Yan Zhu, Masha V. Poyurovsky, Yingchun Li, Lynn Biderman, Joachim Stahl, Xavier Jacq, and Carol Prives

Transcription

1 Molecular Cell, Volume 35 Supplemental Data Ribosomal Protein S7 Is Both a Regulator and a Substrate of MDM2 Yan Zhu, Masha V. Poyurovsky, Yingchun Li, Lynn Biderman, Joachim Stahl, Xavier Jacq, and Carol Prives Supplemental Experimental Procedures Yeast Two Hybrid Screening MDM2 (4-491) was used as bait screening against three different libraries: placenta library (PLA), human fetal brain library (HFBR), and human differentiated adipocyte library (PZD). A confidence score (A to E) assigned to each protein interaction was used to produce a statistical confidence score (Predicted Biological Score, PBS) that ranked interacting proteins according to technical parameters and identified sticky proteins and other false positives (Rain et al., 2001). This statistical analysis takes into account the data from the individual screen but also from the previous screens performed using the same library. Ribosomal Protein S7 has A score in all three screens. Cell Culture and Antibodies U2OS cells and H1299 cells were grown in Dulbecco modified Eagle medium containing 10% fetal bovine serum at 37 C as described in Experimental Procedures. RKO-e6 (clone 10.2) cells, which stably express the human papillomavirus 16 (HPV-16) E6 protein, or RKO-neo cells, which have been stably transfected with an empty vector, were grown in McCoy's medium 1

2 containing 10% fetal bovine serum supplemented with 500 µg/ml G418 and maintained at 37 C as described previously (Gottifredi et al., 2001a). Commercially obtained antibodies that were not described in Experimental Procedures included: mouse monoclonal antibody to MDM2 (Ab-1; Oncogene Research Products), Rabbit polyclonal antibody to human p53 (FL393; Santa Cruz), goat polyclonal antibody to B23 (N-19-G, Santa cruz) c-myc (sigma), FITC donkey anti-mouse IgG antibody (Jackson Immunoresearch), Cy3 donkey antigoat IgG antibody (Jackson Immunoresearch), and Cy5 donkey anti-rabbit IgG antibody (Jackson Immunoresearch). Mouse monoclonal antibody to Rb (IF-8) was supernatant solution from hybridoma cultures. Plasmids and Primers For constructing a Myc-tagged S7 plasmid (Myc-S7) RT-PCR was carried out to obtain S7 fragment that was cloned into pcmv-myc vector (Dr. R. Prywes, Columbia University) between BamHI and EcoRV restriction sites. To generate S7-His6, S7 fragment from Myc-S7 was subcloned into pet-21-a (Novagen) between NdeI and XhoI restriction sites. Two-step PCR was carried out to construct Flag-MDM2 (Δ22), Flag-MDM2 (Δ23), Flag-MDM2 (Δ24) and Flag- MDM2 (Δ34). Briefly, using a Flag-MDM2 plasmid as template, T7 promoter primer and individual reverse primer were used to obtain fragments containing sequences encoding MDM2 residues or 1-340, respectively with different C-terminal overhangs. Similarly, using the Flag-MDM2 plasmid as template, an Sp6 promoter primer and individual forward primer listed below were used to 2

3 obtain fragments containing sequences encoding MDM2 residues , , and with different N-terminal overhangs. Each pair of PCR products was purified and mixed at similar molar ratios and then diluted for use as templates for the second PCR step with T7 and Sp6 promoter primers. The PCR products with deleted MDM2 sequences were purified and digested with BamHI and EcoRI, and then subcloned back into the Flag-MDM2 construct replacing the full-length MDM2 sequence. Similarly, Myc-S7Δ (Δ98-118) was constructed by two-step PCR. PCR products with deleted S7 sequences were purified and digested with BamHI and EcoRV, and then subcloned back into the Myc-S7 construct replacing the full-length S7 sequence. The primer sequences for Flag-MDM2 (Δ22) were 5 -GGGACGCCATCGAATGATGAGGTATATCAAG- 3 (forward) and 5 -CTTGATATACCTCATCATTCGATGGCGTCCCTGTAG-3 (reverse). The primer sequences for Flag-MDM2 (Δ23) were 5 - GGGACGCCATCGAATATTTCTGAGAAAGCCA-3 (forward) and 5 - GGCTTTCTCAGAAATATTCGATGGCGTCCCTG-3 (reverse). The primer sequences for Flag-MDM2 (Δ24) were 5 - GGGACGCCATCCAATTGTGTGATTTGTCAAGG-3 (forward) and 5 - TTGACAAATCACACAATTGGATGGCGTCCCTGTAG-3 (reverse). The primer sequences for Flag-MDM2 (Δ34) are 5 - GGGAAAGATAAAGGGTGTGTGATTTGTCAAGG-3 (forward) and 5 - TTGACAAATCACACACCCTTTATCTTTCCCTT-3 (reverse). Primers 5 -CAGGATCCATTCAGTTCGAGCGCCAA-3 (forward) and 5 - GCGATATCTTACAATTGAAACTCTGG-3 (reverse) were used for constructing 3

4 Myc-S7. Primers 5 -GTCTTTATCGCTCAGAGCCGTACTCTGACAGC-3 (forward) and 5 -CTGTCAGAGTACGGCTCTGAGCGATAAAGACGAC-3 (reverse) were used for constructing Myc-S7Δ. Primers 5 - GGAGATATCATATGTTCAGTTCGAGCGC-3 (forward) and 5 - GGTGCTCGAGTTGAAACTCTGGGAATT-3 (reverse) were used for constructing S7-His6. Primers 5 - GCGGACCGATGTATCCATATGACGTCCCAGACTATGCCACATCATTTTCCAC CTCTGCTCAGTGTT-3 (forward) and 5 - GGGGTACCTTATGCTATAAAAACCTTAA-3 (reverse) were used to insert an HA tag upstream of MDMX. Degradation Assays MEF cells were plated 24 hours before drug treatment. Cells were either untreated or treated with ActD (5 nm) for 6 hours and then harvested, washed with PBS, suspended in SB buffer (25 mm HEPES ph 7.5, 1.5 mm MgCl 2, 5 mm KCl, 1 mm dithiothreitol, 1X complete protease inhibitors, 15 mm creatine phosphate, 2 mm ATP) followed by homogenization by freeze thawing and passage through a needle. Cleared extracts were obtained by subsequent centrifugation (5 min at 5,000 r.p.m. then 60 min at 13,000 r.p.m.) of lysed cells. Cell extracts were supplemented with degradation cocktail (1.5 mg/ml PKubiquitin, 7.5 mm creatine phosphate, 1 mm ATP, 1 mm MgCl 2, 0.1 mg/ml cycloheximide) with or without UbcH5c. Aliquots were removed at indicated time points, and resolved by SDS PAGE followed by Western blotting. 4

5 Immunofluorescent Staining U2OS or H1299 cells grown on coverslips were transfected with plasmids as indicated and immunofluorescent staining was carried out as described in Experimental Procedures. Monoclonal anti-flag (M2) antibody and polyclonal anti-myc antibody were used to detect Flag-MDM2 or Flag-MDM2 mutants and Myc-S7 or Myc-S7-Ub, respectively. Anti-MDM2 (Ab-1) and anti-p53 (FL393) were used to detect endogenous MDM2 and p53, respectively. Anti-B23 (N-19- G) was used to detect endogenous B23. FITC donkey anti-mouse IgG antibody (Jackson Immunoresearch), Cy3 donkey anti-goat IgG antibody (Jackson Immunoresearch), and Cy5 donkey anti-rabbit IgG antibody (Jackson Immunoresearch) were used as secondary antibodies for triple staining in Figure S1A, bottom panel. Alexa fluor 488 goat anti-rabbit or Alexa fluor 594 donkey anti-rabbit antibodies (Molecular Probes, Eugene, OR, USA) were used as secondary antibodies in the other stainings. Cell Cycle Analysis RKO-neo, RKO-e6 or H1299 cells were transfected with buffer alone or sirna oligos as indicated. At 30 h posttransfection (RKO-neo and RKO-e6 cells) or 48 h posttransfection (H1299 cells), cells were harvested by trypsinization, fixed overnight with -20 C methanol as described previously (Gottifredi et al., 2001b). Fixed cells were spun down for 5 min at 2400 rpm (1660 x g), resuspended with cold phosphate-buffered saline, and rehydrated for 1 hour on 5

6 ice. After another spin, cells were resuspended in phosphate-buffered saline solution containing RNase (50µg/ml) and propidium iodide (60 µg/ml, Sigma) and incubated in the dark for 30 min at room temperature. Stained cells were analyzed in a fluorescence-activated cell sorter (FACSCalibur, BD Biosciences) using the ModFit LT program. Cell Fractionation Cell fractionation was carried out as described (Enari et al., 2006). In brief, H1299 cells were lysed in lysis buffer containing 10 mm HEPES (ph 7.9), 1.5 mm MgCl 2, 10 mm KCl, 0.5 mm DTT, 10 mm NaF, 0.5% NP-40, 0.1 mm phenylmethylsulfonyl fluoride and protease inhibitors by vortex for 10 sec. The homogenates were checked microscopically for cell lysis. An aliquot was saved as total cell extracts and the rest was centrifuged for 5 min at 1000 x g. The supernatants were collected and used as cytosolic fractions. Pelleted nuclei were washed twice with lysis buffer and nuclear fractions were extracted from nuclei with extraction buffer containing 25 mm HEPES (ph 7.9), 1.5 mm MgCl 2, 420 mm KCl, 0.5 mm DTT, 10% glycerol, 10 mm NaF, 0.1 mm phenylmethylsulfonyl fluoride and protease inhibitors. 6

7 Figure S1. Residues of MDM2 are Required for S7 Binding. Experiments were carried out as described in Figure 1E using different combination of plasmids. 7

8 = Figure S2. Overexpression of S7 Leads to Cell Cycle Arrest in U2OS Cells. U2OS cells were transfected with Myc-S7 (3 µg) or Myc-L5 (3 µg) together with an F-GFP plasmid (0.1 µg). Thirty hours after transfection, cells were harvested for FACS analysis. Cell cycle profiles were obtained using the ModFit LT program. Error bars represent standard deviations taken from three independent experiments. 8

9 Figure S3. Nucleolar Relocalization of MDM2 by Ectopically Expressed S7. (A) Relocalization of ectopically expressed MDM2 to the nucleolus following transfection of S7 in U2OS cells. U2OS cells were transfected with Flag-MDM2, Myc-S7, or both (1.5 μg each). Twenty-four hours after transfection, the cells were fixed with 4% paraformaldehyde, permeabilized with 0.5% Triton-100 and immunostained with monoclonal anti-flag, or rabbit polyclonal anti-myc, or mixture of goat polyclonal anti-b23 (red), monoclonal anti-flag (green) and rabbit polyclonal anti-myc (blue) antibodies. (B) Relocalization of endogenous MDM2 to the nucleolus following transfection of S7 and stabilization of endogenous p53 9

10 harboring in U2OS cells nucleolar relocalized MDM2. U2OS cells were transfected with Myc-S7 (1.5 μg). Twenty-four hours after transfection, the cells were immunostained with mixture of monoclonal anti-mdm2 (Ab-1, green) and rabbit polyclonal anti-myc antibodies (upper panel), or mixture of monoclonal anti-mdm2 (Ab-1) and rabbit polyclonal anti-p53 (FL-393) antibodies (lower panel). (C) Relocalization of MDM2 to the nucleolus by S7 depends on the binding of S7 to MDM2. U2OS cells were transfected with Flag-MDM2 (Δ23) mutant and Myc-S7 (1.5 μg each). Twenty-four hours after transfection, the cells were immunostained with monoclonal anti-flag and rabbit polyclonal anti-myc antibodies. 10

11 Figure S4. Knock-down S7 Induces a Cell Cycle Arrest in both p53- Dependent and Independent Manner. (A) Cell cycle distribution of RKO-e6 and RKO-neo cells after knocking down S7 by sirna. RKO-e6 and RKO-neo cells were transfected with buffer alone, control sirna (0.05 µm) or two different S7 sirnas (1 and 2; 0.05 µm each). Thirty hours after transfection, cells were trypsinized and fixed with cold methanol followed by cell cycle analysis performed as previously described. The plot was obtained from three separate experiments. (B) Western blot analysis of MDM2 and p53 in RKO-e6 and RKO-neo cells after knocking down S7 by sirna. RKO- 11

12 e6 and RKO-neo cells were treated as in panel A, Forty-eight hours after transfection, cell lysates were prepared and then immunoblotted with anti-rb (IF8), anti-mdm2 (3G5+4B11), anti-p53 (DO-1), anti-s7, or anti-actin antibodies. (C) Cell cycle distribution of H1299 cells after knocking down S7 by sirna. H1299 cells were treated with sirna oligos as in panel A and harvested for cell cycle analysis 48 hours after transfection. Western blot analysis of the cell lysates were also carried out (D). Error bars represent standard deviations taken from three independent experiments. 12

13 Figure S5. Cellular Localization of S7-Ubiqutin Fusion Protein. (A) Subcellular localization of S7 in H1299 cells transfected with wt Myc-S7 or Myc-S7-Ub. H1299 cells were transfected with 1 μg of Myc-S7 or Myc-S7-Ub. Twenty-four hours after transfection, cells were fixed and stained with anti-myc antibody and visualized by confocal microscope. Percent of cells with different S7 cellular localization was estimated by counting at least 200 cells. Representative images of cells with nucleoplasm and nucleolus staining or cytosol and nucleolus staining were shown for Myc-S7 and Myc-S7-Ub respectively. (B) Cellular fractionation of S7 in H1299 cells transfected with wt Myc-S7 or Myc-S7-Ub. H1299 cells were transfected with Myc-S7 (0.8 µg) or Myc-S7-Ub (2.5 µg). 13

14 Cellular fractionation of cells were carried out twenty-four hours after transfection. Total (T), cytosolic (C), and nuclear (N) extracts (equivalent to 4 x 10 4 cells for total and cytosolic extracts; to 2 x 10 5 cells for nuclear extracts) of the cells were analyzed by immunoblot with anti-myc antibody. Co-transfected GFP was used as cytosolic protein marker while endogenous Myc protein was used as nucleular protein marker. 14

15 Supplemental References Enari, M., Ohmori, K., Kitabayashi, I., and Taya, Y. (2006). Requirement of clathrin heavy chain for p53-mediated transcription. Genes & development 20, Gottifredi, V., Karni-Schmidt, O., Shieh, S.S., and Prives, C. (2001a). p53 downregulates CHK1 through p21 and the retinoblastoma protein. Molecular and cellular biology 21, Gottifredi, V., Shieh, S., Taya, Y., and Prives, C. (2001b). p53 accumulates but is functionally impaired when DNA synthesis is blocked. Proceedings of the National Academy of Sciences of the United States of America 98, Rain, J.C., Selig, L., De Reuse, H., Battaglia, V., Reverdy, C., Simon, S., Lenzen, G., Petel, F., Wojcik, J., Schachter, V., et al. (2001). The protein-protein interaction map of Helicobacter pylori. Nature 409,