NZYGene Synthesis kit

Transcription

1 Kit components Component Concentration Amount NZYGene Synthesis kit Catalogue number: MB33901, 10 reactions GS DNA Polymerase 1U/ μl 30 μl Reaction Buffer for GS DNA Polymerase μl dntp mix 2 mm 150 μl MgSO4 25 mm 100 μl - 10 μl Reaction Buffer for UltraPrecise T7 Endonuclease I μl phtp0 vector - 10 μl Reaction Buffer μl NZYEasy enzyme mix - 5 μl Positive control a - 10 μl NZYStar Competent Cells b ml Competent Cells Control Plasmid c 0.1 ng/l 10 μl Description NZYGene Synthesis kit was designed to easily synthesise any DNA fragment using PCR assembly & amplifications protocols. The kit includes an additional error correction step with, which is a new generation of enzymes that recognizes and cleave DNA sequences with DNA mismatches. The integrated NZYGene Synthesis workflow (Figure 1) follows simple, rapid and accurate protocols to facilitate whole gene synthesis. Briefly, the NZYGene synthesis system starts with the design of overlapping oligonucleotides required to produce the desired genes. Overlapping oligonucleotides are assembled into a new DNA fragment by PCR using a high-fidelity DNA polymerase. The innovative enzyme is added to recognise and cleave DNA mismatches resulting from gene assembly allowing the removal of errors that accumulate during the PCR reaction. A final amplification is required to produce errorcorrected DNA fragments that are directly cloned into phtp0 cloning vector following the NZYEasy cloning system. No further additional steps for the removal of errors from synthesised genes, e.g. site-directed mutagenesis, are required. All protocols of this kit were optimized to display high efficiencies and a reduced error rate associated with the production of synthetic genes. a Positive Control: PCR fragment provided for 5 experiments. b Genotype of NZYStar competent cells: enda1 hsdr17(r k-, m k+) supe44 thi - 1 reca1 gyra96 rela1 lacf proa + B + laci q ZM15 :Tn10(Tc R ). c Ampicillin resistance. NZYGene synthesis protocol Before you start using this protocol, please read carefully the NZYGene Synthesis User Guide available at 1. NZYGene synthesis workflow The Figure 1 below represents the integrated NZYGene Synthesis workflow developed for the efficient production of synthetic genes based on oligonucleotide assembly by PCR. The whole procedure consists in seven main steps: oligonucleotide design and synthesis, PCR assembly (PCR1), PCR amplification (PCR2), error correction with UltraPrecise T7 Endonuclease I, PCR amplification (PCR3), NZYEasy cloning, transformation and screening. Note: the yellow triangles represent errors in the DNA sequence. This kit has been successfully used in high-throughput (HTP) platforms for the efficient gene synthesis of a large number of genes at a scale compatible with the functional screen of hundreds to thousands of genes. Storage temperature Store NZYStar Competent Cells at -80 C. Other kit components may be stored at -20 C or at -80 C. NZYGene Synthesis kit components are stable up to the expiry date specified with the product.

2 2. Guidelines for Oligonucleotide Design The synthesis of an artificial gene based on oligonucleotide assembly by PCR requires a pool of overlapping oligonucleotides (forward and reverse). Synthetic oligonucleotides from forward and reverse pools are annealed by PCR assembly, followed by PCR amplification to originate the full-length gene. The DNA sequence of the gene to synthesise is used as template to design the assembly oligonucleotides by dividing the entire sequence into overlapping primers with defined lengths (See Figure 2 below). The external oligonucleotides, termed outer primers, correspond to the external forward and reverse primers (F1 and R1), and internal oligonucleotides (termed inner primers) are usually present in higher number than outer primers. We recommend designing oligonucleotides with a length between bp, which is presently the maximum synthetic length that ensures high fidelity. Each strand of the desired gene should be dissected into overlapping oligonucleotides with bp overlap regions between forward and reverse complementary oligonucleotides. We recommend designing oligonucleotides spaced by 20 bases (named gap). Gaps are not mandatory but they allow to reduce the cost of oligonucleotides. Besides gene sequence, the following 16 bp overhangs must be included on 5 ends of both outer oligonucleotides (F1 and R1), in order to provide the required vector-complementary single-strand terminals: Forward overhang: 5 -TCAGCAAGGGCTGAGG -3 Reverse overhang: 5 -TCAGCGGAAGCTGAGG -3 We recommend using standard purity oligonucleotides (i.e., desalted). However, you should ensure that the oligonucleotide quality is high and compatible with gene synthesis protocols. Purifications are not apropriate since there is a high cost associated with oligonucleotide purifications, such as HPLC or PAGE. 3. Guidelines for PCR assembly and amplifications We strongly recommend using a high-fidelity DNA polymerase to minimize errors introduced during gene assembly by PCR. PCR Assembly: i) Oligonucleotides can be synthesised at any concentration as long as the final inner and outer primers concentration are kept at 20 nm and 800 nm, respectively, in the PCR assembly reaction. ii) We recommend grouping all inner oligonucleotides used in PCR assembly into a pool (named inner oligonucleotide mixture) at 125 nm concentration (work solution). For optimal cloning efficiencies, spin-column purification of the PCR3 product using NZYGelpure kit (NZYTech, cat. No. MB011) or other similar kit is highly recommended. Gel-extraction of the desired band should be ever performed in case non-specific amplifications or primerdimers are formed, thus enhancing cloning efficiencies. 4. Standard Protocol 4.1 PCR assembly (PCR1) The following protocol serves as a general guideline and a starting point for step 1 of NZYGene Synthesis workflow - PCR assembly. Optimal reaction conditions (incubation times and temperatures, concentration of DNA Polymerase) may vary with the number of oligonucleotides used as template and may need to be optimized For each gene to be synthesised, prepare an inner oligonucleotide mixture at 125 nm per primer, containing all inner oligonucleotides On ice, in a sterile, nuclease-free microcentrifuge tube, prepare a reaction mixture for the appropriate number of genes to be synthesised. A single reaction mixture should combine the following components (for a 50 μl reaction): 10 Reaction buffer for GS DNA polymerase 5 μl Inner oligonucleotide mixture Outer oligonucleotides (F1 and R1) 20 nm 800 nm Mix and centrifuge the reactions in a microcentrifuge Perform PCR assembly using the following cycling Annealing C * 8 s Extension 70 C 3 s/kb *Annealing temperature should be a mean value based on primer set used in PCR assembly; typically it should be Tm (mean)-5 ºC Confirm the efficiency of PCR assembly by analysing the PCR1 products through agarose gel Note: There should be a smear band that correspond to oligonucleotides assembly Proceed with PCR amplification (PCR2). 20

3 4.2 PCR amplification (PCR2) A 5 μl aliquot of the resulting PCR1 product should be used as template to perform a second PCR (PCR2), which uses exclusively outer oligonucleotides, thus ensuring the production of the full-length gene of interest. 10 Reaction buffer for Template DNA 5 μl x On ice, prepare the following PCR2 reaction in a 50 μl reaction. PCR1 product 5 μl 10 Reaction buffer for GS DNA polymerase 5 μl Outer oligonucleotide F1 Outer oligonucleotide R Denature and re-anneal the diluted PCR product in a thermocycler using the following conditions: Temp. Time 95 ºC 2 min 4 ºC 5 min 37 ºC 5 min 4 ºC Place the re-annealed PCR on ice. Add UltraPrecise T7 Endonuclease I to the re-annealed PCR products as follows: Mix and centrifuge the reactions in a microcentrifuge Perform PCR assembly using the following cycling Annealing 60 C 10 s Extension 70 C 20 s/kb 30 Re-annealed PCR product 10 μl Mix thoroughly by pipetting up and down Incubate the error correction mix at 25 ºC for 30 minutes. After the incubation, immediately place the reaction on ice Add of 50 mm EDTA (not provided) to slow the activity Proceed immediately with the final PCR amplification in order to finish the gene synthesis protocol Confirm the efficiency of PCR amplification by analysing the PCR2 products through agarose gel Note: There should be a defined band of the correct size For optimal error correction efficiencies, proceed with a spin-column purification of the PCR2 product using NZYGelpure kit (NZYTech, cat. No. MB011) or other similar kit is highly recommended Measure the concentration of the PCR2 product using an apropriate methodology, such as the Nanodrop. 4.3 Error correction with The incorporation of during gene synthesis will allow the efficient removal of errors originated from the initial assembly reactions. Thus, the 3-5 exonuclease activity of this enzyme allows correcting the DNA fragments produced in first PCR amplifications, obtaining error-free DNA fragments after the final amplification (PCR3) Dilute the PCR2 product to 25 ng/μl in 1 Reaction buffer for, as follows: 4.4 Final PCR amplification (PCR3) The products of digestion with UltraPrecise T7 Endonuclease I are assembled and amplified in a final PCR (PCR3) to recover the error-corrected DNA fragments On ice, prepare the following PCR3 reaction in a 50 μl reaction. Error-corrected DNA product 2 μl 10 Reaction Buffer for GS DNA polymerase 5 μl Outer oligonucleotide F1 Outer oligonucleotide R Mix and centrifuge the reactions in a microcentrifuge Perform PCR assembly using the following cycling

4 Annealing 60 C 10 s Extension 70 C 20 s/kb Confirm the efficiency of the PCR amplification by analysing the PCR3 products through agarose gel Note: There should be a defined band at the correct size Clean PCR3 products using a spin-column purification method, such as NZYGelpure kit (NZYTech, cat. No. MB011) Proceed to NZYEasy cloning reaction. 4.5 NZYEasy cloning reaction Please use the table below to determine the optimal amount of the insert DNA, in nanograms, to be used in a cloning reaction: Fragment length (bp) (1) Optimal DNA quantity for Cloning reaction (ng) ( 1) ng of insert required = DNA fragment length (bp) e.g. 500 bp gene = 500 x = 41.5 ng of DNA On ice, in a sterile, nuclease-free microcentrifuge tube, prepare the following reaction mixture: Component Volume Purified DNA fragment x μl (1,2) phtp0 vector (3) 10x Reaction Buffer NZYEasy enzyme mix 0.5 μl up to 10 μl Centrifuge briefly to collect the reaction components. 4.6 Transformation Add 10 µl of NZYEasy ligation product directly into 200 µl NZYStar competent cells Place the mixture on ice for 30 min. Heat shock cells at 42 C for 40 seconds. Place tube on ice for 2 minutes Add 900 µl of pre-warmed SOC media and incubate at 200 rpm at 37 C for 1 hour Centrifuge at 5000 rpm for 1 min. Remove 900 µl of supernatant Re-suspend cells by gentle pipetting. Spread 100 µl of the cells onto the selection LB agar plates containing 200 µg/ml ampicillin Incubate inverted plates overnight at 37 C. 4.7 Screening for recombinant clones containing the synthetic gene Screening for recombinants can easily be achieved by colony- PCR, and/or sequencing. For colony PCR or sequencing use the following phtp0 vector-specific primers: phtp0 forward primer: 5 - GAGCGGATAACAATTTCACACAGG -3 phtp0 reverse primer: 5 - GTTTTCCCAGTCACGACGTTG -3 Note: After running on an agarose gel, the expected size of the insert amplified using the phtp0 vector-specific primers will be incremented by extra 268 bp Select 2-4 colonies to analyse and verify if the synthetic gene is synthesised correctly and cloned in the correct orientation. phtp0 vector Nucleotide sequence and properties of phtp0 cloning vector are available for download at (1) Use a maximum of 7.5 µl of purified PCR insert when it is not possible to use the recommended optimal amount. (2) Positive Control: PCR fragment of 500 bp is provided at 21.0 ng/μl (enough for 5 experiments). Please use 2 μl per reaction. (3) phtp0 vector is provided in a ready-to-use form Mix the reactions by pipetting and spin to collect contents at the bottom of the tubes Perform the cloning reaction in a thermal cycler programmed with the following protocol: Temperature ( C) Time (min)

5 Quality control assays Purity GS DNA polymerase, and NZYEasy enzyme mix are >95% pure as judged by SDS polyacrylamide gel electrophoresis followed by Coomassie blue staining. Nucleases assay All components of the kit are tested for nucleases activities, using μg of pnzy28 plasmid DNA. Following incubation at 37 C for hours, the DNA is visualized on a GreenSafe-stained agarose gel. There must be no visible nicking or cutting of the DNA. Functional assay All components of the kit are functionally tested in a gene synthesis reaction, followed by a cloning and transformation assays. >80% of the recombinant plasmids must contain the gene of interest without sequence errors. Revised 1/17 Certificate of Analysis Test Enzyme purity Nucleases assay Functional assay Result Approved by: José Prates Senior Manager, Quality Systems Estrada do Paço do Lumiar, Campus do Lumiar, Edifício E, R/C, Lisboa Tel: Fax: