Quantification of HIV-1 DNA using Real-Time Recombinase Polymerase Amplification

Transcription

1 Supporting Information Quantification of HIV-1 DNA using Real-Time Recombinase Polymerase Amplification AUTHORS: Zachary Austin Crannell 1*, Brittany Rohrman 1*, Rebecca Richards-Kortum 1 *These authors contributed equally 1 Rice University 6500 Main Street Houston, TX S1

2 Supporting Information Table of Contents: I. Table S1. Primer and Probe Sequences II. III. IV. Figure S1. Generation of Internal Positive Control (IPC) Sequences C. parvum DNA Extraction Protocol Real-time qrpa with varying concentrations of background DNA S2

3 I. Table S1. Primer and Probe Sequences As described in the article, the qrpa assay utilizes a previously published RPA forward primer, RPA reverse primer, and HIV-1 probe. Like the HIV-1 probe, the IPC probe was designed according to the manufacturer s recommendations for TwistAmp exo probes. Specifically TwistAmp exo probes consist of a nucleotide sequence complementary to the target. The probe contains an internal abasic site replacing one of the nucleotides with the abasic site flanked by a fluorophore and a quencher. During amplification, an exonuclease cleaves the abasic site separating the fluorophore and the quencher, allowing detectable fluorescence. As recommended by TwistDx, the IPC amplicon was designed to be longer than the HIV-1 amplicon (435 bp and 141 bp, respectively) in order to prevent the generation of IPC amplicons from outcompeting the generation of the HIV-1 amplicons. However, only one fluorophore is generated for each amplicon. Therefore, the amplification rate (number ofamplicons generated per unit time) can be measured and compared by monitoring the fluorescence in real-time. Description Name Sequence RPA forward primer POLF5 5 -TGGCAGTATTCATTCACAATTTTAAAAGAAAAGG -3 RPA reverse primer POLR3 5 -CCCGAAAATTTTGAATTTTTGTAATTTGTTTTTG -3 HIV-1 probe HEXPOL 5 - TGCTATTATGTCTACTATTCTTTCCCC[SIMA/HEX]GC[THF]C[dT- BHQ1]GTACCCCCCAATCCCC -3 IPC probe FAM-PC 5 -AGGTAGTGACAAGAAATAACAATACAGGAC[FAM]T[THF]T[dT- BHQ1]GGTTTTGTAATTGGAA -3 PCR forward primer 5 -TGGCAGTATTCATTCACAATTTTAAAAGAAAAGG/ATCTAAGGAAGGCAGCAGGC-3 PCR reverse primer 5 -CCCGAAAATTTTGAATTTTTGTAATTTGTTTTTG/TGCTGGAGTATTCAAGGCATA-3 II. Figure S1. Generation of Internal Positive Control (IPC) Sequences S3

4 Figure S1. Generation of IPC sequences. PCR was performed on DNA extracted from 10 5 (+) or 10 6 (++) C. parvum oocysts/ml, and water served as a negative control (-). Different primer pairs were used to generate two IPC sequences (IPC1 and IPC2) and a PCR control. Agarose gel electrophoresis confirmed the generation of the expected 413 bp and 435 bp products. Two New England BioLabs DNA markers are shown for comparison: M1 (100bp DNA ladder) and M2 (low molecular weight DNA ladder). As preliminary qrpa experiments demonstrated that amplification was more consistent for IPC2 than for IPC1, IPC2 served as the positive control sequence for the qrpa assay. III. C. parvum DNA Extraction Protocol Briefly, DNA was extracted from C. parvum oocysts using a modified lysis protocol along with the QiaAMP DNA Mini Kit (Qiagen, Valencia, USA). Two hundred microliters of oocysts suspended in PBS at a concentration of 10 6 oocysts/ml were mixed with 1 ml of NucliSENS Lysis Buffer (BioMerieux, Boston, USA) in a Percellys Soil Mix Bead Tube (SK38, Cayman Chemicals, Ann Arbor, USA). The C. parvum, lysis buffer, and beads were vortexed continuously for 5 min and then incubated at room temperature for 15 min. The tube was then centrifuged at full speed for 2 min. Two hundred microliters of the supernatant were then added to a clean microcentrifuge tube containing 25 µl proteinase K (Qiagen, Valencia, USA) and 200 µl buffer AL (Qiagen, S4

5 Valencia, USA). The samples were then vortexed for 15 sec and incubated on a heat block at 56 C for 15 min. After incubation, 200 µl of molecular biology grade ethanol was added, the tube was vortexed 15 sec, and the total volume was added to a Qiagen QiaAMP DNA spin column. The DNA was bound to the column via centrifugation at 1.6 x 10 4 RCF for 1 min. The DNA was washed according to the manufacturer s instructions with the supplied buffers. Finally, the DNA was eluted in 200 µl AE buffer (Qiagen, Valencia, USA). IV. Real-time qrpa with varying concentrations of background DNA An experiment was performed to determine whether variations in the amount of background DNA in qrpa reactions influence the predicted concentration of target DNA. To simulate the varying background DNA concentrations that may be found in clinical samples, we performed an experiment in which we used the HIV-1 plasmid with background DNA at concentrations at or exceeding those typically found in clinical plasma samples used for viral load testing (10, 20, 40, and 80 ng human genomic DNA per reaction). 1 As shown in Figure S2, the predicted concentration of target DNA remains nearly constant regardless of the concentration of background DNA. Figure S2: Predicted versus true concentration for varying amounts of background DNA. Each marker represents the average of two duplicates for samples containing the same amount of S5

6 background DNA. The range of predicted concentrations is indicated by error bars for each pair of duplicates. S6

7 References (1) Umetani, N.; Hiramatsu, S.; Hoon, D. S. B. Ann. N. Y. Acad. Sci. 2006, 1075, S7