SUPPLEMENTARY INFORMATION

Transcription

1 Ya-Chieh Hsu 1, Joshua J. Chern, Yi Cai 3, Mingyao Liu 3 and Kwang-Wook Choi 145 This section contains: (1) Supplementary discussion () Supplementary methods (3) Additional references (4) Supplementary figures and figure legends 1 1

2 Supplementary discussion: Information about dtctp mutant alleles dtctp Ey0918 allele was semi-lethal. The majority of dtctp Ey0918 homozygous flies died before the 3 rd instar stage. Around 1% of them were able to survive until adulthood with an average of 0% reduction in their body weight. These escaper flies showed an 80% reduction of dtctp protein compared to wild-type flies, indicating that dtctp Ey0918 is a hypomorphic allele. As described in the main text, dtctp h59 is a null allele. A series of rescue experiments were performed to ascertain that deletion of dtctp locus was solely responsible for the lethality and phenotypes. Overexpression of a dtctp cdna by act-gal4 rescued the null mutant flies to pupal or adult stage. Similar rescue effects were also observed when expressing an htctp cdna. Moreover, endogenous regulation of dtctp expression by a genomic rescue construct restored dtctp h59 homozygous flies fully to wild-type adults. The design of the genomic rescue construct is described below in the supplementary methods section. Information about dtctp RNAi phenotypes Due to increased Gal4 expression at higher temperature, the expression of dtctp RNAi caused more dramatic phenotypes when temperature was raised. To create a sensitized background for easier detection of the enhancement effect by s6k (Fig 3m,n), the flies were raised at C, which caused relatively mild reduction of the eye size. For the rest of the manuscript, only the phenotypes at higher temperature are shown (usually at 9 C unless lethality was observed). Supplementary methods:

3 Drosophila genetics dtctp h59 clones were generated by standard Flp/FRT system. dtctp h59 MARCM clones were generated by crossing hs-flp, tub-gal4, UAS-GFPnls ; FRT8 tub-gal80 females to FRT8 dtctp h59 /TM6Tb males. To express CycE or P35 within the dtctp h59 clones, hs-flp, tub-gal4, UAS-GFPnls ; FRT8 tub-gal80 females were crossed to UAS-CycE; FRT8 dtctp h59 /TM6Tb or UAS-P35; FRT8 dtctp h59 /TM6Tb males. The 1 st instar progenies were heat-shocked at 37 C for 1 hr and then kept at 5 C. The larvae were dissected 7 hrs later. To generate the eye composed of only dtctp h59 homozygous cells, the EGUF/Hid technique was used by crossing w; ey-gal4, UAS-FLP; FRT8 pgmr-hid cl3r/tm flies to FRT8 dtctp h59 /TM6Tb flies. Molecular Biology To generate UAS-dTCTP RNAi, a 389 bp of dtctp PCR product amplified with 5' GCCTCTAGATGTTTGCCGACACCTACAAG and 5' GCCTCTAGACCGTCGCAGTCCATAGATTC was cut with XbaI and inserted in opposite orientation on each side of a white exon in pwiz. To generate UAS-dTCTP, an EcoRI/XbaI PCR fragment containing the full length dtctp coding region and 5 Kozak sequence was cloned into the puast vector. UAS-dTCTP E1V was produced using standard PCR procedures to introduce a glutamic acid to valine change at the 1th amino acid position of dtctp. To make UAS-hTCTP, a full-length cdna for htctp (Invitrogen) was digested with EcoRI/XbaI and cloned into the puast vector. To generate the dtctp genomic rescue construct, a 3 Kb XbaI-EcoRI genomic fragment was amplified from genomic DNA prepared from wild-type Canton-S flies and cloned into pcasper. This genomic fragment contains the entire dtctp locus and extends 1 Kb both 3

4 upstream and downstream of the dtctp transcript. dtctp is the only gene predicted in this region. dtctp sequence information is available from the FlyBase website ( Its genome annotation number is CG4800, and the flybase ID is FBgn For protein expression in bacteria, the coding sequences of dtctp, dtctp E1V, and htctp were amplified from UAS-dTCTP, UAS-dTCTP E1V, and UAS-hTCTP respectively, and cloned in frame into pgex-4t1. MBP-dRheb was produced by PCR reaction from full length EST clones GH10361 (DGRC). MBP-Ras was produced by PCR from a Drosophila embryonic cdna library. MBP-hRheb was PCR amplified from a human ORF clone. All of these were cloned in frame into pmal-cri (New England Biolabs). For protein expression in 93T cells, the dtctp coding region was ligated into the BamHI and XbaI sites in pcdna3-flag, and the drheb coding region was ligated into the BamHI and XhoI sites in pcdna3-myc (both pcdna3-flag and pcdna-myc were kindly provided by Tae Ho Shin). For protein expression in S cells, Myc-dRheb was PCR amplified from pcdna3-mycdrheb and cloned into the EcoRI and XhoI sites in pac5.1/v5-hisa (Invitrogen). Immunohistochemistry Third instar imaginal discs were dissected in phosphate-buffered saline (PBS) on ice, fixed in % paraformaldehyde-lysine-periodate fixative and stained according to standard procedure. Rabbit anti-dtctp (1: 50) and mouse anti-gfp (1:100; Santa Cruz Biotechnology) were used in this study. Secondary antibodies used were anti-mouse-fluorescein isothocyanate (FITC) and antirabbit-cy3 (Jackson Immunochemicals). Fluorescent images were scanned using a Zeiss LSM laser-scanning confocal microscope and processed using Adobe Photoshop. 4

5 Cell size and number estimation in nub-gal4 and nub>dtctp RNAi wings For each genotype, 10 wings from males were analyzed. Cell size and total cell numbers in the wing were estimated by counting the numbers of wing hairs in a,500 μm area just posterior to the posterior crossvein (one wing hair corresponds to one cell). Detection of phospho-s6k level We found that the level of phospho-s6k is sensitive to temperature. Strong and consistent signals were obtained from wild-type larvae raised at 18 C, but the levels of phospho-s6k were reduced to an undetectable level for larvae raised at 5 C or above. act-gal4/tm6 Tb flies were crossed to either y w or UAS-dTCTP RNAi flies and kept at 18 C. The F1 third instar larvae without the Tb marker were homogenized in ice-cold extraction buffer (50mM Tris ph8.0, 1% NP-40, 150mM NaCl, mm DTT, 0.1mM NaVO 4, 50mM NaF, 10mM β-glycerolphosphate, 1X Roche protease inhibitor cocktail), kept on ice for an additional 15 min before centrifugation at 13,000g for 30 min at 4 C. Equal amounts of lysates were loaded and resolved by SDS-PAGE. The phospho-ds6k (Thr 398) antibody (from Cell Signaling) was used at 1:1000 dilution. Co-immunoprecipitation assays 93T cells were transiently transfected with Flag-dTCTP, Myc-dRheb, or both vectors (1 μg each) using lipofectamine 000 (Invitrogen). Transfected cells were harvested 48 hrs later in icecold lysis buffer (0 mm Tris ph7.5, 137 mm NaCl, 10 mm EDTA, mm sodium pyrophosphate, 5 mm β-glycerolphosphate, 1% Triton X-100, 10% glycerol, and 1X Roche complete protease inhibitors). Cell lysates were spun down at top speed at 4 C and then immunoprecipitated with 40 μl Myc-conjugated beads (Sigma). Samples were shaken at 4 C overnight, and the immunoprecipitates were washed 5 times with ice-cold lysis buffer before 5

6 analysis. Antibodies against Flag and Myc were from Sigma and Santa Cruz Biotechnology, respectively. In vitro GST-pull down assays Bacterially expressed GST, GST-dTCTP, GST-dTCTP E1V and MBP-Rheb were expressed in Escherichia coli BL1-Codon Plus cells (Stratagene) and purified according to standard procedure. Endogenous nucleotides were removed from purified MBP-dRheb, and the GTPases were loaded with GDP or the non-hydrolysable GTP analogue GppNHp. 10μg of GST, GSTdTCTP, and GST-dTCTP E1V were immobilized on glutathione-agarose beads (Sigma), and incubated hrs with the same amount of treated MBP-dRheb at room temperature. After 5 washes with the binding buffer (10 mm Tris ph7.5, 100 mm NaCl, 10% glycerol, 0.1% DTT, 1X Roche protease inhibitor cocktail, and 5 mm EDTA for nucleotide-free drheb or 10 mm MgCl for GDP or GppNHp loaded drheb), proteins were eluted with 0 mm glutathione elution buffer. The eluted proteins were resolved on 10% SDS-PAGE and visualized by Western blot. The same protocol was followed for in vitro pull-down of human proteins. In vitro GDP release assays 1 µm MBP-dRheb was incubated with 1 µm [ 3 H]GDP at 5 C in buffer B (50 mm HEPES ph 7.6, 100 mm NaCl, and 1 mm DTT) in the absence of GST-dTCTP or in the presence of 1 µm of GST-dTCTP or GST-dTCTP E1V. After reaching the binding equilibrium (~60 min), the GDP/GTP exchange reactions were initiated by the addition of excess free GTP. At different time points, the reactions were terminated by filtration of 0 µl of the mixtures through nitrocellulose filters. The filters were then washed twice with the ice-cold buffer B. The amount of the radionucleotides bound to the GTPase was quantified by scintillation counting. Similar results were obtained from 3 independent experiments. To determine the concentration effect of dtctp 6

7 and htctp on drheb and hrheb, the exchange assays were performed as above except 5 nm nm dtctp or 5 nm-500 nm htctp were used. The GEF activity is expressed as the percent of initial [ 3 H]GDP bound after 10 minutes incubation for drheb and after 15 minutes for hrheb, as the exchange activity of htctp on hrheb is slightly slower than dtctp s activity on drheb. For each time point or concentration, the samples were assayed in duplicate. S cell culture, transfection, and RNAi ds dtctp RNA was generated using MEGAscript RNAi Kit (Ambion) from a 45 bp PCR product amplified with the primers 5' TAATACGACTCACTATAGGGAGACTTCAAGACCAACATGAACAAGG and 5' TAATACGACTCACTATAGGGAGAGAATTGTTTAGCTCGCTGTGATT. Drosophila S cells were maintained in Schneider's medium (Invitrogen) supplemented with 10% fetal bovine serum and antibiotics. RNAi in S cells were performed as described previously 1 with slight modification. dtctp protein in S cells is extremely abundant and stable, as a result more dsrna and a longer incubation time is required to obtain a satisfactory knock-down of dtctp compared to other genes. Cells were treated with dsrna against dtctp or EGFP (40μg/ml) for seven days. On the 8 th day, cells were harvested and resuspended at a density of 1 X 10 6 per ml in fresh Schneider s medium containing 15μg/ml dtctp or EGFP dsrna and plated in 10cm dishes. Transfections were carried out the next day using Effectene reagent (Qiagen), and the cells were transfected with 0.4 μg of Myc-dRheb or pac5.1-v5 His together with μg of dtctp or EGFP dsrna. After 48 hrs, the cells were harvested and snap-frozen in liquid nitrogen until lysis. Measurements of drheb activation state in vivo 7

8 S cells treated with dtctp or control EGFP dsrna were transfected with Myc-dRheb or pac5.1/v5-hisa empty vector as described above. The cells were rapidly extracted in ice-cold lysis buffer (50 mm Tris ph7.5, 1% NP-40, 00 mm NaCl, 10 mm MgCl, and 1X Roche protease inhibitor cocktail). After a brief centrifugation, the extracts were incubated with Myc conjugated agarose beads (Sigma) for hrs at 4 C. Immunoprecipitates were washed 6 times with wash buffer (50 mm Tris ph7.5, 1% NP-40, 500 mm NaCl, 10 mm MgSO 4, 100 mm Ribose) and 3 times with 0 mm TrisPO 4, 5 mm MgSO 4. The beads were then resuspended in 5 mm TrisPO 4, 5 mm DTT, mm EDTA and heated at 100 C for 3 minutes to elute GTP and GDP associated with drheb. The samples were split in half, and GTP was measured in one-half by conversion to ATP using ADP and nucleoside diphosphate kinase. The resulting ATP was measured by the firefly luciferase system. The control sample was subtracted from the experimental sample, and the amount of GTP was determined from the GTP standard curves which was prepared at the same time. The sum of GTP plus GDP was measured as above after converting GDP to GTP using phosphoenolpyruvate and pyruvate kinase. Similar results were obtained in two independent experiments. Measurements and Statistical analysis The measurements described in Fig 1f, Fig Sg, the GFP positive area in Fig h-j and the eye size in Fig 3m-n were obtained using the NIH image J program ( Error bars in all figures represent standard deviation from the mean. All P values were generated by ANOVA. The wings from males were used in all the measurements of the wings described in the manuscript Reference: 1. Worby, C. A., Simonson-Leff, N. & Dixon, J. E. RNA interference of gene expression (RNAi) in cultured Drosophila cells. Sci STKE 001, PL1 (001). 8

9 Figure S1 Alignment of TCTP protein sequences in various species. TCTP is a highly conserved protein present in a wide range of eukaryotic cells. Asterisks (*) mark the absolute conserved amino acid residues in the published TCTP sequences from 4 different species. Arrow marks the E to V mutation (E1V) used in Fig

10 Figure S dtctp RNAi phenotypes. a, Expression of dtctp RNAi in the posterior compartment of the wing by engrailed-gal4 causes significant size reduction of the posterior part, as a result the anterior compartment is folded and distorted. The anterior (A) and posterior (P) compartment boundary is marked by the black dashed line. b, Higher magnification of the red boxed area in a. The cells in the posterior compartment are smaller and denser compared to those in the anterior compartment. c,d, Phenotypes resulted from expression of dtctp RNAi in the notum. The microchaete and macrochaete appear much shorter than those of the control animals. In addition, the overall notum size is also reduced. e,f, Higher magnification pictures for the L1-L (in e, served as an internal control) and L3-L4 regions (in f, corresponding to the dtctp RNAi expression region) in the same ptc>dtctp RNAi wing. The wing hairs are arranged more densely in the L3-L4 region of the ptc>dtctp RNAi wings, suggesting that the individual cell size is smaller. g, Quantification analysis suggests that the cells in the L3-L4 region is 40% smaller than the control cells in the L1-L region. 10

11 Figure S3 CycE suppresses dtctp RNAi phenotype. a,b, Co-expression of CycE and dtctp RNAi in the eye using ey-gal4 rescues dtctp RNAi phenotype. (a) ey>dtctp RNAi at 9 C, (b) ey>dtctp RNAi, CycE at 9 C. c,d, Expression of CycE also suppresses dtctp RNAi phenotype in the wing. (c) ptc>dtctp RNAi at 5 C, (d) ptc>dtctp RNAi, CycE at 5 C. e,f, Quantification analysis of the distance (e) and cell number (f) between L3 and L4 veins. Expression of CycE together with dtctp RNAi restores the distance between these two veins. The suppression is more dramatic with respect to cell number. Flies expressing CycE and dtctp RNAi together show no significant difference in cell number between L3 and L4, but its L3 to L4 distance is still shorter compared to the wild-type distance (n=10 for each genotype, error bars: s.d.; **: P<0.0001). 11

12 Figure S4 dtctp displays GEF-like activity to drheb both in vitro and in vivo. a, 1 µm MBP-dRheb with increased concentration of GST-dTCTP or dtctp E1V. The GEF activity is presented as the percentage of [ 3 H]GDP left on drheb 10 minutes after the reaction starts (error bars: s.d.). b, The percentage of activated GTP-dRheb decreases when dtctp level is knockeddown in S cells (error bars: s.d.). 1

13 Figure S5 Human TCTP rescues dtctp RNAi phenotypes. a, ey>dtctp RNAi at 9 C. b, ey>dtctp RNAi, htctp at 9 C. c, ptc>dtctp RNAi at C. d, ptc>dtctp RNAi, htctp at C. e, htctp preferentially interacts with nucleotide-free hrheb. f, htctp accelerates the GDP/GTP exchange of hrheb (1 µm MBP-hRheb with increased amounts of GST-hTCTP, error bars: s.d.). 13

14 Figure S6 A working model for TCTP in the InR/TSC pathways. Arrows indicate positive relationship and bars represent negative regulation of targets. Dashed lines represent the putative regulations. Our study suggests that TCTP positively regulates the TSC pathway by activating Rheb. TCTP might have additional roles in the TSC pathway downstream of Rheb. 14