mefloquine in West Africa: implication in artemisinin combination therapies efficacy

Transcription

1 JCM Accepts, published online ahead of print on July 00 J. Clin. Microbiol. doi:0./jcm.00-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. 0 0 Pfmdr amplification associated with clinical resistance to mefloquine in West Africa: implication in artemisinin combination therapies efficacy Benoit Witkowski,,, Xavier Iriart,,, Patrice Njomnang Soh,, Sandie Menard,, Muriel Alvarez, Veronique Naneix-Laroche, Bruno Marchou, Jean-François Magnaval, Françoise Benoit-Vical,,, Antoine Berry,, * Running head: mefloquine and pfmdr in Africa Service de Parasitologie-Mycologie, Centre Hospitalier Universitaire de Toulouse, Université de Toulouse and Faculté de Médecine de Rangueil, Université de Toulouse III, Toulouse, France ; CNRS; Laboratoire de Chimie de Coordination, UPR, Toulouse, France, and Université de Toulouse III, Toulouse, France ; UMR MD-UM-UPS, Université Paul Sabatier Toulouse III, France ; Service des Maladies Infectieuses et Tropicales, Centre Hospitalier Universitaire de Toulouse, Toulouse, France. Authors B.W. and X.I. contributed equally to this manuscript. Authors F.B.V. and A.B contributed equally to this manuscript. Keywords: mefloquine, ACT, resistance, Pfmdr amplification, Africa *Correspondence: Service de Parasitologie-Mycologie, Centre Hospitalier Universitaire de Toulouse, Hôpital Rangueil, TSA 00, 0 Toulouse Cedex, France. Phone:. Fax: 0. berry.a@chu-toulouse.fr Downloaded from on March, 0 by guest

2 0 0 Abstract We describe here a clinical failure in the treatment with mefloquine of acute falciparum malaria contracted in Africa associated with in vitro mefloquine-resistance and pfmdr copy number amplification. This case raises the question of the presence and the evolution of this genotype in Africa that is also known to alter the artemisinin combination therapies (ACT) susceptibility. Case report On March 0 th, 00, a -year-old man was admitted to the Tropical and Infectious Disease Unit of the Toulouse University hospital (France) with a -day history of a fever associated with shaking chills and nausea. This patient went to Benin in August 00 for humanitarian purposes and returned to France on February 0 th, 00 (Fig. ). In the month preceding his arrival in Benin, he had travelled in Burkina Faso, Senegal, Mauritania, and Mali. He had never taken any malaria chemoprophylaxis. A few days before his return to France on February 0 th, the patient reported an acute clinical malaria crisis, without parasitological diagnostic evidence, treated in Benin with artesunate 00 mg orally for the first day, and 00 mg/d for the following four days. On February th, a new P. falciparum malaria attack was diagnosed in Tarbes Hospital (France) by a thin blood smear (0. % parasitemia) and by a Core Malaria Pf test (Core Diagnostics), an immunochromatographic rapid diagnostic test (RDT) detecting the P. falciparum-specific antigen histidine-rich protein (). Blood tests showed a slight anemia ( g/l) and a thrombocytopenia ( G/L). He was treated with mefloquine (MQ) (0 mg, 00 mg, and 0 mg oral doses spaced out hours apart) which was well tolerated and seemed efficient. On March th, in the face of the same clinical signs of malaria again, the Downloaded from on March, 0 by guest

3 0 0 patient took a further antimalarial treatment with MQ on his own initiative and using the same protocol. At the time of admission (March 0 th ) to the University hospital, the patient felt tired but was afebrile without nausea or vomiting. The clinical examination (weight kg) was normal without hepatosplenomegaly. All the biological parameters (haemoglobin: g/l, platelet count: G/L) were in a normal range. The thin blood smear revealed 0. % P. falciparum parasitemia. The species identification was confirmed both by a positive histidine-rich protein RDT, the Core Malaria Pf test (Core Diagnostics) and by a P. falciparum-specific PCR which amplifies a base pairs fragment of the mitochondrial Cox gene (primers sequences: Pf: -GGAATGTTATTGCTAACAC- and Pf: - AATGAAGAGCTGTGTATC - (). As the treatment with MQ was clinically ineffective, oral treatment with quinine was initiated, 00 mg (one tablet every hours). Quinine was switched after one day to chloroquine (CQ) for days given the wild-type K haplotype on the pfcrt gene (indicating chloroquine-sensitive parasites) which was determined by qpcr (). The CQ treatment was well tolerated and efficient. The sensitivity to chloroquine and to artemisinin was determined in vitro whereas these parasites were shown resistant to MQ and quinine (Table ). This in vitro radioisotopic chemo-susceptibility analysis was based on parasite growth estimated by [ H] hypoxanthine incorporation. The IC 0 values were determined with GraphPad software by plotting the drug concentration versus the percentage of parasite growth inhibition at h of incubation (). The determination of the Pfmdr copy number was carried out by qpcr on a LightCycler0 with the SYB Green I Master kit (Roche Diagnostics) as described by Witkowski et al (). Primers used were from Price et al (), pfmdr-f: -TGCATCTATAAAACGATCAGACAAA- and pfmdr-r: - TCGTGTGTTCCATGTGACTGT- for pfmdr gene; β-tubulin-f: - TGATGTGCGCAAGTGATCC- and β-tubulin-r: - Downloaded from on March, 0 by guest

4 0 0 TCCTTTGTGGACATTCTTCCTC- for β-tubulin gene. Briefly, β-tubulin was used as one copy reference gene. In each experiment, DNA from the laboratory strains of FcM- Cameroon ( pfmdrcopy) and Dd (- pfmdrcopies) were used as controls. The patient s sample was analyzed in triplicate and was checked twice. The P. falciparum isolate from the patient showed between - copies of pfmdr (copy number value at. ± 0.). The sequencing of pfmdr was performed on a 00 Genetic Analyzer (Applied Biosystems). Primers used were Pfmdr-nest-F: TGTATGTGCTGTATTATCAGGA and Pfmdr-nest-R: CTCTTCTATAATGGACATGGTA for the analysis of codons and ; Pfmdr-nest-F: GAATTATTGTAAATGCAGCTTTA and Pfmdr-nest-R: GCAGCAAACTTACTAACACG for the analysis of codon. Experimentations revealed wild-type N and D alleles and a mutated YF allele (Table ). Discussion To our knowledge, this case is the first observation showing a link between this pfmdr genotype and MQ clinical resistance to falciparum malaria in Africa. This P. falciparum isolate harbored the molecular markers associated with MQ-resistance: a high copy number of pfmdr (. ± 0.) with wild-type N and D alleles, that could explain in part the very high IC 0 values for MQ, quinine, the low IC 0 value for CQ and the MQ clinical failure. Mefloquine-resistant malaria is well known in Southeast Asia and particularly in some parts of Thailand, Burma and Cambodia. This resistance is directly linked to the extensive use of MQ, an aryl-amino-alcohol, as the first line treatment for falciparum malaria since the mid 0s (). In Africa, mefloquine-resistant isolates exist for a long time even when MQ was not used (, ) but only one clinical failure with MQ in a curative treatment regimen has previously been described in 0 (0). Moreover, MQ-susceptibility is usually inversely correlated to CQ-susceptibility as observed in our case (). Thus, the very low number of MQ Downloaded from on March, 0 by guest

5 0 0 resistant isolates is possibly related, first to the low use of MQ in this area and secondly to the high prevalence of CQ-resistant isolates due to massive CQ-pressure in the whole of Africa for decades. Amplification of the pfmdr gene is the most relevant molecular marker associated with resistance to MQ in the field (). In Africa, pfmdr amplification was rarely reported. Only isolates ( in Ivory Cost, in Togo, in Burkina Faso, in Gabon and in Kenya) from samples tested have been found (,,, ). An increase in the pfmdr copy number is also associated with an in vitro decrease in sensitivity to other aryl-amino-alcohols, in particular lumefantrine, the partner of artemether in one of the major ACT used worldwide (, ). Similarly, a positive correlation between the decrease in susceptibility to artemisinin derivatives and pfmdr amplification has also been observed (, ). Interestingly, clones with pfmdr amplification nearly all had the wild-type N pfmdr allele (,, ) since only clones in different studies have been described with the mutated NY allele (, ). In vitro, the N and D alleles, independently of the pfmdr copy number, are associated with a lower susceptibility to MQ and to lumefantrine (,, ). In summary, pfmdr amplification and the N allele pose not only the problem of resistance to MQ but also reduced susceptibility to ACT. Nevertheless a selection of mefloquine resistant clones directly intra-host () is also quite plausible here since this patient was treated with MQ for nearly months (Fig. ). Indeed, Pfmdr duplication or amplification from to copies, are frequent genetic events (respectively /0 or /x0 parasites per asexual cycles) (). The conditions for the emergence of pfmdr amplification in Southeast Asia such as the high pressure of MQ monotherapy or low level of transmission should never occur in Africa suggesting a low risk of this genotype to develop. Nevertheless, the rapid abandonment of CQ in the treatment of P. falciparum malaria in all African areas, replaced by ACT, will allow the Downloaded from on March, 0 by guest

6 0 0 reappearance of genotypes such as the N haplotype on pfmdr (, ) that are favorable to the decreasing effectiveness of aryl-amino-alcohols. This could occur faster than observed in Southeast Asia as the non-falciparum species that are still treated with CQ are less present in Africa (< 0 %) than in Asia (0 %). Furthermore lumefantrine, widely prescribed in Africa with artemether, is well known to also select the pfmdr genotype leading to a lesser susceptibility to aryl-amino-alcohols (, ). Added to this, prevalence of pfmdr amplification may be increased by some combined formulations such as MQ+artesunate and MQ+sulfadoxine-pyrimethamine, used in several African countries although not supported by official health policies (, 0).. The global switch from CQ to aryl-amino-alcohol-based ACTs would be a critical conjunction for the emergence of clones with drug resistance related to the pfmdr genotype. As the emergence of this genotype could announce the decline of ACT efficacy, the molecular monitoring of the pfmdr genotype is therefore now warranted to optimize the management of antimalarial policy and thus to ensure a longer period of efficacy for the ACT treatments. Acknowledgments The authors gratefully acknowledge John Woodley for the English revision of the manuscript. Downloaded from on March, 0 by guest

7 0 0 References. Basco L.K., Le Bras J., Rhoades Z., Wilson C.M., and. Analysis of pfmdr and drug susceptibility in fresh isolates of Plasmodium falciparum from Subsaharan Africa. Mol. Biochem. Parasitol. :-.. Beadle, C., G. W. Long, W. R. Weiss, P. D. McElroy, S. M. Maret, A. J. Oloo, and S. L. Hoffman.. Diagnosis of malaria by detection of Plasmodium falciparum HRP- antigen with a rapid dipstick antigen-capture assay. Lancet :-.. Benoit-Vical, F., J. Lelievre, A. Berry, C. Deymier, O. Dechy-Cabaret, J. Cazelles, C. Loup, A. Robert, J. F. Magnaval, and B. Meunier. 00. Trioxaquines are new antimalarial agents active on all erythrocytic forms, including gametocytes. Antimicrob Agents Chemother :-.. Berry, A., A. Vessiere, R. Fabre, F. Benoit-Vical, B. Marchou, P. Massip, and J. F. Magnaval. 00. Pfcrt KT mutation and its associations in imported Plasmodium falciparum malaria cases. Infect Genet Evol :-.. Carrara, V. I., J. Zwang, E. A. Ashley, R. N. Price, K. Stepniewska, M. Barends, A. Brockman, T. Anderson, R. McGready, L. Phaiphun, S. Proux, M. van Vugt, R. Hutagalung, K. M. Lwin, A. P. Phyo, P. Preechapornkul, M. Imwong, S. Pukrittayakamee, P. Singhasivanon, N. J. White, and F. Nosten. 00. Changes in the treatment responses to artesunate-mefloquine on the northwestern border of Thailand during years of continuous deployment. PLoS ONE :e.. Chippaux, J. P., A. Massougbodji, P. Olliaro, F. Gay, S. Caligaris, and M. Danis.. Sensitivity in vitro of Plasmodium falciparum to chloroquine and mefloquine in two regions of Benin. Trans R Soc Trop Med Hyg :-.. Dokomajilar, C., S. L. Nsobya, B. Greenhouse, P. J. Rosenthal, and G. Dorsey. 00. Selection of Plasmodium falciparum pfmdr alleles following therapy with Downloaded from on March, 0 by guest

8 0 0 artemether-lumefantrine in an area of Uganda where malaria is highly endemic. Antimicrob Agents Chemother 0:-.. Duraisingh, M. T., P. Jones, I. Sambou, L. von Seidlein, M. Pinder, and D. C. Warhurst The tyrosine- allele of the pfmdr gene of Plasmodium falciparum is associated with increased sensitivity to the anti-malarials mefloquine and artemisinin. Mol Biochem Parasitol 0:-.. Fabre, R., A. Berry, B. Morassin, and J. F. Magnaval. 00. Comparative assessment of conventional PCR with multiplex real-time PCR using SYBR Green I detection for the molecular diagnosis of imported malaria. Parasitology :-. 0. Gay, F., M. H. Binet, M. D. Bustos, B. Rouveix, M. Danis, C. Roy, and M. Gentilini. 0. Mefloquine failure in child contracting falciparum malaria in West Africa. Lancet :0-.. Holmgren, G., A. Bjorkman, and J. P. Gil. 00. Amodiaquine resistance is not related to rare findings of pfmdr gene amplifications in Kenya. Trop Med Int Health :0-.. Kublin, J. G., J. F. Cortese, E. M. Njunju, R. A. Mukadam, J. J. Wirima, P. N. Kazembe, A. A. Djimde, B. Kouriba, T. E. Taylor, and C. V. Plowe. 00. Reemergence of chloroquine-sensitive Plasmodium falciparum malaria after cessation of chloroquine use in Malawi. J Infect Dis :0-.. Lim, P., A. P. Alker, N. Khim, N. K. Shah, S. Incardona, S. Doung, P. Yi, D. M. Bouth, C. Bouchier, O. M. Puijalon, S. R. Meshnick, C. Wongsrichanalai, T. Fandeur, J. Le Bras, P. Ringwald, and F. Ariey. 00. Pfmdr copy number and arteminisin derivatives combination therapy failure in falciparum malaria in Cambodia. Malar J :. Downloaded from on March, 0 by guest

9 0 0. Meremikwu, M., U. Okomo, C. Nwachukwu, A. Oyo-Ita, J. Eke-Njoku, J. Okebe, E. Oyo-Ita, and P. Garner. 00. Antimalarial drug prescribing practice in private and public health facilities in South-east Nigeria: a descriptive study. Malar J :.. Oduola, A. M., W. K. Milhous, L. A. Salako, O. Walker, and R. E. Desjardins.. Reduced in-vitro susceptibility to mefloquine in West African isolates of Plasmodium falciparum. Lancet :0-.. Pickard, A. L., C. Wongsrichanalai, A. Purfield, D. Kamwendo, K. Emery, C. Zalewski, F. Kawamoto, R. S. Miller, and S. R. Meshnick. 00. Resistance to antimalarials in Southeast Asia and genetic polymorphisms in pfmdr. Antimicrob Agents Chemother :-.. Preechapornkul, P., M. Imwong, K. Chotivanich, W. Pongtavornpinyo, A. M. Dondorp, N. P. Day, N. J. White, and S. Pukrittayakamee. 00. Plasmodium Falciparum Pfmdr Amplification, Mefloquine Resistance, and Parasite Fitness. Antimicrob Agents Chemother.. Price, R. N., A. C. Uhlemann, A. Brockman, R. McGready, E. Ashley, L. Phaipun, R. Patel, K. Laing, S. Looareesuwan, N. J. White, F. Nosten, and S. Krishna. 00. Mefloquine resistance in Plasmodium falciparum and increased pfmdr gene copy number. Lancet :-.. Price, R. N., A. C. Uhlemann, M. van Vugt, A. Brockman, R. Hutagalung, S. Nair, D. Nash, P. Singhasivanon, T. J. Anderson, S. Krishna, N. J. White, and F. Nosten. 00. Molecular and pharmacological determinants of the therapeutic response to artemether-lumefantrine in multidrug-resistant Plasmodium falciparum malaria. Clin Infect Dis : Sayang, C., M. Gausseres, N. Vernazza-Licht, D. Malvy, D. Bley, and P. Millet. 00. Treatment of malaria from monotherapy to artemisinin-based combination Downloaded from on March, 0 by guest

10 0 0 therapy by health professionals in urban health facilities in Yaounde, central province, Cameroon. Malar J :.. Sidhu, A. B., S. G. Valderramos, and D. A. Fidock. 00. Pfmdr mutations contribute to quinine resistance and enhance mefloquine and artemisinin sensitivity in Plasmodium falciparum. Mol Microbiol :-.. Sisowath, C., J. Stromberg, A. Martensson, M. Msellem, C. Obondo, A. Bjorkman, and J. P. Gil. 00. In vivo selection of Plasmodium falciparum pfmdr N coding alleles by artemether-lumefantrine (Coartem). J Infect Dis :0-.. Uhlemann, A. C., R. McGready, E. A. Ashley, A. Brockman, P. Singhasivanon, S. Krishna, N. J. White, F. Nosten, and R. N. Price. 00. Intrahost selection of Plasmodium falciparum pfmdr alleles after antimalarial treatment on the northwestern border of Thailand. J Infect Dis :-.. Uhlemann, A. C., M. Ramharter, B. Lell, P. G. Kremsner, and S. Krishna. 00. Amplification of Plasmodium falciparum multidrug resistance gene in isolates from Gabon. J Infect Dis :0-.. Witkowski, B., M. L. Nicolau, P. N. Soh, X. Iriart, S. Menard, M. Alvarez, B. Marchou, J. F. Magnaval, F. Benoit-Vical, and A. Berry. Plasmodium falciparum isolates with increased pfmdr copy number circulate in West Africa. Antimicrob Agents Chemother :0-. Downloaded from on March, 0 by guest 0

11 0 0 Figure and legend Fig. BENIN Legend Figure : Feb Self-medication ATS st probable malaria attack Return from Benin Feb 0 Feb Mar Tarbes Hospital M Q nd P. falciparum attack (0.%) FRANCE Self-medication M Q rd probable malaria attack Time of admission Mar 0 Toulouse Hospital Q CQ th P. falciparum attack (0.%) Summary of the patient's malaria attacks and treatment. The periods of treatment (dark grey areas) and mean half-life (pale grey areas) of artesunate (ATS), mefloquine (MQ) are shown. The % of parasitemia are in brackets. Downloaded from on March, 0 by guest

12 0 0 Table : IC 0 value of this P. falciparum isolate Drugs IC 0 (nm) IC 0 value of mefloquine (MQ), chloroquine (CQ), quinine (Q) and artemisinin (ART) obtained with this isolate by the radioactive micro-method. NA: data not available Resistance thresholds (nm) MQ CQ 00 Q ART 0 NA Table : Pfmdr genotype of this P. falciparum isolate Molecular markers Alleles pfmdr copy number.±0. codon codon codon N YF D Downloaded from on March, 0 by guest