Application of Molecular Biology tools for cloning of a foreign gene

Transcription

1 IFM/Kemi Linköpings Universitet September 2013/LGM Labmanual Project course Application of Molecular Biology tools for cloning of a foreign gene

2 Table of contents Introduction... 3 Amplification of a gene with PCR... 4 Restriction digest... 5 Purification of DNA... 6 Agarose gelelectrophoresis... 7 Ligation of vector and PCR fragment... 8 Transformation of a vector after ligation... 9 Analysis of transformants Appendix

3 Inledning This lab, which includes ~ 2 full days, is intended to provide laboratory experience of a few different steps used in cloning, such as restriction cleavage and ligation. For each laboratory experiment is a "standard protocol" with various issues / concerns that are reviewed before you start the experiment. In the lab you will work in larger groups (4-6 in each group) where different people are responsible for different steps of the work according to the flowchart (Figure 1). It is essential that each group make detailed notes of the laboratory work. The results from the different groups will be presented in a seminar. Amplification of gene with PCR Analysis of vector and PCR product on agarose gel Restriction digest of vector Purification of PCR product Purification of vector after restriction digest Restriction digest of PCR product Purification after restriction digest Ligation of vector and PCR product Transformation of ligation mixture Screening of colonies with PCR Analysis of transformants on agarose gel Figur 1: Flow-chart of the various stages in the project laboration. 3

4 Amplification of a gene with PCR Questions / concerns: Based on primer sequence, suggest appropriate PCR cycle What happens if the annealing temperature is too high or too low? Estimate the molar ratio of vector DNA and primers, how big is the surplus? How is the melting point of primers calculated? What should be considered in the design of primers? Procedure: DNA: 1 µl Primer_forward: 1 µl Primer_reverse: 1 µl 10X dntp-mix: 2 µl 10X Reaction buffer: 2 µl H 2 O: 12 µl Taq polymerase: 1 µl Total volume: 20 µl Withdraw 5 µl for analysis on an agarosegel, the remaining will be used for restriction digest. Readings: T.A Brown Gene Cloning and DNA analysis, 6 th edition, page

5 Restriction digest Questions / concerns: What is a Unit? At what temperature and for a how long time should the reaction be incubated? How is the inactivation of enzymes done? What happens if you do not deactivate the enzymes? What should be considered in the choice of reaction buffer when you have two different restriction enzymes in the mixture? What controls should be included to know that both enzymes have worked? Restriktion digest of vector/fragment: DNA: ( ng) X µl Restriction enzyme NcoI: 1 µl Restriction enzyme EagI: 1 µl 10X Reaction buffer: 2 µl H 2 O: Y µl Total volume: 20 µl Withdraw 5 µl for analysis on an agarose gel, the remaining will be purified with a suitable purification kit. Readings: T.A Brown Gene Cloning and DNA analysis, 6 th edition, page

6 Purification of DNA Any manipulation of DNA such as PCR amplification or restriction cleavage requires DNA purified after the reaction. The purification serves multiple purposes, to get rid of excess such as primers and restriction enzymes, reaction buffer is replaced with H 2 O and concentrating the sample. This labexercise we will make use of a commercial kits for purifying DNA. This kit is based on the DNA binds to a solid matrix and then eluted into the small volume of sterile H 2 O. Purification of PCR produkt after amplification and restriction digest (QIAgen minelute PCR purification kit) Procedure: 1) Add 5 volumes of PB buffer to reaction mixture. 2) Centrifuge for 1 min in "minelute column" of binding DNA. 3) Discard the solution and add 750 µl wash solution, centrifuge for 1 min and discard the solution. 4) Centrifuge the column dry to remove any excess wash solution. 5) Add 10 µl H 2 O and let stand 1 minute. Transfer "minelute column" to a new epp.rör and centrifuge 1 min. 6) The test is now available in epp.tube and is ready to be used for ligation. Readings: Information from Qiagenom Minelute PCR purification Kit: actioncleanupkit.aspx?r=2538 6

7 Agarose gelelectrophoresis Questions / concerns: What controls should be present during electrophoresis What happens if you have too low or too high voltage for electrophoresis? What should you consider when you do a preparative agarosegel? Which concentration of agarose gel should you use? Procedure: 1) In a 250 ml bottle is added g agarose and 10ml 10x TBE buffer and diluted with water to total volume of 100ml. 2) Heat the agarose gel until it is completely liquid in a microwave. Let the mixture cool for a while (about 60 o C) and pour agarose gel. Allow the gel to cool for at least 30 minutes. Electrophoretic separation of DNA 1) Mix 4 µl loading buffer with 5 µl DNA and 11 µl H2O. 2) Add 5 µl premixed molecular weight marker 3) Add agarose gel in electrophoresis apparatus and fill with 1X TBE buffer to cover gel. 4) Apply gently and slowly the samples in sample wells with a automatic pipette 5) Separate the DNA fragments by applying a voltage ~ 100 Volts. Remember that DNA is negatively charged. 6) When the blue marker has reached about 2 / 3 down the gel is interrupted electrophoresis and DNA fragments stained with ethidium bromide. Ethidium Bromide intercalate with DNA and can be seen when the gel is illuminated with nm light at a transluminator. Protect your eyes by using safety glasses and wear gloves when working with Ethidium Bromide. 7) Photograph of the gel and estimate the amount of DNA you have received. Furher readings: T.A Brown Gene Cloning and DNA analysis, 6 th edition, page

8 Ligation of vector and PCR fragment Questions / concerns: What is the molar relationship between the vector and fragments in the reaction? How do you know the amount of DNA? For how long time and at what temperature will the ligation reaction take place? What should you consider when ligation of "blunt-ends" instead of "sticky-ends"? What controls should be included in the ligation reaction? What is a Unit? Procedure: 1) Take ~ 50ng vector and 3-fold molar excess of PCR product. Adjust the volume to 10 µl of H 2 O. 2) Add 10 µl 2 x Quick Ligation Buffer and mix. 3) Add 1 µl Quick T4 DNA ligase and mix thoroughly, centrifuge the mixture a few seconds. 4) Incubate at room temperature for 5-15 min. 5) Set the mixture on ice. 6) Transform the ligation reaction or freeze -20 C for later transformation. Readings: T.A Brown Gene Cloning and DNA analysis, 6 th edition, page

9 Questions / concerns: Transformation of vector after ligation What controls should be included in the ligation reaction? Procedure: 1) Thaw the super-competent Nova Blue cells portioned in 50 µl 2) For each 50 µl's portion of the super-competent cells are added to 1-5 µl of the test, control or transformation control. 3) Mix gently with pipette tip and incubate on ice for 30 minutes. 4) "heat shock" the cells by placing the tubes in heating block 45 seconds at 42 C, then place tubes on ice for 2 minutes. 5) Add 200 µl of preheated (42 C) SOC culture medium and incubate the transformation reaction 1 hour at 37 C. 6) Take all of the incubated mixture and spread on agar plate. 7) The day after the transformation (approximately 16 hours). Count the number of colonies on the agar media. Readings: T.A Brown Gene Cloning and DNA analysis, 6 th edition, page

10 Analysis of transformants In order to find transformants with the cloned gene there are a number of different methods. The best thing is to do a plasmid preparation on a number of colonies and determine the DNA sequence of the different clones. Since this method is somewhat tedious, we will try to do "colony screening" with PCR. This method is based on that a number of colonies from the agar plate (one colony in each tube) are transferred to a tube and DNA content could be amplified using PCR. Since we are using the same primers as we used to isolate the gene will enable us to identify those colonies that have the gene inserted into the vector. Procedure: 1) Mix the following solutions into PCR tubes (one tube for each colony, marking the tubes carefully) Primer_forward: 1 µl Primer_reverse: 1 µl 10X dntp-mix: 2 µl 10X Reaction buffer: 2 µl H 2 O: 12 µl Total volume: ~20 µl 2) Pick a colony with a toothpick and inoculate into the PCR tube. 3) Heat the PCR tube at 95 C for 5 min. 4) Add 1 µl of Taq polymerase, mix with a short spin. 5) Amplify DNA in the PCR cycle that you used to isolate the gene. 6) Upon completion of PCR add 4 µl loading buffer and samples are analyzed on an agarose gel. 10

11 Appendix Primer_forward: 5 -GCGCGCCCATGGCCCATCACTGGGGGTA-3 Primer_reverse: 5 -GCGCGCCGGCCGTTATTTGAAGGAAGCTTTGATTTG 3 Figur 3: Primers for PCR amplification. Underlined shows the restriction sites and bases in italic the part of the primer binding to the gene. 5 - ATGGCCCATCACTGGGGGTACGGCAAACACAACGGACCTGAGCACTGGCATAA GGACTTCCCCATTGCCAAGGGAGAGCGCCAGTCCCCTGTTGACATCGACACTC ATACAGCCAAGTATGACCCTTCCCTGAAGCCCCTGTCTGTTTCCTATGATCAA GCAACTTCCCTGAGGATCCTCAACAATGGTCATGCTTTCAACGTGGAGTTTGA TGACTCTCAGGACAAAGCAGTGCTCAAGGGAGGACCCCTGGATGGCACTTACA GATTGATTCAGTTTCACTTTCACTGGGGTTCACTTGATGGACAAGGTTCAGAG CATACTGTGGATAAAAAGAAATATGCTGCAGAACTTCACTTGGTTCACTGGAA CACCAAATATGGGGATTTTGGGAAAGCTGTGCAGCAACCTGATGGACTGGCCG TTCTAGGTATTTTTTTGAAGGTTGGCAGCGCTAAACCGGGCCTTCAGAAAGTT GTTGATGTGCTGGATTCCATTAAAACAAAGGGCAAGAGTGCTGACTTCACTAA CTTCGATCCTCGTGGCCTCCTTCCTGAATCCTTGGATTACTGGACCTACCCAG GCTCACTGACCACCCCTCCTCTTCTGGAATGTGTGACCTGGATTGTGCTCAAG GAACCCATCAGCGTCAGCAGCGAGCAGGTGTTGAAATTCCGTAAACTTAACTT CAATGGGGAGGGTGAACCCGAAGAACTGATGGTGGACAACTGGCGCCCAGCTC AGCCACTGAAGAACAGGCAAATCAAAGCTTCCTTCAAATAA -3 Figur 2: DNA sequence of the gene amplified by PCR 11

12 Links: 1. New England Biolabs home page about restriction enzymes: 2. QIAgen minelute PCR purification kit: on/minelute/ _hb_qq_minelute_0604.pdf 3. New England Biolabs home page about the quick ligation kit: 12