Supporting Information. A Target-Triggered DNAzyme Motor Enabling Homogeneous, Amplified Detection of Proteins

Transcription

1 Supporting Information A Target-Triggered DNAzyme Motor Enabling Homogeneous, Amplified Detection of Proteins Junbo Chen,, Albert Zuehlke, Bin Deng, Hanyong Peng, Xiandeng Hou,, and Hongquan Zhang*, Analytical & Testing Center, Sichuan University, 29 Wangjiang Road, Chengdu, Sichuan , China. Division of Analytical and Environmental Toxicology, Department of Laboratory Medicine and Pathology, Faculty of Medicine and Dentistry, University of Alberta, Edmonton, Alberta, T6G 2G3, Canada. College of Chemistry, Sichuan University, 29 Wangjiang Road, Chengdu, Sichuan , China. Corresponding Author * hongquan@ualberta.ca S1

2 Table of Contents Table S1 Sequences used to construct 8-17E DNAzyme motors. Table S2 Sequences of different DNAzymes and substrates used to construct DNAzyme motors. Table S3 Limits of detection of homogeneous assays for thrombin detection. Figure S1 (a) Sequence of the original 8-17E DNAzyme 22 and its substrate. (b) Sequence of the truncated version of the 8-17E DNAzyme and substrate. Figure S2 (a) Main components of a molecular motor constructed with DNAzyme and gold nanoparticle (AuNP) tracks. (b) Operation of the target-triggered DNAzyme motor. Figure S3 Examination of operation of the DNAzyme motor by using gel electrophoresis. Figure S4 Dependence of the DNAzyme motor on different divalent metal ions. Figure S5 Effect of Mg 2+ concentration on the signal output of the DNAzyme motor. Figure S6 The response of five DNAzyme motors to 250 pm streptavidin. Figure S7 Verifying that the moving of the DNAzyme motor remains on the AuNP track on which the motor is anchored by target binding. Figure S8 UV-Visible absorption spectra of motor solutions containing varying concentrations of streptavidin. Figure S9 Comparison of operations of the DNAzyme motor that was incubated with AuNP track and streptavidin using two different methods. Figure S10 The real-time response of the DNAzyme motor to 200 pm streptavidin. Figure S11 (a) A linear relationship between the rate of substrate cleavage and streptavidin concentration. b) A linear relationship between streptavidin concentration and fluorescence intensity at 30 and 60 min of the DNAzyme operation. Figure S12 Operation of the DNAzyme motors constructed by using 8-17E, Mg5, 8-17, and DNAzymes, respectively. Figure S13 A linear relationship between the rate of the substrate cleavage and thrombin concentration. Figure S14 (a) The response of the DNAzyme motor to varying concentrations of thrombin in 5% serum. b) A linear relationship between the rate of substrate cleavage and thrombin concentration. Figure S15 The operation of the DNAzyme motor in response to 250 pm thrombin (a) and 200 pm streptavidin (b) in 50% serum. Figure S16 The DNA sequence and its secondary structure used to estimate T m of the binding-induced hybrid between the DNAzyme and its substrate. S2

3 Table S1. Sequences used to construct 8-17E DNAzyme motors Oligonucleotides Sequences (5 3 ) Substrate for all motors Spacing Oligo on AuNP HS-(T) 14 CACTATrAGGAAGAGAT-6-Carboxyfluorescein (6-FAM) S2 HS-TTTTTTTTTT Motor triggered by streptavidin DNAzyme-1 Biotin-(T) 45 GTCATCTCTTCTCCGAGCCGGTCGAAATAGTG DNAzyme-2 Biotin-(T) 45 GTCATCTCTTCTCCGAGCCGGTCGAAATAGT DNAzyme-3 DNAzyme-4 DNAzyme-5 Biotin-(T) 46 GTCTCTTCTCCGAGCCGGTCGAAATAGT Arm2 Catalytic core Arm1 Biotin-(T) 46 GTCTCTTCTCCGAGCCGGTCGAAATAG Biotin-(T) 46 GTCTCTTCTCCGAGCCGGTCGAAATA L2 HS-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-Biotin Motor triggered by thrombin binding to aptamers 15-mer aptamer (L1) GGTTGGTGTGGTTGG(T) 46 GTCTCTTCTCCGAGCCGGTCGAAATAGT linked to DNAzyme 15-mer aptamer Biotin-TTTTTAGT CCG TGG TAG GGC AGG TTG GGG TGA CT 29-mer aptamer (L2) 29-mer aptamer S3

4 Table S2. Sequences of different DNAzymes and substrates used to construct DNAzyme motors Oligonucleotides Sequences (5 3 ) Substrate for 8-17E, 8-17, and Mg5 HS-(T) 14 CACTATrAGGAAGAGAT-6-Carboxyfluorescein (6-FAM) DNAzymes Substrate for DNAzyme HS-(T) 14 TAGTTA rgru GAAGAGAT-6-FAM 8-17E DNAzyme 8-17 DNAzyme Mg5 DNAzyme DNAzyme Biotin-(T) 46 GTCTCTTCTCCGAGCCGGTCGAAATAGT Arm2 Catalytic core Arm1 Biotin-(T) 46 G TCTCTT CTCCGAGCCGGACGAATAGT Arm2 Catalytic core Arm1 Biotin-(T) 46 TCTCTTCTGTCAGCGACACGAAATAGT Arm2 Catalytic core Arm1 Biotin-(T) 46 TCTCTTCAGGCTAGCTACAACGATAACT Arm2 Catalytic core Arm1 S4

5 Table S3. Limits of detection of homogeneous assays for thrombin detection Format of assays Detection Amplification LOD (pm) Refs Molecular beacon-based assays Catalytic beaconbased assays Protein enzymeassisted assays Nanomaterialassisted assays DNA assemblymediated assays Fluorescence Non-amplified Fluorescence Non-amplified Fluorescence Non-amplified Calorimetry Amplified 1 4 Luminescence Amplified Calorimetry Amplified Fluorescence Exonuclease III assisted amplification Fluorescence Nicking enzyme 8 -assisted amplification 40 Calorimetry Nicking enzyme assisted amplification Fluorescence Exonuclease III assisted amplification Fluorescence Exonuclease I assisted amplification Fluorescence Graphene oxide Non-amplified Fluorescence Graphene oxide Non-amplified Luminescence Gold nanoparticle Non-amplified Absorbance Fe 3 O 4 magnetic nanoparticles Nonamplified Fluorescence Graphene oxide-agncs Non-amplified Fluorescence Carbon nanotube Non-amplified Fluorescence Nano-C Non-amplified 1000 Fluorescence Rolling circle replication amplification Fluorescence Non-amplified Fluorescence Non-amplified assays This work DNAzyme motor Fluorescence DNAzyme-assisted amplification S5

6 Figure S1. (a) Sequence of the original 8-17E DNAzyme 22 and its substrate. (b) Sequence of the truncated version of the 8-17E DNAzyme 1 and substrate. The arm 1 was shortened from 9 n.t. to 5 n.t., and the arm 2 was shortened from 9 n.t. to 7 n.t. The truncated version (b) of the DNAzyme was used to build the motor. S6

7 Figure S2a. Main components of a molecular motor constructed with DNAzyme and gold nanoparticle (AuNP) tracks. The DNAzyme motor system comprises two main components: a DNAzyme coupled with an affinity ligand L1 via a flexible spacer S1 and an AuNP decorated with the second affinity ligand L2 and the substrate for the DNAzyme. The AuNP serves as a scaffold to construct three-dimensional tracks of hundreds of substrate molecules. Onto each AuNP were conjugated hundreds of DNA-RNA chimeric substrates and tens of an affinity ligand L2. To enhance the accessibility of the substrate to the DNAzyme, the substrate was designed to have a 14-thymine spacer S2 at the 5'-end that was attached to the AuNP. A 6-carboxyfluorescein (FAM) molecule was labeled at the 3'-end of the substrate. The fluorescence of FAM was quenched by the AuNP. The arm 1 and arm 2 of DNAzyme were designed to have only 5 and 7 bases, so that their hybridization to the substrate sequence (T m < 7 C) is not stable at room temperature. In the absence of a target molecule, the two components remain separate and the motor is off. S7

8 Figure S2b. Operation of the target-triggered DNAzyme motor. Binding of a target molecule (e.g., a specific protein) activates the molecular motor, resulting in stepwise movement of the DNAzyme on the three-dimensional AuNP tracks and the corresponding cleavage of the substrate molecules. The binding of L1 and L2 to the same target molecule brings the DNAzyme onto the AuNP track, dramatically increasing the local effective concentrations of DNAzyme and substrate. Thus, the stability of hybrid between the substrate and the two short arms is dramatically enhanced, leading to hybridization between the DNAzyme and one substrate molecule on AuNP. In the presence of cofactor Mg 2+, the DNAzyme is activated to cleave the substrate at the single-ribonucleotide junction, generating two oligonucleotide fragments F1 and F2. F1 then dissociates from arm 2 and is released from the AuNP surface, restoring fluorescence. The DNAzyme is also liberated from F2 because the hybrid between arm 1 and F2 becomes unstable. The DNAzyme is therefore available for hybridization with another substrate on AuNP, accomplishing the movement of DNAzyme from one to the next substrate. The overall length of the loop after the protein-triggered hybridization of DNAzyme and the substrate can be estimated by counting the number of nucleotides in the loop. The total number of nucleotides in the loop includes 46 bases (S1), 15 bases (S2), and 30 bases (poly T used to conjugate biotin to AuNP). Even without including the size of target molecule and the two ligands, the loop (91 bases) is ~30 nm in length, larger than the AuNP diameter of 20 nm. S8

9 Figure S3. Examination of operation of the DNAzyme motor by using gel electrophoresis. In gel images a and b, no band corresponding to the substrate fragment F1 was observed, suggesting that the DNAzyme motor is inactive in the absence of either target (a) or cofactor Mg 2+ (b). In the presence of cofactor Mg 2+ and different concentrations of streptavidin (STV), the motor is activated to cleave substrate strands, releasing fragment F1 from AuNPs (images c-f). The intensity of F1 band increases over the operation time, suggesting that the operation of the motor is autonomous and processive. Higher concentration of streptavidin resulted in stronger F1 bands, suggesting that more motors were activated in response to more target molecules. S9

10 To use gel electrophoresis to examine the operation of the DNAyzme motor, the DNAzyme motor system at a concentration equivalent to 6.7 nm AuNP track was mixed with 0, 1, 2, 4, 10 nm streptavidin in 25 mm Tris-acetate buffer (ph 8.3), containing 200 mm NaCl and 0.01% BSA. After incubation at room temperature for 10 min, 10 mm Mg 2+ was added. At time points 5, 15, 20, 30, 40 and 60 min, 5 μl of the operation solution was sampled repeatedly, to which 5 μl of 50 mm EDTA was added to chelate the cofactor Mg 2+ and thus stop operation of the motor. The sampled solutions were then loaded onto a 14% polyacrylamide gel for separation. Electrophoresis was carried out at 80 V for 100 min. The FAM-containing substrate strand (Sub) and its fragment F1 were used to serve as DNA markers. The fragment F1 was obtained by hydrolysis of the single ribonucleotide bond of the substrate strand using 2 M NaOH. S10

11 Figure S4. Dependence of the DNAzyme motor on different divalent metal ions. a) The response of the motor to 250 pm streptavidin in the presence of different divalent metal ions. b) Multiple turnover rate constants of the DNAzyme motor in the presence of different metal ions. The concentrations of metal ions are 10 mm for Mg 2+, Ca 2+, Ba 2+, Zn 2+, and 200 µm for Pb 2+. S11

12 Figure S5. Effect of Mg 2+ concentration on the signal output of the DNAzyme motor. a) The response of the motor to 250 pm streptavidin in the presence of 5 20 mm Mg 2+. b) Multiple turnover rate constants of the DNAzyme motor in the presence of 5 20 mm Mg 2+. S12

13 Figure S6 The response of five DNAzyme motors to 250 pm streptavidin. The sequences of five DNAzymes are listed in Table S1. The arm 1 and arm 2 of DNAzyme are crucial for minimizing target-independent DNAzyme cleavage and securing protein-triggered DNAzyme activity and fast turnover rate. We designed five DNAzymes with different arm lengths (Table S1) and studied the performances of the motors built from these DNAzymes. To compare these DNAzymes, we determined their background fluorescence resulting from target-independent DNAzyme cleavage and multipleturnover rate constants displayed in target-activated motors. The DNAzymes were designed to have asymmetric arm lengths. The background levels are mainly impacted by the length of arm 2 (Figure 2d) because arm 2 is longer than arm 1. DNAzymes 1 and 2, possessing an arm 2 of 8 bases, result in similar background levels although their arm 1 contains 6 and 5 bases, respectively. By shortening arm 2 from 8 to 7 bases, the background is effectively reduced. The length of arm 1 is of great importance for the cleavage rate of the DNAzyme because hybridization between arm 1 and substrate remains as an intramolecular association after cleavage (Table 1, Figure S5). DNAzymes 2 and 3, having an arm 1 of 5 bases, show similar rate constants higher than that of DNAzyme 1 of which the arm 1 contains 6 bases. The shorter arm 1 facilitates the dissociation of DNAzyme from the cleaved substrate, thereby enhancing turnover rate. However, further shortening arm 1 from 5 bases to 4 and 3 bases largely decreases the rate constant of DNAzymes, which suggests that arm 1 at 4 and 3 bases is too short to ensure efficient association with the substrate even though the hybrid between arm 2 and the substrate has been formed. S13

14 Figure S7 Verifying that the moving of the DNAzyme motor remains on the AuNP track on which the motor is anchored by target binding. a) Schemes showing difference of two operations. b) Fluorescence curves of two operations. The AuNP track I contains substrate strands each labeled with a FAM molecule and biotinlabeled oligonucleotides for streptavidin binding, whereas the AuNP track II contains only substrate strands each labeled with a ROX molecule. Solutions of operation 1 contain 0.23 nm AuNP track I, 2 nm biotin-labeled DNAzyme, and 0.2 nm streptavidin; solutions of operation 2 contain 0.23 nm AuNP track I, 0.23 nm AuNP track II, 2 nm biotin-labeled DNAzyme, and 0.2 nm streptavidin. Fluorescence of FAM (520 nm) and ROX (590 nm) was monitored for operation 2. If cleavage of substrates across different AuNP tracks takes place, ROX fluorescence increase would be observed. Little ROX fluorescence increase suggests that there is little cleavage of substrates across AuNP tracks. Similar FAM fluorescence increase for two operations further supports that the presence of track II does not affect the moving of the motor on track I and the moving of the motor localizes within individual AuNP tracks. S14

15 Figure S8. UV-Visible absorption spectra of motor solutions containing varying concentrations of streptavidin. Solutions were prepared to contain all components required for the motor except Mg 2+. They all contained 0.23 nm AuNP track, 2 nm DNAzyme motor, and 200 mm NaCl; but 0, 25, 60, or 100 pm streptavidin in 25 mm Tris-acetate buffer (ph 8.3). These four solutions were each incubated at room temperature for 2 h prior to analysis. In the absence of Mg 2+, the DNAzyme motor is off, and the UV-Vis analysis is not affected by fluorescence. UV-Vis spectra of these four solutions showed no difference, suggesting that there is no AuNP aggregation under the operating conditions of the DNAzyme motor. The absence of AuNP aggregation is attributed to two main reasons: (1) high negative charge density and steric hindrance resulting from high substrate density on AuNP surface and (2) the presence of 2 nm biotin-labeled DNAzyme motor in the solution. High density of oligonucleotide creates high negative charge density on AuNP surface and steric hindrance. Although the binding of the streptavidin to the first AuNP track is fast because DNA-conjugated AuNPs are favorable to protein binding, further binding of the second AuNP is difficult because of strong negative charge repulsion and steric hindrance. In contrast, the biotin-labeled DNAzyme motor has less charge repulsion and steric hindrance. The DNAzyme motor can bind to the streptavidin molecule easier and faster than the second AuNP, which then further inhibits AuNP aggregation. S15

16 Figure S9. Comparison of operations of the DNAzyme motor that was incubated with AuNP track and streptavidin using two different methods. We used two different methods to prepare operation solutions to test whether the optimized concentrations of AuNP track and biotin-labeled motor can obviate occupying of four binding sites of an individual streptavidin molecule by four biotins from the AuNP track or four biotins from the biotin-labeled DNAzyme. The solution of operation 1 was prepared with procedures that were also used to prepare all other operation solutions nm AuNP track was first mixed with 2 nm biotin-labeled DNAzyme, followed by addition of 0.2 nm streptavidin. For the solution of operation 2, 200 pm streptavidin was first incubated with 0.2 nm biotin-labeled DNAzyme to form a streptavidin-biotinylated DNAzyme complex at a 1:1 stoichiometry. The 0.2 nm such complex was further mixed with 0.23 nm AuNP track. Therefore, the procedures for preparing the solution of operation 2 obviate occupying of four binding sites of an individual streptavidin molecule by four biotins from the AuNP track or four biotins from the biotin-labeled DNAzyme. The fluorescence increase of operation 1 is slightly higher than that of operation 2, suggesting that the optimized concentrations of AuNP track and biotin-labeled motor obviate the sensitivity decrease due to occupying of four binding sites of an individual streptavidin molecule by four biotins from the AuNP track or four biotins from the biotin-labeled DNAzyme. The slightly higher fluorescence increase of operation 1 is probably because some streptavidin molecules might anchor more than one biotinylated DNAzyme strands onto the AuNP track. S16

17 Figure S10. The real-time response of the DNAyzme motor to 200 pm streptavidin. The amount of AuNP track (230 pm) was in excess over that of streptavidin (200 pm), to allow only a single streptavidin molecule available for binding to an AuNP track. After 10 h, the motor has moved 178 steps, resulting in the cleavage of ~77% of the total substrates on a single AuNP. S17

18 Figure S11. a) A linear relationship between the rate of substrate cleavage and streptavidin concentration. The cleavage rates were calculated by using fluorescence data obtained during the first hour of the DNAzyme operation. b) A linear relationship between streptavidin concentration and fluorescence intensity at 30 and 60 min of the DNAzyme operation. S18

19 Figure S12. Operation of the DNAzyme motors constructed by using 8-17E, Mg5, 8-17, and DNAzymes, respectively. The sequences of DNAzymes and substrates are listed in Table S2. To minimize the impact of arm sequences on the performance of the DNAzyme motors, similar sequences were used for arms 1 and 2 of these four DNAzyme motors. To test the operation of the DNAzyme motors, operating solutions contained 0.23 nm AuNP track, 2 nm DNAzyme motor, 200 mm NaCl, 10 mm Mg 2+, and 200 pm streptavidin in 25 mm Tris-acetate buffer (ph 8.3). S19

20 Figure S13. A linear relationship between the rate of the substrate cleavage and thrombin concentration. The cleavage rates were calculated by using fluorescence data obtained during the first 30 min of operation of the DNAzyme motor responsive to thrombin. During the initial operating period, the fluorescence intensity increases linearly with time. S20

21 Figure S14. a) The response of the DNAzyme motor to varying concentrations of thrombin in 5% serum. b) A linear relationship between the rate of substrate cleavage and thrombin concentration. The cleavage rates were calculated by using fluorescence data obtained during the first 30 min of operation of the DNAzyme motor responsive to thrombin. During the initial operating period, the fluorescence intensity increases linearly with time. S21

22 Figure S15. The operation of the DNAzyme motor in response to 250 pm thrombin (a) and 200 pm streptavidin (b) in 50% serum. To test if the DNAzyme motor could operate in high percent serum, a thrombin sample was prepared by adding 250 pm thrombin into 50% serum and operation of the DNAzyme motor in response to this sample was then monitored. No fluorescence increase was observed over the operation time, suggesting the activity of the DNAzyme motor was inhibited by 50% serum. Instead, the sample solution showed high fluorescence background, which resulted from intrinsic fluorescence of serum matrix because the solution containing only 50% serum generated similar fluorescence intensity. To test if this inhibition could be due to effect of serum matrix on the binding of thrombin to aptamers, two changes were made. First, the DNAzyme motor system responding to streptavidin was used to test the operation of the motor in 50% serum because of extraordinary binding affinity of streptavidin to biotin and high stability of streptavidin biotin complex. Second, before addition of 50% serum, streptavidin molecules were incubated with AuNPs and DNAzyme motors to ensure the attachment of DNAzyme motors to the surface of AuNPs through the streptavidin-biotin interaction. Similarly, no fluorescence increase was observed, suggesting that serum matrix inhibits operation of the DNAzyme motor through interference of hybridization of DNAzyme to its substrate. S22

23 Figure S16. The DNA sequence and its secondary structure used to estimate T m of the bindinginduced hybrid between the DNAzyme and its substrate. S23

24 References (1) Wang, W. J.; Chen, C. L.; Qian M. X.; Zhao, X. S. Anal. Biochem. 2008, 373, (2) Li, J.J.; Fang X.; Tan, W. Biochem. Biophys. Res. Commun. 2002, 229, (3) Nutiu, R. Li, Y.F.; J. Am. Chem. Soc. 2003, 125, (4) Zhang, Y. F.; Li, B.X.; Jin, Y. Analyst 2011, 136, (5) Liu, X. Q.; Freeman, R.; Golub, E.; Willner, I. ACS Nano 2011, 5, (6) Li, T.; Wang, E. K.; Dong, S. J. Chem. Commun. 2008, 31, (7) Zou, P.; Liu, Y. L.; Wang, H. Y.; Wu, J.; Zhu, F. F.; Wu, H. Biosens. & Bioelectron. 2016, 79, (8) Xue, L. Y.; Zhou, X. M.; Xing, D. Chem. Commun., 2010, 46, (9) Li, J.; Fu, H. E.; Wu, L. J.; Zheng, A. X.; Chen, G. N.; Yang, H. H. Anal. Chem. 2012, 84, (10) Liu, X. Q.; Freeman, R.; Willner, I. Chem.-Eur. J. 2012, 8, (11) Zheng, D. M.; Zou, R. X.; Lou, X. H. Anal. Chem. 2012, 84, (12) Chang, H. X.; Tang, L. H.; Wang, Y.; Jiang, J. H.; Li, J. H. Anal. Chem. 2010, 82, (13) Sui, N.; Wang, L. N.; Xie, F. X.; Liu, F. Y.; Xiao, H. L.; Liu, M. H.; Yu, W. W. Microchim. Acta. 2016, 183, (14) Chen, L. Y.; Bao, Y. G.; Denstedt, J.; Zhang, J. Biosens. & Bioelectron. 2015, 77, (15) Hu, P.; Han, L.; Zhu, C. Z.; Dong, S. J. Chem. Commun. 2013, 17, (16) Feng, J. J.; Zhuo, C. X.; Ma, X. J.; Li, S. Q.; Zhang, Y. D. Analyst 2016, 14, (17) Yang, R. H.; Tang, Z. W.; Yan, J. L.; Kang, H. Z.; Kim, Y. M.; Zhu, Z.; Tan, W. H. Anal. Chem. 2008, 80, (18) Li, H. L.; Zhang, Y. W.; Luo, Y. L.; Sun, X. P. Small 2011, 7, (19) Di Giusto, D.A.; Wlassoff, W.A.; Gooding, J.J.; Messerle, B.A.; King, G.C. Nucleic Acids Res. 2005, e64. (20) Heyduk, E. T. Anal. Chem. 2005, 77, (21) Li, J. J.; Zhong, X. Q.; Zhang, H. Q.; Le, X.C.; Zhu, J. J.; Anal. Chem. 2012, 84, S24