFCF) diet of autistic children and to some of the low cholesterol diets. According to those who tried it, it is very hard to stick to and can be quite costly. It requires elimination of all forms of sugar, grain, dairy and fermented products and all processed food. Materials and Methods Sample Collection A total of 20 samples were collected. The samples were inoculated on SDA and incubated at 37ºC. The samples were also inoculated on the differential media CHROM agar and the plates were incubated at 37ºC 3. Morphological Tests Germ tube test A small amount of pure culture of organism from SDA was inoculated into 0.5ml of serum (horse/sheep/human) and incubated for about 3 hours at 37ºC. A drop of suspension was placed on a clean glass slide and covered with a cover slip and examined for the production of germ tube under light microscope South As. J. Biol.Sci. 2(1): Savetha et al

3 Chlamydospore formation test An isolated colony from the SDA plate was taken and inoculated on to cornmeal agar. The plates were incubated at 25ºC for hours and observed for chlamydospore production under light microscope 5. Growth on corn meal agar for chlamydospore or true hyphae production Different Candida species show various kinds of sporulation when grown on corn meal agar. C. albicans produces characteristic chlamydospores on corn meal agar 6. Suspend 1.9grams of Hi media corn meal agar in 100ml distilled water and heat to boil to dissolve the agar. Add 1ml tween 80, mix and autoclave at 121ºc for 15minutes and pour plates and allow setting. Pick up a small portion of a single colony of the yeast and inoculate as for isolation. Make few cuts into the agar with the loop in a slanting manner near the secondary and tertiary streak area and place a cover slip over the cut area. Incubate the plate at 30ºc for 24-72hours. Examine the plates under the microscope (100X, 450X) for the characteristic blastoconidia (yeast cells) formation along the streak line. Look for pseudohyphae, true hyphae and chlamydospores. Biochemical Test Carbohydrate (sugar) Fermentation Test Fermentation broth of 1% of the sugar solution (dextrose, lactose, sucrose and maltose) were prepared with Bromocresol purple as indicator and dispensed into test tubes 0.2ml of the saline suspension of organism grown on a sugar free media (nutrient) agar was added to each tube 7. The tubes were incubated at 37ºC for 7-12 days and observed for the production of acid/gas. Species of Candida were identified based on the pattern of sugar fermentation 8. Urease Test Inoculate the slant with one colony of yeast or a small bit of inoculum from mold colony. Incubate at 30-37ºC for atleast 7 days South As. J. Biol.Sci. 2(1): Savetha et al

4 Identification of Candida Spp. Based 18SR DNA A total of 6 Candida strains were analyzed of which 3 were clinical strains of Candida albicans, Candida tropicalis and Candida dubliniensis isolated from oral specimens from HIV infected patients and 3 standard strains of Candida albicans (ATCC 90028), Candida tropicalis and Candida dubliniensis (Wu284) were also included in this discrimination 9.The isolates were grown in yeast complete medium prior to molecular analysis. Isolation of DNA The DNA molecules are separated by electrophoresis 10. Gel is removed and the bands are visualized under UV light in a transilluminator. Polymerase Chain Reaction Primer details ITS1: TCCGTAGGTGAACCTGCGG ITS 4: TCCTCCGCTTATTGATATGC The DNA samples are amplified 11. PCR amplified samples 12 are purified and further subjected to sequencing which was done by using the Applied Biosystems sequencing instrument and the results were analyzed by using available bioinformatics tools such as BLAST, NJ plot and CLUSTAL-X. Results A total of 20 oral specimens were collected from HIV patients. The samples were inoculated on Sabourad s Dextrose Agar (SDA) and incubated at 37ºC for hours. 18/20 of the oral specimens grew Candida in culture. The culture positive samples were speciated based on the colony morphology on SDA and incubated for 48 hours (Fig: 1). From those culture individual colonies is taken for germ tube identification test, chlamydospore formation test, cornmeal agar test, CHROM agar and incubate the plates to check the growth at 45ºC. The same cultures are subjected to standard biochemical test such as sugar fermentation (Table -1), sugar assimilation test and urease tests. 15 South As. J. Biol.Sci. 2(1): Savetha et al

5 Figure: 1 Colony Morphology of Candida spp. on SDA Plates a- C. albicans b- C. guillermondii c- C. parapsilosis d - C. lusitaniae Out of 18 Candida isolated and speciated only 12 cultures are finally amplified and sequenced because of less time (Fig-2and 3). In that 8 cultures (CP1, CP3, CP4, CP 11, CP12, CP14, CP16 and CP19) were found to be Pichia guilliermondii (or) C. guillermondii, 2 cultures (CP17 and CP18) were found to be C. parapsilosis, 1 culture (CP8) were found to be Clavispora lusitaniae (or) C. lusitaniae and remaining 1 culture were found to be mixed one so we dint get sequencing result properly. Figure: 2 DNA bands of different C. spp. without marker 16 South As. J. Biol.Sci. 2(1): Savetha et al

6 Figure: 3 Lane-1 to 8- C. guillermondii; Lane-9 and 10 C. parapsilosis and Lane-11- C. lusitaniae Table1: Standard chart showing sugar fermentation and assimilation tests of various Candida spp. CP.No. CP1 CP3 CP4 CP 11 CP12 CP14 CP16 CP19 CP8 CP17 CP18 Urease Melibiose Lactose Maltose Sucrose Galactose Cellobiose Inositol Xylose Dulcitol Raffinose Trehalose Discussion Opportunistic fungal infections are more common in HIV infected patients and previous studies have revealed that 60% to 80% of HIV patients develop one or more fungal infections at some time during their illness, the most frequent being oropharyngeal candidasis 13. In the present study, out of 20 oral specimens collected from HIV patients, 18 cultures of the isolates were positive for Candida. Generally, 17 South As. J. Biol.Sci. 2(1): Savetha et al

7 C.albicans is the most predominant causative agent. Many authors have reported C.albicans as the most predominant species isolated from HIV patients 14. In the present study, out of 18 Candida species all the samples are underwent for basic biochemical, morphological and molecular studies. The 12 samples which taken for the molecular study were further identified 8 cultures as C. guillermondii or Pichia guilliermondii, 2 cultures were identified as C. parapsilosis and 1 culture were identified as Clavispora lusitaniae (or) C. lusitaniae which was done by PCR and 28s rdna sequencing 15. The sequencing results are further subjected to bioinformatics to find out the homology and phylogenetic tree was developed by available bioinformatics tool such BLAST, NJ plot and CLUSTALX. Germ tube and chlamydospore test was negative for all the three species, C. guillermondii also able to ferment all the sugars except Melibiose, Lactose,Maltose, Dulcitol, Raffinose and inositol and for sugar assimilation test; it shows positive results for dextrose, galactose, sucrose, cellulose, trehalose and xylose. The incidence of candidiasis caused by non albicans species has been reported by many researchers 16. The study was also attempted to screen for C.dublinensis, which is closely related, phenotypically similar to C.albicans, but we are not able to do that because of less time and sequencing reports are not reached. Despite reports of the worldwide isolation of C.dubliniensis from oral and systemic candidasis among immunocompromised patients, till date there has been only one report of isolation of C. dubliniensis from India, which was isolated from a HIV patient 13. In the present basic study up to now stating that none of the isolates found to be either C.albicans or C. dubliniensis, but in our CHROM agar plate one culture shows apple green colonies which might be C.albicans and another one which shows metallic blue colour is C. tropicalis. However a large number of screenings of Candida species in these groups of patients is required. In the past years, several investigators have reported, with increasing frequency, recovery of atypical isolates of the pathogenic yeast C. albicans from clinical samples 3. Some of the atypical C. albicans strains, 18 South As. J. Biol.Sci. 2(1): Savetha et al

8 primarily isolated from oral cavity of HIV-infected patients, were assigned to the species C. dubliniensis Recently, some atypical chlamydospore-negative C.albicans strains have been proposed to represent a separate species within the genus Candida (C. africana), but there is far too few genetic information available to assess if it may indeed be considered a separate species from C. albicans. According to this, in our present study most of the organism which shows Chlamydospore and germ tube negative but we need to find out by doing the sequencing. From that can conclude may be our organism is also C.albicans. Some authors have described PCR-based assays that use only a single specie-specific pair of primers to amplify a DNA fragment to check the difference between C. albicans or C. dubliniensis from other candida species 17. Juliana Campos et al. (2004) developed a simple PCR-based assay, based on the amplification of the transposable group I intron in 25S rdna, to identify correctly C. albicans genotypes, including C. dubliniensis. However, possible horizontal transfer of the transposable group I intron between C. albicans and C. dubliniensis limits this approach in clinical laboratory applications. References 1. Andreas Gruber, HIV-1 and its transmembrane protein gp41 bind to different Candida species modulating adhesion. FEMS Immunology and Medical Microbiology 37: Abdelghani Sebti, Candida dubliniensis at a Cancer Center. CID. 32: Frank C. Odds and Ria Bernaerts, CHROMagar Candida, a New Differential Isolation Medium for Presumptive Identification of Clinically Important Candida Species. 4. Firooz Beheshti, Germ Tube and Chlamydospore Formation by Candida albicans on a New Medium. American Society for Microbiol., Edward balish, Chlamydospore Production and Germ-Tube Formation by Auxotrophs of Candida albicans. American Society for Microbiol., South As. J. Biol.Sci. 2(1): Savetha et al

9 6. Zavalza-Stiker Alicia, Rapid Production Of Candida albicans Chlamydospores in Liqiud Media Under Various Incubation Conditions. Jpn.J MedMycol Saravana Bhavan.P., Culture and Identification of Candida Albicans from Vaginal Ulcer and Separation of Enolase on SDS-PAGE. Int. J. Biol., Jose Lopez, Rapid Identification of Candida glabrata Based on Trehalose and Sucrose Assimilation Using Rosco Diagnostic Tablets Zlem Osmanaúaoúlu, Identification of Different Candida Species Isolated in Various Hospitals in Ankara by Fungichrom Test Kit and Their Differentiation by SDS-PAGE. Turk. J. Med. Sci., 30: Lourdes Villa-Tanaca, Identification of Candida spp. by Randomly Amplified Polymorphic DNA Analysis and Differentiation between Candida albicans and Candida dubliniensis by Direct PCR Methods. J. Cli. Microbiol., Bujdakova H., Discrimation between candida albicans and candida dublinesis isolated from hivpositive patients by using commercial method in comparison with PCR assay. Folia microbial, 49(4): Orazio Romeo and Giuseppe Criseo, First molecular method for discriminating between candida Africana, candida albicans, and candida dubliniensis by using hwp1 gene. Diagnostic microbiology and infectious disease. J. Clin. Microbil., 62: Tylenda CA., Larsen J., Yeh CK., Lane HC. and Fox C., High levels of oral yeasts in early HIV-1 infection. J. Oral Pathol. Med., 18: Tremblay MJ., Fortin JF. and Cantin R., The acquisition of host-encoded proteins by nascent HIV-1. Immunol. Today. 19, Fox BC., Mobley HLT. and Wade JC., The use of a DNA probe for epidemiological studies of candidiasis in immunocompromised hosts. J. Infec. Dis., 159: South As. J. Biol.Sci. 2(1): Savetha et al

10 16. Ziauddin khan, abu Salim Mustafa and fasahat fakhar alam, Real time lightcycler PCR and melting temperature analysis for the identification of clinically important candida spp. J. Microbial. Immunol. Infet., 42: Badiee P., Molecular Identification and In-Vitro Susceptibility of Candida albicans and C. dubliniensis Isolated from Immunocompromised Patients. Iranian Red Crescent Medical Journal. 11(4): South As. J. Biol.Sci. 2(1): Savetha et al