Progress report (Jan June, 2007)
|
|
- Geoffrey Norton
- 5 years ago
- Views:
Transcription
1 Progress report (Jan June, 2007) Capacity Building Project Implementation of the Cartagena Protocols on Biosafety Project Title: Strengthening of bio-safety Laboratory: Development and validation of sensitive molecular methods for testing of genetically modified seeds and detection of un-intended introduction of GMO in environment Dr Anil Kumar PROFESSOR & HEAD & PRINCIPAL INVESTIGATOR Department of Molecular Biology & Genetic Engineering College of Basic Sciences and Humanities G.B.Pant University of Agriculture & Technology Pantnagar
2 Objectives To provide testing facilities for genetically modified seeds of agricultural produces. To generate molecular probes against defined target (promoters, reporters, selectable markers and desired. transgenes and proteins in GM seeds) for testing and monitoring GM seeds released deliberately or accidentally. To develop statistical models for risk evaluation and management. To develop suitable methodology in the form of kits for diagnostic and testing analysis of GM produces in the field. To impart manpower training that may assist in enforcing biosafety regulations.
3 Milestones defined and achieved 1. Recruitment of manpower 2. Training of staff 3. Procurement of equipments 4. Upgrading laboratories and facilities 5. Development and validation of diagnostics tools for LMO seed (Model is Bt cotton) Acquisition of GM seeds Standardization of DNA isolation from seeds Design of primers and probe Standardization of protein isolation from seeds Standardization of diagnostic techniques
4 6. Development and validation of diagnostics tools for novel trait osmotin (Model is Brassica) Standardization of DNA isolation from seeds Design of primers and probes 7. Identification of critical points in seed processing
5 Molecular detection of GM crops Development and validation of diagnostics tools for GM seeds DNA based analysis Protein based analysis Immunological based analysis
6 Standardization of DNA extraction and isolation from Bt cotton seeds M A B C D E F M S.No Methods Yield (? g/g seed) Time taken (h) M- Marker A- DNA isolated from ½ of seed by Benito et al., 1992 (Modified) which gave maximum yield B- DNA isolated from ½ of seed by SDS (Modified) C- DNA isolated from ½ of seed by Heewankang et al, 1998 D- DNA isolated from ¼ of seed by Benito et al., 1992 (Modified) E- DNA isolated from ¼ of seed by SDS (Modified) F- DNA isolated from ¼ of seed by Heewankang et al, ) 2) 3) Benito et.al 1992 (Modified) SDS (Modified) Heewankang et.al Following modifications were made In the method of Benito et. al 1992 Starting material - ½ and ¼ of seed In situ crushing with glass rod in Eppendorf tube Use of 33% more extraction buffer and 5 M potassium acetate than the original method
7 Development and validation of diagnostics tools for novel trait osmotin (Model is Brassica) Standardization of DNA isolation from mustard seeds S.No. 1. Methods SDS OD OD Ratio 260/ Conc. Of DNA (µg/(µl) Yield (µg/g seed) M A B 2. Benito et al, { M-marker, A- Benito et al, 1992, 3. Heewanka ng et al, 1998 Nil Nil Nil Nil Nil B- SDS, Heewankan et al, 1998}
8 M M kb 1.0 kb Different stages of hardening of annexin transformed Brassica plants. PCR detection of Annexin introgression in Brassica plants
9 Standardization of PCR for detection of GM cotton Design of primers: For detection of GM crops especially Bt cotton, four strategies were adopted for designing suitable primer sets 1. Primer sets which were already available for amplification of of cry genes in other transgenic crops, 2. Primer sets designed from conserved sequences of several bacterial cry gene variants and cry genes introgressed in transgenic plants especially cry 1Ab, cry 1Ac and cry 9c, 3. Primer sets for sequences of t-dna inserted in to plant genome like Ca MV 35 S promoter, npt II selectable marker and nos terminator, 4. Primer sets designed from conserved sequences of cry genes introgressed in Bt cotton developed by Maharashtra Hybrid Seed Company (Mahyco), JK Seeds, ICAR and China seeds.
10 Primer sets designed from conserved sequences of several bacterial cry genes variants and cry genes introgressed in transgenic plants especially cry 1Ab, cry 1Ac and cry 9c The data base was searched with the nucleotide sequences of cry genes as queries using the database search and analysis service on the worldwide ( me.ad.jpl). The program used was Basic local Alignment SEARCH Tool (Multialin)
11 Results of PCR PCR was performed for amplification of cry gene(s) of Bt cotton seed using sets of primer designed in previous slide but it failed to give amplification.
12 Cry-Bt identifier: A database is made for Researchers & Students with a very simple user interface. Users may enter Home Page Home Page
13 IMPLICATIONS OF Cry-Bt IDENTIFIERS DATABASE Development of a user friendly tool that would assist researchers in detection of crygenes in transgenic crops. Helps researchers and students to access information related to crygenes and easy access to updated database input. Designed based on relational database that interacts with sources of information, gene sequences from database, literature information, facilitating in-silico analysis. The developed database enables primer designing associated with Cry-Bt gene identification, sequence comparison and domain analysis.
14 Online Linkage with Cry-Bt Identifier Database
15 Primer sets designed from conserved sequences of cry genes introgressed in Bt cotton developed by Maharashtra Hybrid Seed Company (Mahyco), JK Seeds, ICAR and China seeds. CODE SEQUENCES 5-3 GC Value (%) Tm Value (?c) KG 1 TATCAGATCTCCACACTTGATGGAC GTGAGGTGGCTGTGGCCGGCAC KG 2 AGTGTTTGGACAGAGGTGGG GGCACATTGTTGTTCTGTGG KG 3 GACACAGTTTCTGCTCAGCG GATCACACCTGCAGTTCCAC PCR amplification of cry gene Optimization of PCR conditions using above mentioned primer for detection of Cry gene is in the progress.
16
17 Protein based analysis of Bt cotton BT Cotton Non BT Cotton
18 Standardization of protein isolation from cotton seeds Extraction of proteins from Bt and non-bt cotton seeds using five different buffer systems and quantification by Bradford s method. The isolated protein was used for immunodetection of Bt protein using microtitre ELISA and Lateral flow Immunodiffusion tests.
19 Extraction of Bt protein from cotton seed by using five different extraction buffer systems (buffer system 2. showed max extractability (112 mg/g) S. No. Type of seeds Type of Buffer ph Weight of seed Protein concentration µg/µl Yield mg/g of seed A. Bt Extraction buffer g Non Bt Extraction buffer g B. Bt Extraction buffer g Non Bt Extraction buffer g C. Bt Extraction buffer g Non Bt Extraction buffer g D. Bt Extraction buffer g Non Bt Extraction buffer g E. Bt Extraction buffer g Non Bt Extraction buffer g
20 Detection of cry protein by SDS-PAGE M T1 N1 T2 NT2 T3 NT3 M T1 NT1 T2 NT2 T3 NT3 CBBR-250 staining Silver nitrate staining {M-Marker, T1- Buffer 2 (Bt Cotton seed), NT1-Buffer 2 (Non Bt Cotton seed), T2- Buffer 3 (Bt Cotton seed), NT2-Buffer 3 (Non Bt Cotton seed), T3- Buffer 4 (Bt Cotton seed) and NT3-Buffer 4 (Non Bt Cotton seed), The cry protein was not detected by SDS- PAGE either followed by the staining either with CBBR-250 or Silver nitrate
21 Immunological based analysis Standardization of Diagnostic techniques Immunodipstick test for detection of Bt protein in transgenic cotton Trial study for transgene detection in Bt cotton has been initiated. -Standardization of Bt-express Kit (Innovative BioSciences) and Desigen Bt Xpress strips (Mahyco) for detectipn of cryi Ac & cryi Ab -Standardization of Bt-quant Kit (Innovative BioSciences) for detection & quantification of cryi Ac & cryi Ab
22 Sensitivity of Bt express kit in seeds mixed with non transgenic seeds ( transgenic : non-transgenic) Control Bt protein Threshold level of detection of Bt protein 1%
23 Effect of extractability of Bt protein using different buffer system EB 1 EB - 2 EB - 3 EB 4 EB 5
24 Comparison of Results of Lateral Flow Immuno-diffusion Tests Threshold detection 1:100 BT Express Kit take min for the detection of Cry Protein (cry1ac/cry1ab) Non-Bt Bt Non-Bt Bt DesiGen take min for detection of cry 1Ac protein BT Express Kit (Cry 1AC/ Cry 1AB) DesiGen-Kit (Cry 1Ac)
25 PANTNAGAR BIOSAFETY One of the four centers established in India under the World Bank-GEF project for implemention of Cartagena protocol on biosafety by Ministry of Environment & Forest (Govt. of India) CENTER NBPGR DELHI NRCPB DELHI GBPUAT PANTNAGAR National level facilty for strengthening of institutional capacity building Institutional Biosafety Committee is also in place at Pantnagar for scientific evaluation of R & D proposals on development and field testing (commercialization) of transgenic crops CFTRI MYSORE GEF-WORLD BANK CAPACITY BUILDING PROJECT ON BIOSAFETY
26 CASE STUDIES Investigation of the presence of Bt transgene in a cotton variety (SR-8) developed by private seed company (Surya Seeds) Detection of Bt protein using lateral flow immunodiffusion test Development of intense colored appeared ion dipstick indicated the presence of Bt transgene in the variety of cotton seeds provided by company. This indicate that such variety claimed to be a variant through natural selection and hence this variety must go through the procedure of release of transgenic varieties as per the norms developed by federal regulatory bodies such as DBT and MOEF for commercialization and cultivation. Thus, it is mandatory that all the normal and hybrid varieties developed by different seed companies have to undergone the testing of presence of transgene introgressed in agricultural crops. The responsibility of Biosafety Centre has now tremendously increased with the following objectives: 1. To assess and prioritise options for the identification of the possible transgene(s) in the seeds. 2. To develop testing protocols to rapidly identify the transgene in seed lots. 3. To identify the genetic purity, likely extent of GM seeds in non-gm commercial crops. 4. To detect the deliberate and un-intentional release of transgenic crops in the environment.
27 Illegal, spurious and fake seeds Thus, on an average 28% of the illegal seed brands are non-bt, only 26% are F-1, rest of 46% are only 10-75% positive for Bt, indicating possible F2 seed and mixtures. Fake cartons of the legal seeds are increasing. Illegal BesT packets Original Fake
28 Amazing (spurious!!) sense of humour ORIGINAL FAKE
29 Organization of two national training workshops on biosafety AIMS OF TRAINING WERE To create awareness about the Bio-safety issues related to use of transgenic crop plants. To acquaint the scientific personnel with the current scientific knowledge about development, detection and production technologies for transgenic crops. To provide on-hand laboratory training about molecular testing methods of transgenic plants. To address the issues pertaining to Environmental concerns biosafety of transgenic foods and public attitude
30 FIRST TRAINING REPORT Biosafety issues in the management of genetically Modified crops (3 rd to 9 th July 2006) The training included 15 lectures covering various aforesaid aspects of transgenic plants, delivered by various experts from BRCPB, ICGEB, NBPGR etc. as well as from our University. Besides it participants were also exposed to a capsule of 14 laboratory exercises of molecular testing methods 24 participants from 7 states of country Chief Guest of Inaugural function: Dr. P.L. Gautam, Vice-chancellor Guest of Honour: Dr. Ch. Samar Pal Singh, Progressive Farmer Chief Guest of Valedictory function: Dr. G.K.Garg, Advisor (Biotechnology)
31 SECOND TRAINING REPORT Biosafety measures for monitoring of deliberate and unintended release of transgenic crops (Feb. 2007) The training included 15 lectures covering various aforesaid aspects of transgenic plants, delivered by various experts from BRCPB, ICGEB, NBPGR etc. as well as from our University. Besides it participants were also exposed to a capsule of 14 laboratory exercises of molecular testing methods 25 participants from 9 states of country Chief Guest of Inaugural function: Dr L.M.S. Palni, Scientific Advisor (Biotechnology) Govt. of Uttranchal Chief Guest of Valedictory function: Dr Manoranjan Hota, Additional Director, Ministry of Environ. & Forests, (Govt. of India) New Delhi
32 Zonal wise distribution of participants First training Second training
33 RESEARCH PUBLICATIONS Mahender Singh, Dinesh Yadav, Dinesh Panday & Anil Kumar (2006) Detection strategies for Non-Antibiotic, Non- Herbicide marker Phosphate Mannose Isomerase (PMI) in second generation transgenic crops International Conference on the Implications of the Cartagena Protocol on Biosafety, Nov organized by Project Coordination and Monitoring Unit ( PCMU), Ministry of Environment & Forests, Govt. of India in association with BCIL & ITDC, New Delhi. Kaushal Gautam, Mahender Singh, Dinesh Yadav & Anil Kumar (2006) Comparative analysis of endogenously developed Bt lateral immuno diffusion strip test for identification of Bt gene transfer in BT cotton International Conference on the Implications of the Cartagena Protocol on Biosafety, Nov organized by Project Coordination and Monitoring Unit ( PCMU), Ministry of Environment & Forests, Govt. of India in association with BCIL & ITDC, New Delhi. Anil Kumar Kaushal Gautam, Mahender Singh and G. K Garg Molecular methods for treating of genetically modified seeds: validation and determination of threshold level of transgene detection proceedings in Biosafety issues and challenges edited by D.D. Verma and Manoranjan Hota, MOEF, New Delhi, pp Vinay Kumar Singh, Soma Marla, Sonu Ambwani and Anil Kumar Development and uses of biological database of cry genes present in Bacillus thuriengiensis (Cry-Bt identifiers) for designing suitable primers for detection of Bt transgenic International Conference on the Implications of the Cartagena Protocol on Biosafety, Nov organized by Project Coordination and Monitoring Unit ( PCMU), Ministry of Environment & Forests, Govt. of India in association with BCIL & ITDC, New Delhi. Cry Data base developed by biosafety center and Bioinformatic center Manual on Critical control points in the GM seed production Two book chapters in edited book by NBPGR, New Delhi Course curriculum on Biosafety has been prepared
34 Course Curriculum on Bio-safety Issues for the Management of Genetically Modified Plants Developed by Bio-safety Center, Department of Molecular Biology and Genetic Engineering G.B. Pant University of Agriculture and Technology Pantnagar Uttranchal In association with Ministry of Environment and Forests (Govt. of India) New Delhi
35 BIOSAFETY MEASURES FOR MONITORING OF DELIBERATE AND UNINTENDED RELEASE OF TRANSGENIC CROPS A TRAINING MANUAL BIOSAFETY CENTRE DEPARTMENT OF MOLECULAR BIOLOGY & GENETIC ENGINEERING COLLEGE OF BASIC SCIENCES & HUMANITIES G. B. PANT UNIVERSITY OF AG. & TECH. PANTNAGAR, UTTARANCHAL,
36 Pantnagar Biosafety Centre released three books on Biosafety and Biotechnology
37 What to do next? Capillary electrophoresis for detection of Bt protein Detection of threshold value, seed to seed variations of cry gene using Real Time PCR Cry Protein detection using western blotting. PCR Amplification of mannose isomerase gene from E. Coli for cloning and expression, subsequently development of immunoprobe for transgene detection based on non-antibiotic/non-herbicide markers
38