GENETICS - CLUTCH CH.7 DNA AND CHROMOSOME STRUCTURE.

Transcription

1 !!

2 COCEPT: DA AS THE GEETIC MATERIAL DA wasn t always thought of as the genetic material To be genetic material, a molecule needs to have certain - Store information - Transmit information - Replicate with little errors - Be able to change with mutations and variations Before the 1940s, many people believed proteins were the source of genetic material - Tetranucleotide hypothesis stated that the four DA nucleotides were just repeated over and over Tetranucleotide hypothesis ACGTACGTACGTACGTACGTACGT There were a number of experiments that DA was the genetic material Avery, Macleod, and McCarty experiment in Infected a mouse with a mixture of heat-inactivated virus, and non-infectious virus - They wanted to figure out whether proteins, fats, RA, or DA transformed the virus - It was DA Avery experiments Page 2

3 The Hershey/Chase experiment in Labeled bacteriophages protein and DA with different radioisotopes - Labeled-DA was transferred into the bacterium, not the labeled protein The Watson, Crick, Franklin, and Wilkins discovered 3D structure of DA - X-ray diffraction beams X-rays at DA, and uses math to calculate structure from the ray s deflections - Rosalind Franklin was the first to do this, her scientific partner was Wilkins - Wilkins showed Watson and Crick, Franklin s X-ray diffraction data - Watson and Crick used that data to come up with the 3D double helix model - Only Watson, Crick, and Wilkins got the obel Prize (Franklin had passed away before the award) Page 3

4 PRACTICE 1. The tetranucleotide hypothesis stated what? a. There were four nucleotides b. The four nucleotides were repeated again and again, making up chromosomes c. Only one of the four nucleotides is used for genetic storage d. Four nucleotide repeats encode for a protein necessary for genetic storage 2. The Avery, Macleod, and McCarty experiment in 1944 figured out what? a. Proteins were the genetic material b. RA was the genetic material c. DA was the genetic material d. Fats were the genetic material Page 4

5 3. The Hershey/Chase experiments in 1952 use bacteriophages to study what? a. The codon code b. Whether DA or protein was the genetic material c. How DA was replicated d. How bacteriophages caused cell death Page 5

6 COCEPT: DA STRUCTURE Deoxyribose nucleic acid (DA) has three main components These include: - A phosphate - A pentose sugar (deoxyribose has H at 2 carbon, ribose has OH at 2 carbon) - A itrogenous base: adenine (A), guanine (G), cytosine (C), thymine (T) There are two common names for combinations of these three components - ucleosides contain a nitrogenous base and pentose sugar - ucleotides contain a nitrogenous base, pentose sugar, and phosphate The nitrogenous bases fall into two - Purines are bases with a double-ring structure: includes adenine and guanine - Pyrimidines are bases with single ring structure: includes cytosine and thymine - Purines pair with Pyrimidines Chargoff s rules state that A pairs with T and C pairs with G Page 6

7 O Adenine Thymine O O Guanine Cytosine O Purine Pyrimidines Two types of create DA - Phosphodiester bonds connect the nucleotides together in a single strand - Hydrogen bonds connect the complementary strands together - G/C pairings make three hydrogen bonds. A/T pairings make two hydrogen bonds The complementary strands are antiparallel, meaning that the nucleotides are inverted in sequence The two DA strands form a double helix - The double helix has a large major groove and a small minor groove Page 7

8 PRACTICE 1. Which of the following is not a component of a nucleotide? a. Phosphate b. Pentose Sugar c. Starch sugar d. itrogenous base 2. Chargoff s rules states that which nucleotide pairings occurred? a. A and G, C and T b. T and U, C and G c. G and U, C and A d. A and T, C and G Page 8

9 3. Which of the following is OT true regarding the structure of the DA double helix? a. The two strands run parallel b. The two strands are complementary c. The nucleotides are held together via Phosphodiester bonds d. There is a major groove and minor groove Page 9

10 COCEPT: ALTERATIVE DA FORMS There are many different of DA B-DA is the most common DA form. Right-handed helix A-DA is a rare, shorter, right-handed helix Z-DA is a rare, left-handed helix There are other forms of DA including: C-DA, D-DA, E-DA, and P-DA PRACTICE 1. Which of the following types of DA is the most common DA form? a. A-DA b. B-DA c. C-DA d. D-DA Page 10

11 2. Which of the following types of DA is characterized by a left-handed helix? a. A-DA b. B-DA c. C-DA d. Z-DA Page 11

12 COCEPT: RA RA differs from DA RA was used as the genetic material during the world - Ribozymes can catalyze chemical reactions - Can form secondary structures RA structure is from DA structure - Ribose sugars vs. deoxyribose sugars (difference lies in OH at 2 carbon) - This small difference makes RA more easily degraded - Contains uracil (U) instead of thymine (T) - RA is normally single stranded There are many different RA classes mra is the coding RA, which codes for proteins Two RAs are important for translation - rra creates ribosomal subunits - tra is used to add amino acids onto a polypeptide chain There are many classes of non-coding RAs with a variety of functions - miras and siras play a role in RAinterference, which controls gene expression - Small cytoplasmic RAs (scras) have an unknown function - Long non-coding RAs have many different functions - snras convert pre-mra into mra - snoras process rras Page 12

13 PRACTICE 1. True or False: RA predated DA as the main genetic material during the early world. a. True b. False 2. Which of the following is not a difference between DA and RA? a. RA uses ribose, DA uses deoxyribose b. RA uses uracil, DA uses thymine c. RA uses Phosphodiester bonds, DA uses ester bonds d. RA is normally single stranded, DA is normally double stranded Page 13

14 3. Which of the following terms is used to describe catalytically active RA molecules? a. Proteosomes b. Ribozymes c. Polymerases d. Ligases Page 14

15 COCEPT: BACTERIAL AD VIRAL CHROMOSOME STRUCTURE Bacterial and viral chromosomes are much They have different characteristic than eukaryotic chromosomes Bacterial Genetic Material Circular chromosomes DA Viral Genetic Material Single or double-stranded DA or RA There are DA binding proteins that to the DA - HU and H1 proteins are similar to histone proteins found in eukaryotic chromosomes - They package a lot of DA into a small area The circular chromosomes contain a few structural components - The origin of replication is where replication begins - The chromosome contains repetitive sequences - Often they are intergenic regions, which are untranscribed regions between genes PRACTICE 1. True or False: Bacteria and viruses can use RA as their genetic material. a. True b. False Page 15

16 2. What is the name of the bacterial chromosomal region where replication begins? a. Transcription start site b. Origin of DA copying c. Polymerase initiation site d. Origin of replication Page 16

17 COCEPT: EUKARYOTIC CHROMOSOME STRUCTURE Eukaryotic chromosomes have a specific Chromatin is a combination of DA and protein - Heterochromatin is tightly packed DA - Euchromatin is loosely packaged DA Structures Chromosomes are packaged into four levels The ucleosome is made up of histone proteins and DA - Histone core consists of two copies of H2A, H2B, H3, H4 - Histone linker, H1, connects the histone core 30nm fiber is composed of multiple nucleosomes 250nm fiber is composed of 30nm fibers Page 17

18 The chromosomes have specific The centromere is the constricted region of the chromosome where spindle fibers attach - Kinetochore is a group of cellular proteins that link centromeres to spindle fibers - Contains heterochromatin and sequences where the kinetochore attaches - Contains a special histone variant cenh3 The telomere is the end of the chromosome - Contains repetitive telomeric sequences, which are repeats of A and T followed by 2-3 Gs - Shelterin is a protein that binds to telomeres and prevents DA from breaks at the ends - Has G rich 3 overhang, that assists in replication TTAGGG Supercoiling Supercoiling is an extremely tight of chromosomes - Positive supercoiling describes DA molecules that are over-rotated - egative supercoiling describes DA molecules that are under-rotated Topoisomerases are enzymes remove rotations from DA - Type I - relaxes the number of negative supercoils - Type II (DA Gyrase) introduces negative supercoils, to remove positive supercoils Page 18

19 PRACTICE 1. Which of the following terms is used to describe open chromatin which is loosely packaged DA? a. Heterochromatin b. Achromatin c. Euchromatin d. Mochromatin Page 19

20 2. Histone proteins are responsible for what? a. Separating genes on the chromosomes b. Packaging the chromosome c. Bringing distant regions of chromosomes together d. Separating chromosomes 3. Which of the following is the correct order of chromosomal packaging levels? a. ucleosome, 250nm fiber, 30nm fiber, chromosome b. 250nm fiber, 30nm fiber, nucleosome, chromosome c. ucleosome, 30nm fiber, 250nm fiber, chromosome d. ucleosome, 30nm fiber, chromosome, 250nm fiber Page 20

21 4. What is the name of the enzyme that removes supercoils in DA? a. Ligase b. Polymerase c. Topoisomerase d. Kinase Page 21