Hematopoietic Stem Cell Protocols

Transcription

1 M E T H O D S I N M O L E C U L A R M E D I C I N E TM Hematopoietic Stem Cell Protocols Edited by Christopher A. Klug Craig T. Jordan Humana Press

2 AGM and Yolk Sac HSC 1 1 Isolation and Analysis of Hematopoietic Stem Cells from Mouse Embryos Elaine Dzierzak and Marella de Bruijn 1. Introduction Recently, there has been much interest in the embryonic origins of the adult hematopoietic system in mammals (1). The controversy surrounding the potency and function of hematopoietic cells produced by the yolk sac compared to those produced by the intrabody portion of the mouse embryo has prompted much new research in the field of developmental hematopoiesis (2 8). While the yolk sac is the first tissue in the mammalian conceptus to visibly exhibit hematopoietic cells, the intrabody region which at different stages of development includes the splanchnopleural mesoderm, para-aortic splanchnopleura (PAS) and the aorta-gonad-mesonephros (AGM) region clearly contains more potent undifferentiated hematopoietic progenitors and stem cells before the yolk sac. Furthermore, the most interesting dichotomy revealed by these studies is that terminally differentiated hematopoietic cells can be produced in the mouse embryo before the appearance of cells with adult repopulating capacity. Thus, the accepted view of the adult hematopoietic hierarchy with the hematopoietic stem cell (HSC) at its foundation does not reflect the hematopoietic hierarchy in the developing mouse embryo (9). Because this field offers many questions concerning the types of hematopoietic cells present in the embryo, the lineage relationships between these cells, and the molecular programs necessary for the development of the embryonic and adult hematopoietic systems, this section presents the approaches taken and the materials and methods necessary to explore the mouse embryo for the presence of the first adult repopulating HSCs. From: Methods in Molecular Medicine, vol. 63: Hematopoietic Stem Cell Protocols Edited by: C. A. Klug and C. T. Jordan Humana Press Inc., Totowa, NJ 1

3 2 Dzierzak and de Bruijn 2. Materials 2.1. Isolation and Dissection of Embryonic Tissues 1. Dissection needles: sharpened tungsten wire of mm diameter (Agar Scientific Ltd.) attached to metal holders typically used for bacterial culture inoculation. 2. Dissection microscope: any suitable dissection microscope with magnification range from 7 40 with a black background stage and cold light source. 3. Culture plates: mm plastic tissue culture dishes. 4. Medium: phosphate-buffered saline (PBS) with 10% fetal calf serum (FCS), penicillin (100 U/mL) and streptomycin (100 µg/ml) Organ Explant Culture 1. Millipore 0.65 µm DV Durapore membrane filters: Before use, filters are washed and sterilized in several changes of boiling tissue-culture water (Sigma, cat. #W- 3500) and dried in a tissue-culture hood. 2. Stainless-steel mesh supports: Supports were custom-made in our workshop by bending a 22 mm 12 mm rectangular piece of stainless-steel wire mesh so that it stands 5 mm high with a 12 mm 12 mm supportive platform. Supports are washed in nitric acid (HNO 3) for 2 24 h, then rinsed five times in sterile milliq water. Subsequently, they are sterilized in 70% ethanol and rinsed two times in tissue-culture water (Sigma). Then, the supports are dried in a tissue-culture hood Well tissue culture plates. 4. Curved fine point forceps. 5. Medium: Myeloid long-term culture (LTC) media (M5300, StemCell Technologies). Supplemented with hydrocortisone succinate (Sigma), 10 5 M final concentration. 6. Scalpel blade Preparation of a Single-Cell Suspension from Dissected Embryonic Tissues 1. Collagenase Type I (Sigma): Make a 2.5% stock solution in PBS and freeze aliquots at 20 o C. For use, make a 1:20 dilution of stock collagenase in PBS-10% FCS-Pen-Strep. One ml of 0.12% collagenase will disperse approx 10 embryonic tissues when incubated at 37 o C for 1 h PREPARATION AND STAINING OF SINGLE-CELL SUSPENSION 1. Propidium iodide (Sigma). 2. Heat-inactivated FCS. 3. Hematopoietic-specific antibodies, available from sources such as Pharmingen.

4 AGM and Yolk Sac HSC Colony-Forming Unit-Spleen (CFU-S) Assay 1. Tellyesniczky s solution: for 100 ml, mix 90 ml of 70% ethanol, 5 ml of glacial acetic acid, and 5 ml of 37% formaldehyde (100% formalin) PERIPHERAL BLOOD DNA PREPARATION AND PCR ANALYSIS 1. Blood Mix: 0.05 M Tris-HCl ph 7.8, 0.1 M EDTA, 0.1 M NaCl, 1% SDS, 0.3 mg/ ml Proteinase K. 2. RNase A: 10 mg/ml stock solution. 3. Phenol-Chloroform-Isoamyl alcohol M sodium acetate (ph 5.6). 5. Isopropanol % ethanol. 7. LacZ PCR primers: lacz1 5 GCGACTTCCAGTTCAACATC3' lacz2 5 GATGAGTTTGGACAAACCAC3' 8. YMT2 PCR primers: ymt1 5 CTGGAGCTCTACAGTGATGA3' ymt2 5 CAGTTACCAATCAACACATCAC3' 9. Myogenin PCR primers: myo1 5 TTACGTCCATCGTGGACAGC3' myo2 5 TGGGCTGGGTGTTAGTCTTA3' 10. Deoxynucleotide 5' triphosphate (dntp) mix: stock solution of 10 mm each of deoxyadenosine 5' triphosphate (datp), deoxythymidine 5' triphosphate (dttp), deoxyguanosine 5' triphosphate (dgtp), deoxycytidine 5' triphosphate (dctp). 11. PCR (10X) mix: 100 mm Tris-HCl, ph 9.0, 15 mm MgCl 2, 500 mm KCl, 1% Triton-X-100, 0.1% w/v stabilizer. 12. Taq polymerase MULTILINEAGE ANALYSIS 1. Complete medium: RPMI-1640, 5% FCS, 2 mm L-glutamine, 10 mm HEPES, 100 U/mL penicillin, 100 µg/ml streptomycin, and 100 µm 2-mercaptoethanol. 2. Lipopolysaccharide (Sigma). 3. Murine interleukin 2 (IL-2)(Biosource) 4. Concanavalin A (Sigma). 5. L-cell conditioned medium. 6. Lineage-specific antibodies are routinely used (available from sources such as Pharmingen). 3. Methods 3.1. Isolation and Dissection of Embryonic Tissues 1. To obtain embryonic tissues for the analysis of HSCs and progenitors, adult male mice are mated with two females in the late afternoon. Females are checked for the presence of a vaginal plug the following morning. If a plug is found, this is considered embryonic d 0 (E0) (see Note 1).

5 4 Dzierzak and de Bruijn Fig. 1. Schematic diagram of the dissection procedure on an E10/E11 mouse embryo. Dark broken lines show the regions in which a series of cuts are performed on the mouse embryo. (A) The yolk sac (YS) is removed by cutting the vitelline artery (VA) and umbilical artery (UA) the site where they join the yolk sac. A second cut adjacent to the embryo body frees the arteries. (B) The dissection needles cut the head and tail regions from the trunk of the embryo which contains the AGM and liver (L). (C) The internal organs (gastrointestinal tract, heart, and liver) are dissected away first, and then the dorsal tissues (the neural tube and somites) are removed. (D) After turning the remaining trunkal region of the embryo so that the ventral side is facing upwards, the dissection needles are inserted under the AGM region, and the remaining somitic tissue is dissected away. 2. Pregnant females at the chosen day of gestation are sacrificed, and uteri removed into a mm tissue-culture dish containing PBS-FCS (PBS with 10% FCS, penicillin 100 U/mL and streptomycin 100 µg/ml). 3. Using a dissection microscope ( 7 8 magnification) and fine forceps or scissors, remove the muscular wall of uterus from the individual decidua. Then with small grasps of the forceps, remove Reichert s membrane, which is the thin tissue layer surrounding the yolk sac (13). During these manipulations, the embryos are transferred to other culture dishes containing PBS-FCS to wash away maternal blood contamination.