Genetically Diverse Long-Lived Clonal Lineages of Phytophthora capsici from Pepper in Gansu, China

Transcription

1 Genetics nd Resistnce Geneticlly Diverse Long-Lived Clonl Lineges of Phytophthor cpsici from Pepper in Gnsu, Chin Jin Hu, Zhili Png, Yng Bi, Jingpeng Sho, Yongzho Dio, Jinguo Guo, Yonggng Liu, Heping Lv, Kurt Lmour, nd Xili Liu First, second, third, fourth, fifth, nd tenth uthors: Deprtment of Plnt Pthology, Chin Agriculturl University, Beijing , Chin; sixth, seventh, nd eighth uthors: Plnt Protection Institute, Gnsu Acdemy of Agriculturl Science, Lnzhou , Chin; nd first nd ninth uthors: Deprtment of Entomology nd Plnt Pthology, University of Tennessee, Knoxville Accepted for publiction 12 Mrch ABSTRACT Hu, J., Png, Z., Bi, Y., Sho, J., Dio, Y., Guo, J., Liu, Y., Lv, H., Lmour, K., nd Liu, X Geneticlly diverse long-lived clonl lineges of Phytophthor cpsici from pepper in Gnsu, Chin. Phytopthology 103: Phytophthor cpsici cuses significnt loss to pepper production in Chin, nd our objective ws to investigte the popultion structure in Gnsu province. Between 2007 nd 2011, 279 isoltes were collected from pepper t 24 loctions. Isoltes (or subsets) were ssessed for simple sequence repet (SSR) genotype, metlxyl resistnce, mting type, nd physiologicl rce using cultivrs from the World Vegetble Center (AVRDC) nd New Mexico recombinnt inbred lines (NMRILs). The A1 nd A2 mting types were recovered from nine loctions nd metlxylresistnt isoltes from three loctions. A totl of 104 isoltes tested on the AVRDC pnel resolved five physiologicl rces. None of 42 isoltes tested on the NMRIL pnel cused visible infection. SSR genotyping of 127 isoltes reveled 59 unique genotypes, with 42 present s singletons nd 17 hving 2 to 13 isoltes. Isoltes with identicl genotypes were recovered from multiple sites cross multiple yers nd, in mny cses, hd different rce types or metlxyl sensitivities. Isoltes clustered into three groups with ech group hving lmost exclusively the A1 or A2 mting type. Overll it ppers long-lived geneticlly diverse clonl lineges re dispersed cross Gnsu, outcrossing is rre, nd functionlly importnt vrition exists within clonl frmework. Phytophthor cpsici Leonin ws first described in New Mexico s the cusl gent of chili pepper blight (26) nd hs wide host rnge, including pepper, tomto, eggplnt, cucurbits, nd snp nd lim ben (15,39). P. cpsici infects roots, crown, folige, nd fruit nd cuses problems worldwide (2,9,20,25, 36,37). Epidemics re driven by the sexul life cycle nd, during wrm nd wet conditions, P. cpsici produces lrge numbers of deciduous sporngi. Sporngi cn directly germinte nd infect plnts or relese swimming zoospores in wter to indirectly infect plnts (8,15). P. cpsici is heterothllic nd requires the interction of two mting types (A1 nd A2) to initite sexul reproduction nd produce thick-wlled oospores (19). Oospores survive hrsh environments (cold, dry, or fllow periods) for severl yers (15,18). The phenotypic nd genotypic diversity of P. cpsici hs been investigted t loctions worldwide (1,12,17,23,30,36,37). In North Americ nd South Afric, popultions re diverse nd outcrossing ppers to be common (11,23,30). In North Americ, the popultion structure is dynmic. At the beginning of the growing seson, diverse isoltes initite epidemics but, s the seson progresses, clonl lineges my dominte limited res (single or nerby fields) (6,21,23). In generl, clonl lineges do not pper to persist between yers or cross wide res. In South Americ, the popultion structure of P. cpsici is quite different nd, in Peru nd Argentin, clonl lineges re found cross wide geogrphicl res (entire countries) nd survive for severl yers (12,17). In Chin, P. cpsici ws first reported in Jingsu province in the 1960s nd is now found on pepper, tomto, eggplnt, nd cowpe Corresponding uthor: X. Liu; E-mil ddress: seedling@cu.edu.cn PHYTO R 2013 The Americn Phytopthologicl Society cross the country (43). Despite being widespred, the popultion structure of P. cpsici in most res is unknown (41,42). In 2008, 37 P. cpsici isoltes from estern Chin were shown to be ll A1 mting types nd to hve diverse rndomly mplified polymorphic DNA (RAPD) genotypes, lthough the number of unique genotypes ws not specified (37). In Yunnn province, both A1 nd A2 mting types were found in some fields nd sexul reproduction ws predicted (41). In ddition, sensitivity to metlxyl or mefenoxm hs been investigted in different res of Chin nd the frequency of resistnce vries mong popultions (28,33). Gnsu province in western Chin hs severl lrge pepper production frms with different cpsicum vrieties. It is the most importnt region for hybrid pepper seed production nd the seed is distributed throughout Chin nd exported to foreign countries. In the pst decde, cpsicum yield hs decresed significntly due to P. cpsici nd, in some cses, frmers hve bndoned pepper production due to the intense disese pressure. Vrious strtegies, including fungicides, resistnt cultivrs, nd biologicl controls, re used to control P. cpsici but few re effective under optiml conditions for disese (15). We re currently conducting countrywide survey of P. cpsici in Chin to better understnd the epidemiology nd popultion diversity. Here, we report metlxyl sensitivity, mting type, physiologicl rce, nd genetic diversity of P. cpsici recovered from Gnsu province nd the implictions for disese mngement. MATERIALS AND METHODS Smple collection nd storge. From 2007 to 2011, pepper plnts with typicl symptoms of Phytophthor blight were collected from pepper frms cross Gnsu province, Chin (Fig. 1). The smpling strtegy ws to collect from s mny sites s possible. Isoltions were mde by removing the epidermis of infected plnts, cutting the phloem into smll pieces, nd plting onto 920 PHYTOPATHOLOGY

2 potto dextrose gr (PDA) rifmpicin-penicillin-pentchloronitrobenzene (RPP) medi. The PDA-RPP medi ws mde by boiling 200 g of potto tubers in distilled wter for 15 min nd filtering through four lyers of cheesecloth. The filtrte ws then combined with 18 g of glucose, 15 g of gr, nd distilled wter to finl volume of 1 liter. The medi ws utoclved t 121 C for 20 min nd cooled to 60 C before dding rifmpicin (98%.i.) t 50 µg/ml (Tuoyingfng Biotech Co., Ltd., Beijing), penicillin (98%.i.) t 50 µg/ml (Tuoyingfng Biotech Co., Ltd.), nd pentchloronitrobenzene (40%.i.) t 50 µg/ml (Snli Chemicl Industry Co., Ltd., Shnxi, Chin). The isoltion pltes were wrpped with Prfilm nd incubted t room temperture (25 C) for 2 to 4 dys, nd coenocytic hyphe growing from the mrgin ws trnsferred to new PDA-RPP pltes. In ll, 1 to 3 isoltes were recovered from ech plnt nd single zoospores isolted (34). For single-zoospore isoltion, isoltes were grown for 4 dys nd plced under fluorescent light t 25 C for 4 dys to produce sporngi. Sporngi were suspended in 10 ml of sterile distilled wter nd incubted t 4 C for 30 min nd then room temperture for 30 to 60 min to stimulte zoospores production, nd 100 µl of the resulting zoospore suspension ws spred onto gr pltes nd incubted for 8 to 12 h in the drk. Single germinting zoospores were visulized using light microscope nd trnsferred to PDA-RPP pltes. For storge, plugs of ctively growing mycelium were trnsferred to 2-ml sterile tubes contining sterile distilled wter nd stored t 18 C. Mting type nd metlxyl resistnce. Mting type ws determined by trnsferring 5-mm-dimeter plug from 7-dyold culture to 9-cm-dimeter V8-RPP gr pltes (160 ml of V8 juice, 18 g of dextrose, nd 12 g of gr in totl volume of 1 liter of medi mended with rifmpicin t 50 µg/ml, penicillin t 50 µg /ml, nd pentchloronitrobenzene t 50 µg/ml) nd piring with known A1 nd A2 mting types (PCAS1 = A1 nd PCAS2 = A2; kindly supplied by Mike Coffey from the University of Cliforni, Riverside Collection). Plugs were pired t roughly 2-cm spcing, nd pltes were incubted in the drk t room temperture (22 to 25 C) for 3 to 5 dys nd checked for the presence of oospores using light microscope t 100 mgnifiction (16). A χ 2 test ws used to test whether the observed rtio of A1/A2 mting types ws significntly different from 1:1 in loctions where >10 unique multilocus simple sequence repet (SSR) genotypes were recovered. Sensitivity to metlxyl ws tested by plcing 5-mm plug from the edge of 7-dy-old cultures onto 9 cm PDA-RPP medi mended with either no metlxyl (control), metlxyl t 5 µg/ml, or metlxyl t 100 µg/ml (Technicl grde 96%.i.; Agroplex P. Ltd., Beijing). Ech combintion of isolte nd concentrtion hd three replicte pltes. All tests were conducted twice. Pltes were incubted in the drk t 25 C for 3 to 5 dys. The dimeter of ech colony ws mesured perpendiculrly nd verged to clculte the percentge of growth inhibition. Isoltes re considered sensitive if growth on medium mended with metlxyl t 5 µg/ml ws <40% growth of the control, intermeditely resistnt if growth on medium mended with metlxyl t 5 µg/ml ws >40% growth of control but growth on medium mended with metlxyl t 100 µg/ml ws <40% growth of the control, or resistnt if growth on medium mended with metlxyl t both 5 nd 100 µg/ml ws >40% growth of the control (4,13,32). Physiologicl rce identifiction. Two sets of cultivr differentils were used to chrcterize physiologicl rces for P. cpsici Fig. 1. Overview of loctions smpled for Phytophthor cpsici nd sptil distribution of three potentil clonl lineges cross Gnsu province from 2007 to Dots denote the 24 smpling loctions. Individul loctions re grouped into regions s NW = northwest, C = centrl, nd SE = southest Gnsu. Number of isoltes with unique genotypes in ech region is listed t the bottom of pie chrt. Vol. 103, No. 9,

3 from Gnsu province. The first included four cultivr lines previously used to identify rces of P. cpsici in Chin (kindly supplied by Dr. Tincheng Wng t the World Vegetble Center [AVRDC]): Erly Clwonder (susceptible), PI (resistnt), PBC137 (prtilly resistnt), nd PBC602 (prtilly resistnt) (3,27). The second included eight recombinnt inbred lines (RILs) (NMRIL- A, NMRIL-B, NMRIL-F, NMRIL-G, NMRIL-H, NMRIL-N, NMRIL-X, nd NMRIL-Z) previously used to identify 13 physiologicl rces in 17 isoltes of P. cpsici mostly from New Mexico (kindly supplied by Dr. Pul Boslnd t New Mexico Stte University) (38). Pepper seedlings were grown in sterile soil in plnting trys composed of 50 cells (cells were 5 by 5 cm) t 25 C in greenhouse for 3 weeks nd inoculted with 3 ml of zoospore suspension t concentrtion of 10 4 zoospores/ml fter the plnts hd been wtered. To prevent movement of inoculum between plnts, the trys rested on metl screens to llow ny excess wter or zoospores to drin out the bottom. Zoospores were prepred s described bove nd the concentrtion djusted with hemcytometer. Ech isolte ws tested on 10 seedlings per cultivr in rndomized complete block design nd ech test ws conducted twice. Control seedlings were inoculted with 3 ml of sterile wter. After inocultion, the trys were plced in greenhouse nd cultivr susceptibility ws ssessed 10 dys fter inocultion. For the AVRDC pnel, cultivr ws considered susceptible if the percentge of obviously infected plnts (browning roots nd wilt symptoms) ws >20% nd resistnt if <20% (3,27). For the NMRILs, plnts with no lesions in the root re were considered resistnt nd plnts with ny visible lesions were considered susceptible (38). Erly Clwonder nd PI were used s susceptible nd resistnt controls, respectively. The dt ws nlyzed using SAS (version 9.2 for Windows). A χ 2 test of homogeneity ws performed to determine whether the dt could be pooled. Genomic DNA nd moleculr identifiction. Mycelium for genomic DNA extrction ws prepred by growing isoltes on cellophne floting on selective medi, s described previously (7). After 7 dys, the mycelium ws hrvested nd stored t 20 C. The mycelium ws immersed in liquid nitrogen nd ground into fine powder using sterile mortr nd pestle nd genomic DNA ws extrcted using cetyltrimethylmmonium bromide procedure s previously described (35) nd stored t 20 C. Isoltes were identified s P. cpsici using polymerse chin rection restriction frgment length polymorphism (PCR-RFLP) of the internl trnscribed spcer (ITS) region with the restriction enzyme MspI (Sigm-Aldrich Shnghi Trding Co., Ltd., Shnghi, Chin) s previously described (5). The ITS region ws PCR mplified using primers A2 (ACTTTCCACGTGAACCG TTTCAA) nd I2 (GATATCAGGTCCAATTGAGATGC) nd the resulting PCR mplicon ws digested in 10-µl rection solution contining 5 µl of the PCR product, 1 µl of MspI, nd 1 µl of 10 restriction endonuclese buffer SL (5). Smples were spun for 5 s before incubtion t 37 C for 30 min, nd the frgments were visulized on 3% high-resolution gr gel. SSR mrkers. Eight previously reported SSR mrkers were tested on 10 P. cpsici isoltes recovered from different yers nd regions in Gnsu (30). The SSR loci were PCR mplified with n initil denturtion t 94 C for 4 min; followed by 35 cycles of 94 C for 30 s, 63 C for 30 s, nd 72 C for 30 s; nd finl extension of 72 C for 7 min. The resulting mplicons were diluted nd resolved on 3730XL sequencer (Applied Biosystems, Foster City, CA) nd mnully scored using Genemrker version The SSR bnds re designted by their lengths nd the llele pirs delimited with the / chrcter, with individuls being homozygous (e.g., 150/150) or heterozygous (e.g., 150/156). Genetic similrity ws ssessed using JMP Genomics 6.0 (SAS Institute Inc., Cry, NC) using the Fst Wrd hierrchicl clustering to produce het mp of similrity. RESULTS Isoltes collection nd moleculr identifiction. In totl, 279 isoltes were recovered from 24 loctions in the northwest, centrl, nd southest regions of Gnsu province (Fig. 1). Most isoltes (n = 263) were recovered from hot pepper nd sweet pepper in 2010 nd An dditionl 16 isoltes recovered from pepper in 2007 nd 2009 were kindly supplied by the Plnt Protection Institute of the Gnsu Acdemy of Agriculturl Science (Tble 1). All isoltes were confirmed to be P. cpsici bsed on the four mjor ITS RFLP bnds dignostic for P. cpsici (251, 221, 204, nd 77 bp) (5). In ddition, ll isoltes displyed the key morphologicl chrcteristics common to P. cpsici, including elongted sporngi with prominent ppille on long pedicels nd heterothllism. No chlmydospores were observed in culture. Mting type nd metlxyl resistnce determintion. A1 nd A2 mting types were recovered from ech region. Overll, there were 153 (54.8%) A1 nd 126 (45.2%) A2 mting types (Tble 1). Both mting types were recovered from nine loctions (dt not shown). In ddition, A1 nd A2 isoltes were recovered from the sme pepper plnt t one loction. A χ 2 test for mting type using ll isoltes with unique genotypes indicted tht the observed numbers of A1 nd A2 isoltes meet the expecttions for 1:1 rtio. Only one loction hd >10 unique genotypes nd the A1/A2 rtio t this loction devited significntly from 1:1. The percentges of metlxyl sensitive, intermeditely resistnt, nd resistnt isoltes were 55.6, 31.5, nd 12.9%, respectively (Tble 1). All of the fully resistnt isoltes, except one, were from two loctions in the center nd southest of Gnsu. Physiologicl rce. Isoltes unble to produce sufficient zoospores for inocultion were excluded from physiologicl rce chrcteriztion (n = 175). In totl, 104 isoltes were successfully plced into five physiologicl rces (R1, R2, R3, R4, nd R5) using four cultivr differentils from AVRDC (Tble 2). Of these, 44 isoltes from 18 loctions were identified s R3, 26 isoltes from 12 loctions were identified s R2, 25 isoltes from 15 loctions were identified s R1, 8 isoltes from 6 loctions were identified s R5, nd single isolte ws identified s R4 (Tble 3). All rces were recovered from multiple yers except R4 (Tble 3). Rces 4 nd 5 were newly identified (3,27). Forty-two isoltes, representing ll five AVRDC rces, were tested on the NMRIL pnel. All eight of the NMRILs were resistnt to ll 42 isoltes, except single isolte tht ws ble to infect NMRIL-X (dt not shown). TABLE 1. Summry dt for mting type nd metlxyl resistnce for Phytophthor cpsici from Gnsu province Mting type Sensitivity to metlxyl Region Number of isoltes A1 A2 S IR R Northwest Centrl Southest Totl Metlxyl sensitivity: S = sensitive, IR = intermeditely resistnt, nd R = resistnt. 922 PHYTOPATHOLOGY

4 SSR diversity. A test of the eight previously reported SSR mrkers using isoltes from Gnsu reveled five polymorphic SSR loci (Pcp1, Pcp3, Pcp4, Pcp5, nd Pcp7) (30). In totl, 135 isoltes (out of the 279 collected) were ssessed for SSR genotype nd, of these, 127 hd mplifiction of ll five loci nd were retined for further nlyses. The number of lleles vried TABLE 2. Cultivr interctions nd rce ssignment for Phytophthor cpsici isoltes recovered from Gnsu using differentils from the World Vegetble Center Cultivr Rce Erly Clwonder PBC137 PBC602 P R1 S R R R R2 S S R R R3 S S S R R4 R R R R R5 S R S R S = susceptible nd R = resistnt phenotype. from 3 to 13 (verge of 8) per locus nd, in totl, 41 lleles were ssessed. In totl, the five loci resolved 59 unique multilocus genotypes (MLGs), with 42 MLGs present once nd the remining 85 isoltes distributed in 17 MLGs with 2 to 13 isoltes (Tble 4; Fig. 2). Of the 17 MLGs, 3 were restricted to single loctions (Tinshui nd Zhngye) nd 14 were recovered from 2 to 6 loctions (Tble 4). Twelve MLGs were recovered in different yers from seprte loctions nd MLG02, MLG10, MLG11, nd MLG13 were recovered over 5-yer time spn (2007 to 2011). In ddition, MLG10 ws recovered in 2007, 2010, nd 2011 from loctions within the sme villge in Zhngye (Tble 4). Genetic similrity nlysis grouped unique genotypes into three groups. Within these three groups, isoltes hd lmost exclusively the sme mting type (Fig. 3). All but three isoltes in group I were the A2 mting type. Isoltes in group II were the A1 mting type, except one isolte in MLG11 with the A2 mting type. Isoltes in group III were the A2 mting type, except one isolte in MLG10 with the A1 mting type. The het plots illustrte the degree of similrity between different genotypes (Fig. 3). TABLE 3. Sptiotemporl rce distribution of Phytophthor cpsici isoltes (n = 104) from Gnsu province Region Rce Northwest Centrl Southest Totl R R R R R Rces ssigned using pepper differentils from the World Vegetble Center (AVRDC). Yer TABLE 4. Summry dt for mting type, rce, metlxyl resistnce, nd region for Phytophthor cpsici isoltes hving identicl multilocus simple sequence repet (MLG) genotypes in Gnsu province Mting type Rce b Metlxyl resistnce c Region d MLG N Yer A1 A2 R1 R2 R3 R4 R5 S IR R NW C SE Number of isoltes. b Rce could not be ssigned to ll isoltes. Rce determined using cultivrs from the World Vegetble Center (AVRDC). c S = sensitive, IR = intermeditely sensitive, nd R = resistnt. d NW = northwest, C = centrl, nd SE = southest Gnsu province. Vol. 103, No. 9,

5 DISCUSSION Here, we present detiled chrcteriztion of P. cpsici on pepper in Gnsu province. The popultion structure proved to be complex nd it ppers tht extensive vrition occurs within the context of limited number of long-lived clonl lineges. Initilly, this ws not pprent becuse both mting types were recovered from cross the province, within the sme fields, nd even on the sme plnt, nd isoltes exhibited extensive genotypic vrition. Both mting types nd extensive genotypic vrition re Fig. 2. Number of Phytophthor cpsici isoltes within ech of 17 multilocus genotypes (MLGs) in Gnsu province, Chin. Fig. 3. Het mp nd dendrogrm illustrting genetic diversity of Phytophthor cpsici bsed on unique simple sequence repet genotypes recovered from Gnsu. Genotypes re lbeled with mting type, multilocus genotype (MLG) identifier with the number of isoltes in prentheses, geogrphicl region, nd yer of collection or MY if the genotype ws recovered from multiple yers. Isoltes with the sme genotype but different mting type re both listed. Similrity is scled from the lest (white) to the most (blck) relted. The three proposed clonl lineges re designted s I, II, nd III with genotypes designted s circles, dimonds, nd squres, respectively. NW = northwest, C = centrl, nd SE = southest. 924 PHYTOPATHOLOGY

6 the hllmrks of popultions where outcrossing nd sexul recombintion ply n importnt role. Nonetheless, the sptil nd temporl distribution of identicl genotypes nd the strong correltion between genetic similrity nd mting type indictes tht outcrossing is likely uncommon (Tble 4; Fig. 3). Identicl genotypes were recovered from diverse loctions over 5 yers, nd strictly defined clonl lineges (those with identicl genotypes) re widely distributed nd survive extended periods (Tble 4). Although there ws extensive genotypic vrition, this vrition ws structured lmost exclusively bsed on mting type (Fig. 3). In North Americn P. cpsici popultions, outcrossing is common nd importnt for survivl nd there is no correltion between mting type nd genetic similrity (6,11,22,23). The sitution in Gnsu is similr to popultions of P. cpsici in Peru nd Argentin, where long-lived widely dispersed clonl lineges dominte; however, in these countries, there is often only single mting type (12,17). Recent reserch indictes tht mting type my be poor chrcteristic for describing diversity in P. cpsici nd tht spontneous mting type chnges (prticulrly A2 to A1 chnges) cn occur nd my be ssocited with genetic phenomenon known s loss of heterozygosity (LOH) (24). Three of the five isoltes with mting types different from their group occurred within the context of identicl MLGs nd it is possible tht the underlying mechnism is LOH (Fig. 3). We hve since completed follow-up studies chrcterizing single zoospore-derived isoltes from subset of the field isoltes nd found tht some A2 isoltes cn produce zoospore progeny with A1, A2, nd A1/A2 (self-fertile) mting type profiles (dt not reported). Clerly, this is n re needing further investigtion. Pepper plnts re not present in the field yer-round in Gnsu nd it is not cler how the clonl lineges survive or spred. Chlmydospores were not observed in ny of the isoltes. Isoltes my move with infected plnt mterils, contminted wter, or the frequent exchnge of pepper seed. Pepper seed is n importnt product in Gnsu nd some reserchers suggest tht spred of pepper seed my be n importnt mens for P. cpsici dispersl (21,26,40). Host mteril is bsent from fields during the winter months nd seed possibly provides mechnism for survivl. The potentil role of seed in movement nd survivl needs further evlution. The survivl of clonl lineges cross severl yers my be due to the plnting strtegies in some loctions where pepper plnts re grown in the field during the summer nd in the greenhouse during the winter, potentilly providing ccess to host mteril yer round. At this point, the incidence of pepper blight during the winter seson in the greenhouse is unknown nd further investigtions re wrrnted. Of the 24 frms smpled, only 2 hd high proportion of metlxyl- or mefenoxm resistnt isoltes. This is not surprising becuse most frms re extensively mnged by frmers nd metlxyl- or mefenoxm-contining fungicides re generlly not used. The lrge pepper frms in Wuwei nd Tinshui with higher proportion of resistnt isoltes develop new cpsicum vrieties nd fungicides re pplied frequently. Becuse mny res hve sensitive isoltes, mefenoxm or metlxyl fungicides my be useful, lthough fungicide rottion using chemistries with different modes of ction should be used to slow the inevitble development of resistnce (29,31). Isoltes within the sme group nd identicl genotypes hd different physiologicl rces, suggesting tht different virulence phenotypes re evolving within clonl lineges. High virulence diversity in clonl lineges hd lso been reported in other Phytophthor spp., nd future studies on effector genes nd their dynmics, prticulrly in field scenrios, my be useful (10,14). All eight NMRILs were resistnt to diverse rry of isoltes of P. cpsici from Gnsu province. Although more work is needed, it ppers tht resistnce crried by the NMRILs my be useful for developing cultivrs useful for mnging P. cpsici in Gnsu. We re currently nlyzing the Gnsu isoltes nd lrger collection of P. cpsici from cross Chin using lrge pnel of single-nucleotide polymorphism mrkers distributed cross the P. cpsici genome. Although the work is still in progress, the trends for the isoltes from Gnsu re the sme (e.g., three geneticlly diverse clonl lineges re dominnt). Future work will focus on mesuring the frequency nd extent of mitotic vrition under differing cropping systems nd differing selection pressures (e.g., fungicides) nd identifying the genes or polymorphisms underlying functionl diversity. ACKNOWLEDGMENTS This work ws funded by the Ntionl Science Foundtion of Chin (number ) nd specil Fund for Agro-scientific Reserch in the Public Interest (numbers nd ). We thnk P. W. Boslnd for kindly supplying the NMRILs. LITERATURE CITED 1. Al-S di, A. M., Drenth, A., Dedmn, M. L., nd Aitken, E. A. B Genetic diversity, ggressiveness nd metlxyl sensitivity of Pythium phnidermtum popultions infecting cucumber in Omn. Plnt Pthol. 57: Bbdoost, M Phytophthor cpsici: A serious thret to vegetble industries in the world. (Abstr.) Phytopthology 98:S Blck, L. L Studies on Phytophthor blight in pepper. Pges in: AVRDC Report N. S. Tlekr, ed. Asin Vegetble Reserch nd Development Center, Shnhu, Chin. 4. Dehl, K. L., Demuth, S. P., Sinden, S. L., nd Riverpen, A Identifiction of mting types nd metlxyl resistnce in North-Americn popultions of Phytophthor infestns. Am. J. Potto Res. 72: Drenth, A., Wgels, G., Smith, B., Sendll, B., O Dwyer, C., Irvine, G., nd Irwin, J. A. G Development of DNA-bsed method for detection nd identifiction of Phytophthor species. Austrls. Plnt Pthol. 35: Dunn, A. R., Milgroom, M. G., Meitz, J. C., McLeod, A., Fry, W. E., McGrth, M. T., Dillrd, H. R., nd Smrt, C. D Popultion structure nd resistnce to mefenoxm of Phytophthor cpsici in New York Stte. Plnt Dis. 94: Erlnd, S., Henrion, B., Mrtin, F., Glover, L. A., nd Alexnder, I. J Identifiction of the ectomycorrhizl bsidiomycete Tylospor fibrillos Donk by RFLP nlysis of the PCR-mplified ITS nd IGS regions of ribosoml DNA. New Phytol. 126: Erwin, D. C., Brtnicki-Grci, S., nd Tso, P. H Phytophthor: its Biology, Txonomy, Ecology, nd Pthology. Americn Phytopthologicl Society, St. Pul, MN. 9. Erwin, D. C., nd Ribeiro, O. K Phytophthor Diseses Worldwide. Americn Phytopthologicl Society, St. Pul, MN. 10. Förster, H., Tyler, B. M., nd Coffey, M. D Phytophthor soje rces hve risen by clonl evolution nd by rre outcrosses. Mol. Plnt- Microbe Interct. 7: Goben, D., McGrth, M. T., nd Lmour, K. H Survivl nd spred of Phytophthor cpsici on Long Islnd, New York. Mycol. Prog. 11: Goben, D., Roig, J., Glmrini, C., Hulvey, J., nd Lmour, K Genetic diversity of Phytophthor cpsici isoltes from pepper nd pumpkin in Argentin. Mycologi 104: Goodwin, S. B., Sujkowski, L. S., nd Fry, W. E Widespred distribution nd probble origin of resistnce to metlxyl in clonl genotypes of Phytophthor infestns in the United Sttes nd western Cnd. Phytopthology 86: Guo, J., Vn Der Lee, T., Qu, D. Y., Yo, Y. Q., Gong, X. F., Ling, D. L., Xie, K. Y., Wng, X. W., nd Govers, F Phytophthor infestns isoltes from Northern Chin show high virulence diversity but low genotypic diversity. Plnt Biol. 11: Husbeck, M. K., nd Lmour, K. H Phytophthor cpsici on vegetble crops: Reserch progress nd mngement chllenges. Plnt Dis. 88: Hord, M. J., nd Ristino, J. B Effects of physicl nd chemicl fctors on the germintion of oospores of Phytophthor cpsici in vitro. Phytopthology 81: Hurtdo-Gonzles, O., Argon-Cbllero, L., Apz-Tpi, W., Donhoo, R., nd Lmour, K. H Survivl nd spred of Phytophthor cpsici in Costl Peru. Phytopthology 98: Judelson, H. S Sexul reproduction in oomycetes: Biology, diversity, nd contributions to fitness. Pges in: Oomycete Genetics Vol. 103, No. 9,

7 nd Genomics. John Wiley & Sons, Inc., New York. 19. Ko, W. H Hormonl heterothllism nd homothllism in Phytophthor. Annu. Rev. Phytopthol. 26: Lbuschgne, N., Thompson, A. H., nd Both, W. J First report of stem nd root rot of tomto cused by Phytophthor cpsici in South Afric. Plnt Dis. 87: Lmour, K. H Phytophthor cpsici: Sex, selection, nd the welth of vrition. Pges in: Oomycete Genetics nd Genomics. John Wiley & Sons, Inc., New York. 22. Lmour, K. H., nd Husbeck, M. K Mefenoxm insensitivity nd the sexul stge of Phytophthor cpsici in Michign cucurbit fields. Phytopthology 90: Lmour, K. H., nd Husbeck, M. K The dynmics of mefenoxm insensitivity in recombining popultion of Phytophthor cpsici chrcterized with mplified frgment length polymorphism mrkers. Phytopthology 91: Lmour, K. H., Mudge, J., Goben, D., Hurtdo-Gonzles, O. P., Schmutz, J., Kuo, A., Miller, N. A., Rice, B. J., Rffele, S., Cno, L. M., Bhrti, A. K., Donhoo, R. S., Finley, S., Huitem, E., Hulvey, J., Pltt, D., Slmov, A., Svidor, A., Shrm, R., Stm, R., Storey, D., Thines, M., Win, J., Hs, B. J., Dinwiddie, D. L., Jenkins, J., Knight, J. R., Affourtit, J. P., Hn, C. S., Chertkov, O., Lindquist, E. A., Detter, C., Grigoriev, I. V., Kmoun, S., nd Kingsmore, S. F Genome sequencing nd mpping revel loss of heterozygosity s mechnism for rpid dpttion in the vegetble pthogen Phytophthor cpsici. Mol. Plnt-Microbe Interct. 25: Lmour, K. H., Stm, R., Jupe, J., nd Huitem, E The oomycete brod-host-rnge pthogen Phytophthor cpsici. Mol. Plnt Pthol. 13: Leonin, L. H Stem nd fruit blight of peppers cused by Phytophthor cpsici sp. nov. Phytopthology 12: Li, Z. J., Long, W. P., Zheng, J. R., nd Lei, J. J Isoltion nd identifiction of Phytophthor cpsici in Gungdong province nd mesurement of their pthogenicity nd physiologicl rce differentition. Front. Agric. Chin 1: Liu, Y. G., Zhng, H. Y., Guo, J. G., nd Lu, H. P Study on the resistnce of Phytophthor cpsici isoltes to metlxyl in Gnsu. Gnsu Agric. Sci. Technol. 7: Lu, X. H., Husbeck, M. K., Liu, X. L., nd Ho, J. J Wild type sensitivity nd muttion nlysis for resistnce risk to fluopicolide in Phytophthor cpsici. Plnt Dis. 95: Meitz, J. C., Linde, C. C., Thompson, A., Lngenhoven, S., nd McLeod, A Phytophthor cpsici on vegetble hosts in South Afric: Distribution, host rnge nd genetic diversity. Austrls. Plnt Pthol. 39: Meng, Q. X., Cui, X. L., Bi, Y., Wng, Q., Ho, J. J., nd Liu, X. L Biologicl nd genetic chrcteriztion of Phytophthor cpsici mutnts resistnt to flumorph. Plnt Pthol. 60: Prr, G., nd Ristino, J. B Resistnce to mefenoxm nd metlxyl mong field isoltes of Phytophthor cpsici cusing Phytophthor blight of bell pepper. Plnt Dis. 85: Qi, R. D., Ding, J. C., Go, Z. M., Ni, C. G., Jing, J. J., nd Li, P Resistnce of Phytophthor cpsici isoltes to metlxyl in Anhui province. Act Phytopthol. Sin. 35: Ristino, J. B Intrspecific vrition mong isoltes of Phytophthor cpsici from pepper nd cucurbit fields in North-Crolin. Phytopthology 80: Ristino, J. B., Mdritch, M., Trout, C. L., nd Prr, G PCR mplifiction of ribosoml DNA for species identifiction in the plnt pthogen genus Phytophthor. Appl. Environ. Microbiol. 64: Silvr, C., Merino, F., nd Diz, J Diversity of Phytophthor cpsici in northwest Spin: nlysis of virulence, metlxyl response, nd moleculr chrcteriztion. Plnt Dis. 90: Sun, W. X., Ji, Y. J., O Neill, N. R., Feng, B. Z., nd Zhng, X. G Genetic diversity in Phytophthor cpsici from estern Chin. Cn. J. Plnt Pthol. 30: Sy, O., Steiner, R., nd Boslnd, P. W Recombinnt inbred line differentil identifies rce-specific resistnce to Phytophthor root rot in Cpsicum nnuum. Phytopthology 98: Tin, D., nd Bbdoost, M Host rnge of Phytophthor cpsici from pumpkin nd pthogenicity of isoltes. Plnt Dis. 88: Weber, G. F Blight of peppers in Florid cused by Phytophthor cpsici. Phytopthology 22: Yng, M. Y., Co, J. F., Li, X. D., Sun, D. W., Wng, Y. C., nd Zho, Z. J Moleculr dignosis nd chrcteriztion of blight disese pthogen on pepper in Yunnn. Act Phytopthol. Sin. 39: Zhng, H. Y., Liu, Y. G., Lu, H. P., Guo, J. G., nd Song, S. Y Mting types nd distribution of cusl orgnism of pepper in Gnsu province. Act Agric. Bor-Occid. Sin. 35: Zhou, Q. M., Li, L. Y., nd Yng, S. H Investigtion of Phytophthor blight. Chin Veg. 01: PHYTOPATHOLOGY