Monitoraggio molecolare della malattia minima residua nelle leucemie acute pediatriche: standards o ricerca? Giovanni Cazzaniga

Transcription

1 Monitoraggio molecolare della malattia minima residua nelle leucemie acute pediatriche: standards o ricerca? Giovanni Cazzaniga Centro Ricerca Tettamanti Clinica Pediatrica Università Milano-Bicocca Fondazione Monza e Brianza per il Bambino e la sua Mamma c/o Ospedale San Gerardo Monza

2 Childhood ALL: The Treatment Dilemma p-survival (%) Status at the end of the 1990's p-morbidity (severe) (%) p-mortality (treatment reltaed) (%) Treatment intensity (number of drugs combined, dose intensity)

3 The questions: How to identify those children (25%) who ultimately relapse with disease that is highly refractory to current therapy. How to identify those children (25%, or more?) who are likely over-treated and may well be cured using less intensive regimens resulting in fewer toxicities and long term side effects.

4 MRD as surrogate marker to assess heterogeneity in response to treatment

5 MRD detection in Acute Lymphoblastic Leukemia: Fusion transcripts resulting from chromosomal translocations Immunoglobulin (Ig) and T cell Receptor (TcR) gene rearrangements Multiparametric Flow cytometry

6 Variability of the V(D)J region of Ig/TcR gene rearrangements as patient and clone-specific target for MRD detection Ig H VH 5 ' DH JH 3 ' Impossibile visualizzare l'immagine. La memoria del computer potrebbe essere insufficiente per aprire l'immagine oppure l'immagine potrebbe essere danneggiata. Riavviare il computer e aprire di nuovo il file. Se viene visualizzata di nuovo la x rossa, potrebbe essere necessario eliminare l'immagine e inserirla di nuovo. Junctional ( N ) regions VH primer DH primer JH primer Patient Marker Junction Junctional sequence Sensitivity AC15 Vd2-Dd3-20 / 9 /-13 TGAAGGGTCTT TCGGGCCCC CACAGTGCTAC 4 AN40 Vd2-Dd3-5 /14 / 0 TGAAGGGTCTTACTACTGTGCCTGTG CACCTGACGTACTT ACTGGGGGATACGCACAGTGCTAC 4 AX21 Vd2-Dd3-1 / 2 / 0 TGAAGGGTCTTACTACTGTGCCTGTGACAC GA ACTGGGGGATACGCACAGTGCTAC 4 AA34 Vd2-Dd3-3 /14 / 0 TGAAGGGTCTTACTACTGTGCCTGTGAC CTTTCACCCTTTTT ACTGGGGGATACGCACAGTGCTAC 5

7 P mrd_upd2.kam 02JAN I-BFM-SG ALL-MRD-Study: Update Outcome by MRD detection levels at w5 (tp 1) and w12 (tp 2) p: 1-2:.0003; 1-3:.0001; 2-3:.0001 Low risk group Intermediate risk group Basis for risk stratification in trial ALL-BFM 2000 High risk group years MRD at tp. 1+2 neg.: 0.98, SE=.02 (N= 55, 1 event) MRD pos but < 10-3 at tp. 2: 0.76, SE=.06 (N= 55, 14 events) MRD at tp. 1+2 >=10-3 : 0.16, SE=.08 (N= 19, 16 events)

8 MRD detection by monitoring Ig/TcR rerrangements Forward junctional primer Germline fluorescent probe R Q Reverse primer V N J undil PB

9 Advanced RQ-PCR MRD detection in childhood ALL in the AIEOP-BFM 2000 study Germline TaqMan probes; Design of specific primers for each patient specific target; Sensitivity testing of all the primers/probe combinations; Sensitivity testing by modifying annealing temperature; MRD detection experiment; Parallel albumin analysis on each sample; Final data calculation (normalization).

10 Flow diagram of diagnostic management Padova (centralized) If material is insufficient: phone call for repuncture Genetics and AIEOP Center MRD result for final risk group assignment DNA of diagnosis DNA of follow up time points Immunophenotyping Cytomorphology (diagnosis) Evaluation of response (d8) Preparation of DNA (d0, d33, w12) Banking of Cells and DNA MRD of local patients Monza Molecular genetics: Translocations (RNA) MRD: Identification of MRD targets Testing of specifity and sensitivity MRD quantification of follow up time points Interpretation of results

11 Definition of MRD in AIEOP-BFM ALL 2000 SR: MRD negative on day 33 (post-induction,tp1), and at day 78 (before "Prot. M" = TP2), if measured with at least 2 markers with a sensitivity of at least MR: no "SR-MRD" or "HR-MRD" criteria are met. HR: MRD at time point 2 (d 78) is positive at 10-3.

12 Clinical impact of MRD It strongly depends on the therapeutic time point assessed: Early time points the applicability of MRD could be higher as much as earlier is the prognostic time point. Late time points the persistence of residual blasts beyond 4 to 6 months or the re-emergence of residual disease, even at the level of 1x10-4, predicts clinical relapse. However, the clinical usefulness of late MRD determination is limited.

13 MRD Timepoints 1a AIEOP - BFM ALL 2000: Study questions in all risk groups (3) (4) (5) 1 1b 2 30/7/2000 MRD as surrogate marker for early intervention? SR : no HR criteria MRD neg. at tps. 1+2 SR - 1 R1 SR - 2 III II 12 Gy* only T-ALL R I A -D + I A -P + I B HR: PRED-PR t(9;22) t(4;11) NR d33 M HR: MRD level at tp. 2 >=10-3 HR - 1 H R 3' MR: no HR criteria no SR-criteria H R 2' H R 1' MR - 1 R2 MR - 2 III II 12 Gy* only T-ALL 12Gy* 10 weeks interim maintenance with 6-MP / MTX III 6-MP/MTX III III III 4 Wks. 6-MP/MTX 4 Wks. R3 HR - 2 H R 1' H R 2' H R 3' AIEO P BFM H R 1' II H R 2' 18Gy* H R 3' II II 12Gy* 0 BM sampling G-CSF I A -D: Protocol I, Phase A with DEXA I A -P: Protocol I, Phase A with PRED B M T # 29 * presymptomatic cranial irradiation (18[24] Gy for CNS pos. pts only) # selected indications for allo-bmt (in all strata of HR) SR: 2 molecular marker with a sensitivity of =<10-4 available (obligatory) W.

14 Final risk group assignment in AIEOP-BFM ALL 2000 with and without MRD results (n=4239) MRD classification feasible n = 3265 (77%) MRD-SR n = 1287 (40%) MRD-MR n = 1708 (51%) MRD-HR n = 270 (8%) Final clinical risk groups (all eligible pts = 4239) n=1495 n=1241 n=46 n=213 n=270 SR: n = 1241 MR: n = HR: n = % 55% 16% n = 843 n = 131 MRD classification not feasible n = 974 (23%)

15 AIEOP-BFM patients Probability Overall outcome results by final and MRD-only risk groups SURVIVAL EFS yrs Prob. 89.4%(0.7) 79.4%(1.1) 311 deaths 524 events YEARS FROM DIAGNOSIS AIEOP-BFM 2000 AIEOP-BFM 2000 by final risk 4239 patients by MRD 3265 patients EFS EFS 1.0 CORS/H annover - Apr SR 2000 MR 2000 HR N. pts N. events yrs EFS 91.4%(1.5) 78.8%(1.6) 59.5%(3.2) 3 4 SR MR HR 0.2 N. pts N. events yrs EFS 91.5%(1.5) 75.7%(2.3) 36.8%(6.6) YEARS FROM DIAGNOSIS YEARS FROM DIAGNOSIS CORS/H annover - Apr CORS/H annover - Apr 2 006

16 MRD risk groups of ALL-AIEOP BFM 2000 in comparison to risk groups according to ALL-BFM 95 criteria (eligible patients classifiable by MRD) ALL-BFM 95 risk criteria SR MR HR All SR 40% 55% 5% 1031 (100%) MRD risk criteria MR 29% 55% 16% 1306 (100%) HR 9% 29% 61% 215 (100%) All 32% 53% 15% 2552 Definition of risk groups in ALL-BFM 95: SR: PRED-GR; WBC <20,000, and age 2-5y MR: PRED-GR; WBC >= 20,000, or age <1y, or >= 6y HR: PRED-PR, or induction failure, or Ph+ ALL

17 AIEOP-BFM criteria: Standard Risk - by MRD 1092 patients MRD results according to non-mrd based AIEOP-BFM 95 criteria EFS SR MR HR N. pts N. events yrs EFS 94.1%(1.8) 83.6%(2.6) 30.4%(15) YEARS FROM DIAGNOSIS AIEOP-BFM criteria: Medium Risk - by MRD 1803 patients AIEOP-BFM criteria: High Risk - by MRD 370 patients EFS EFS SR MR HR N. pts N. events yrs EFS 89.7%(2.1) 70.4%(3.9) 45.3%(11.4) 0.2 SR MR HR N. pts N. events yrs EFS 94.9%(3.5) 78.1%(4) 39.3%(5) YEARS FROM DIAGNOSIS YEARS FROM DIAGNOSIS CORS/Hannover - Apr 2006 CORS/Hannover - Apr 2006

18 AIEOP-BFM 2000 T lineage - by MRD 387 patients EFS SR MR HR N. pts N. events yrs EFS 96.5%(2.5) 84.7%(2.7) 40.3%(6.8) YEARS FROM DIAGNOSIS CORS/Hannover - Apr 2 006

19 MRD results in genetically defined subgroups dsmc0405.tab 18MAY05 P AIEOP + ALL-BFM 2000, EFS MRD Risk Groups, BCR/ABL pos Log-Rank p =.016 Pts enrolled Sep/Jul 00 Oct 04 (Status April 05) years 4 MRD-SR 1.0, SE=.00 (N= 6, no event) MRD-MR.50, SE=.15 (N=16, 6 events) MRD-HR.23, SE=.12 (N=18, 11 events) EFS SR MR HR AIEOP-BFM 2000 TEL/AML pos - by MRD 673 patients N. pts N. events yrs EFS 93.5%(1.9) 67.5%(8.2) 58.3%(18.6) YEARS FROM DIAGNOSIS CORS/Hannover - Apr 2006

20 Summary of MRD results in childhood ALL The long term EFS results of the retrospective MRD study confirmed the prognostic value of MRD monitoring at two early time points. The cooperative AIEOP-BFM ALL2000 protocol was the first large multicentric trial using early MRD monitoring as a major prognostic factor for risk stratification in childhood ALL. feasibility of early MRD monitoring in a large proportion of patients (~80%) MRD confirmed its high prognostic value in all the biological subgroups of patients. Definition of a large SR group with excellent outcome

21 How to integrate MRD in the design of the new childhood ALL treatment protocol?

22 AIEOP-BFM ALL 2009 New PCR-MRD Risk Criteria PCR-MRD-SR MRD negative at TP 1 and TP 2 with at least one, preferably more than one marker with a sensitivity of at least 10-4 PCR-MRD-MR MRD positive at TP 1 and/or TP 2 and MRD at TP 2 <10-3 with at least one marker PCR-MRD-MR SER MRD >10-3 at TP 1 and still positive at TP 2 PCR-MRD-HR MRD >10-3 at TP 2

23 AIEOP + ALL-BFM 2000 EFS (6 years) BCP-ALL, non-hr Patient enrollment AIEOP: 09/00 07/06 BFM: 07/00 06/06 (Status June 08) aieop_bfm.tab 30APR09 P SER, slow early responers Log-Rank p = < TP1 LOW+, TP2 NEG 0.83, SE=0.03 (N=305, 38 events) years TP1 LOW+, TP2 POS 0.79, SE=0.05 (N= 97, 16 events) TP1 HIGH+, TP2 NEG 0.73, SE=0.05 (N=106, 28 events) TP1 HIGH+, TP2 POS 0.40, SE=0.07 (N= 89, 40 events)

24 Role of FCM-MRD d15 for the stratification in AIEOP-BFM ) >10% à HR 2) Stratification of patients who are not stratifiable by PCR-MRD (and without classical HR criteria): <0,1% à SR >0,1% and <10% à MR -> Stratification in >95% of patients

25 How to integrate MRD in the design of the new ALL treatment protocol? MRD detection, currently the best available individual risk assessment method, was available for stratification in almost all patients (combined use of PCR and FCM) R1: Treatment reduction for low-risk pts but controlled by MRD R2: Targeted and monitored intensification for all pts with intermediate relapse risk R3: Early targeted and monitored intensification in high risk pts

26 AIEOP-BFM ALL 2009 T/non- HR IA D IB M II pcrt 12 Gy if age > 2 yrs* / in selected subgroups no CRT + 6x IT MTX Immunology unknown or pb- ALL + TEL/AML1 neg + FCM- MRD d15 >0.1% IA SR II pb # /non- HR TEL/AML1 pos and/or FCM- MRD d15 <0.1% IA R 1 IA NRd33 only FCM d15 >10% IB M MRD- MR SER MRD- HR only MR R 2 II II HR T- ALL pb- ALL # IA CPM IA R HR IB IB + HR 1 HR 2 pcrt 12 Gy if age > 2 yrs* / in selected subgroups no CRT + 6x IT MTX HR 3 III III III SCT DNX- FLA + SCT w IA Prot. IA with 4 DNR doses (day 8, 15, 22 and 29) IA Prot. IA with 2 DNR doses (day 8 and 15) # or immunophenotype unknown * in pasents with CNS disease (CNS 3) tcrt with 12 Gy/18 Gy (dose age- adapted)) PEG- L- ASP 2500 IU/m 2 every 2 weeks, over 20 weeks in total PEG- L- ASP 4 x 2500 IU/m 2 over 4 weeks

27 AIEOP-BFM ALL 2009: MRD-controlled treatment intensification in MRD-HR TP2: >10-3 before 3.HR (w18): pos neg Administration of 3 rd HR-block real-time MRD-Monitoring after 3.HR (w20): w21: >10-3 DNX-FLA SCT immediately or additional element: - MRD response > 1 log: 2 nd DNX-FLA - no MRD response: other elements to be considered, e.g. FLAMSA, VP16/AMSA <10-4 Administration of 1 st Prot.III >10-3 <10-4 (if bridging till SCT is needed) SCT

28 Monitoraggio molecolare della malattia minima residua nelle leucemie acute pediatriche: standards o ricerca?

29 Prerequisites of a reliable technique to detect MRD a. Sensitivity of at least 10-4, although it depends on the clinical question; b. Specificity, to prevent false-positive results c. being quantifiable within a large dynamic range; d. stability over-time of leukaemia-specific markers, to prevent falsenegative results, particularly in long-term studies; e. reproducibility between laboratories (essential for multicenter trials); f. careful standardization and quality control checks; g. rapid availability of results (in time for clinical usefulness)

30 Problems and pitfalls of MRD-PCR detection via Ig/TCR genes 1. Time consuming, labor intensive and expensive Target identification, selection and testing: 3-4 weeks RQ-PCR analysis of follow-up samples:1-2 weeks 2. Extensive knowledge and experience needed: Structure of Ig/TCR genes and rearrangement processes Ig/TCR gene rearrangement patterns in ALL (precursor-b- ALL T-ALL; children adults) 3. International comparability of MRD-PCR results Between MRD-PCR centers of same treatment protocol Between treatment protocols Standardization, guidelines and quality control

31 European Study Group on MRD detection in ALL (ex ESG-MRD-ALL) 48 laboratories in 19 countries

32 (EHA working group) EuroClonality (BIOMED-2) EuroMRD ALL, infant ALL and NHL EuroFlow Since 1996 Since 2001 Since 2006 Participants: based on experience and participation in (inter)national clinical trails Aims: - Innovation and standardization of laboratory diagnostics - Quality control - Continuous education

33 European Study Group on MRD detection in ALL (EuroMRD) AIMS of ESG-MRD-ALL (initial focus on PCR analysis of Ig/TCR genes): 1. Quality Control Program: 2 times per year: - February / March - August / September 2. Educational meetings, including evaluation of quality control rounds: 2 times per year: - April / May - October / November 3. Standardization of MRD techniques - standardization techniques within each treatment protocol - guidelines for interpretation of RQ-PCR results 4. Collaborative development and clinical evaluation of new MRD strategies and new MRD techniques Basis for accreditation of laboratory diagnostics

34

35 EuroMRD collaborative history Start IG/TcR analysis in I- BFM 1993

36 Quality Control within the EuroMRD-ALL 1.00E-02 RQ-PCR analysis of a follow-up sample using provided primers/probe set 1.00E E E-05 Positive QR: 5x MRD-PCR laboratories Mean MRD level differs less than 2-fold between various laboratories

37 Inter-laboratory concordance on QR, sensitivity, MRD1 and MRD2 QR 21 Task 1: QR, S, MRD1 and MRD2 100 Percent of labs with same result QR S MRD 1 MRD 2 0 case 1 case 2 case 3 case 4 case 5 case 6 case 7 case 8 case 9 case 10

38 Perspectives MRD is generally used in ALL to guide post induction or post consolidation therapy. Whilst it is unlikely that MRD studies could be completely replaced by novel risk factors, the combined use of MRD evaluation and the newly available genomic information on leukaemia presenting features, like Ikaros or CRLF2 gene deletions will further improve risk assignment of ALL patients. However, clinically relevant improvements in ALL treatment can only result if MRD-based stratification is paralleled by the finding of the appropriate therapeutic strategy.

39 IKZF1 deletions in Intermediate Risk (IR) EFS Event Free Survival 0.4 N. pts N. events 5 yrs EFS 0.2 NEG %(2.6) POS %(7.2) YEARS FROM DIAGNOSIS p-value=0.052 D Cumulative Incidence of Relapse Cum. Incidence N. pts N. rel. 5 yrs Cum. Incidence NEG %(2.5) POS %(6.6) YEARS FROM DIAGNOSIS p-value=0.30

40 EFS and CIR by CRLF2 expression in BCP-ALL Intermediate risk patients pb AIEOP 2000 Intermediate Risk - by CRLF2 deletion 229 patients NEG POS N. pts N. rel yrs Cum. Incidence 17.6%(2.6) 61.1%(12.9) 0.7 Cum. Incidence YEARS FROM DIAGNOSIS P< pb AIEOP 2000 CORS - Nov 2010

41 Linear Subclonal architecture in ALL Anderson, Nature 2011 Notta, Nature 2011 Moderate Complex

42 Darwinian clonal evolution of a cancer Evolutionary speciation, from Charles Darwin's (1837) Greaves, M. Cancer stem cells: back to Darwin? Semin. Cancer Biol. 20, (2010).

43 Changes in clonal architecture in ALL

44 Clonal relationship of diagnosis and relapse samples in ALL Mullighan, C. G. et al. Science 322, (2008).

45 Perspectives : Clinical use of MRD 1. Identification of subgroup of patients with different kinetic of early tumor reduction 2. Identification of patients with different outcome within genetically homogeneous subgroups 3. Identification of impending relapse 4. Molecular relapse?

46 Early detection of relapse 5/77 17/28 13/15 Adult- ALL, Raff et al., Blood 2007

47 Prospective MRD monitoring in chilhood ALL for molecular relapse detection? Systematic controls for MRD on all patients have relatively low chances (in children) to identify MRD relapses MRD monitoring may be quite stressful (for patients/ families and labs) HR subgroups could be more suitable for a strategy of MRD monitoring A second sample for confirmation of MRD positivity should be required

48 MRD as surrogate marker for early assessment of novel therapies? Ø The pressure to accelerate approval of novel drugs or the attempt to shorten the time to trial results has generated a growing interest on the use of end-points on activity (response) as surrogate end-points for efficacy (survival or event free survival). Ø However, deciding that efficacy of treatment can be assessed in terms of molecular response requires that MRD levels are properly validated as a surrogate endpoint.

49

50 MRD as surrogate end point AcSvity or Efficacy early response or clinical outcome MRD EFS- Survival An end- point for acsvity is not necessarily a surrogate for efficacy It has to be pointed out that surrogate markers cannot serve as final proof of clinical efficacy or long term benefit. If they are intended to be the basis for regulatory review and approval then, unless they are properly validated, there should be a predetermined plan to supplement such studies with further evidence to support clinical benefit, safety and risk/ benefit assessment. EmeaCHMP/EWP/83561/2005

51 Conclusions standards or research? Ø Standard Indepenent prognostic value at end-induction Standarized method Quality control rounds Ø Research MRD depends on treatment and time points -> no clear value outside clinical protocols Clonal background and evolution Combination of MRD and new genetic biomarkers Validation as a surrogate marker of efficacy Future use of next generation sequencing (development and validation) Biology of different response (MRD)?

52 Molecular MRD monitoring in chilhood AML

53 ( ) AML is lagging behind acute lymphoblastic leukemia with respect to the implementation of MRD criteria for guidance during therapy. AML is particularly disadvantaged compared with ALL in that approximately half of AML patients lack a molecular target suitable for MRD monitoring. Elisabeth Paietta. Minimal residual disease in acute myeloid leukemia: coming of age. ASH Eucational

54 Molecular targets for MRD quantification in AML Fusion transcripts - t(8;21)(q22;q22) / AML1-ETO - inv(16) or t(16;16)(p13q22) / CBFβ-MYH11 15% of cases RNA, non-linear correlation with cells Pre-leukemia/SC monitoring Mutations (allele specific primers) ex. NPM1, FLT3-ITD low mutation rate in chilren unstable targets Overexpression ex. WT1, EVI1, PRAME

55 WT1 expression monitoring in chilhoo AML Various methodologies to quantify WT1 expression Aim: To standardize WT1 mrna quantitation the European Study Group on WT1 Expression in Childhood AML was established including centers from Germany, Italy and Czech Republic

56 WT1 Quality controls Leukemia 2009, 23 (8), Standardization of WT1 mrna quantitation

57 WT1 expression in AML and healthy BM 2 log 20% PB

58 Acknowledgments Lilia Corral Simona Songia Tiziana Villa Eugenia Mella Valentina Carrino Giuseppe Gaipa Oscar Maglia Simona Sala Laura Levati Vincenzo Rossi Andrea Biondi Valentino Conter Giuseppe Masera Daniela Silvestri Maria Grazia Valsecchi Fondazione Tettamanti BFM Germany BFM Austria BFM Suisse Grants by Fondazione Cariplo, AIRC and Comitato M.L.Verga Emanuela Giarin Maddalena Paganin Katia Polato Barbara Buldini Barbara Michelotto Giuseppe Basso Clinica Ped. Univ. Padova

59

60 Surrogacy requires that the effect of the intervention on the candidate surrogate predicts its effect on true clinical outcome Prentice s definition Treatment Surrogate Clinical X Surrogate endpoint needs to be validated It is treatment (class) specific

61 Surrogate scenario Standard treatment 100 pts Experimental treatment 100 pts Response YES NO YES NO High ac`vity % failures 4 yrs n. of failed 10% 40% % 40% Same rate of failures in responders/non responders Modest effect on clinical outcome MG Valsecchi, CORS Monza

62 EuroClonality-NGS consortium Main objective of the consortium is to develop, standardize, and validate IG / TR NGS tools for: i.) clonality assessment; ii.) MRD analysis; iii.) repertoire analysis / somatic mutation analysis Platform-independent assay design Scientifically independent group, no exclusive interactions with commercial partners in the field of NGS (whenever relevant and useful, collaboration will be initiated, for example for optimal dissemination of developed assays / tools)

63 EuroClonality NGS consortium A. Langerak / J. van Dongen (Rdam) P. Groenen (Nijmegen) M. Brüggemann / C. Pott (Kiel) M. Hummel (Berlin) M. Catherwood (Belfast) F. Davi (Paris) E. Macintyre (Paris) R. Garcia Sanz (Salamanca) G. Cazzaniga (Monza) K. Stamatopoulos (Thessaloniki) N. Darzentas (Brno) Coordination : A.W. Langerak M. Lefranc / V. Giudicelli (Montpellier)

64 EuroClonality-NGS consortium Phase 1 Technical WorkPackages 1 Development of IG-TR PCR-based NGS assays (all teams) 2 Bioinformatics pipeline (N. Darzentas) 3 Capture-based NGS strategies (D Gonzalez) Phase 2 Application WorkPackages 4 NGS-based clonality assessment (P. Groenen / M. Hummel) 5 NGS-based MRD assessment (M. Brüggemann / C. Pott) 6 NGS-based Ig repertoire analysis (F. Davi / K. Stamatopoulos) 7 NGS-based TR repertoire analysis (A. Langerak / E. Macintyre)

65 EuroClonality-NGS PCR-based assays Position IGH V-J IGH D-J IGK V-J / V-Kde IGL V-J TRB V-J / D-J TRG V-J TRD V-J / D-D/J FR3 (clonality, MRD) ~200 bp Kiel Salam. Paris-P Thess Nijmegen Rotterdam Belfast NOT Berlin Kiel Monza Paris-N London Paris-N Monza London leader (repertoire) Paris-P n.a. (phase 2?) t.b.d. (phase 2?) t.b.d. NOT NOT NOT

66 Platform independence 454 GS Flex, Junior (Roche) HiSeq, MiSeq (Illumina) Ion Torrent (Life)

67 EuroClonality-NGS Bioinformatic pipeline wet lab work 'raw' data from the NGS machine data preparation, including error correction meta- analysis, e.g. IMGT/HighV- QUEST Nikos Darzentas Vojta Bystry Jana Silhava Bioinformatics Analysis Team - BAT - bat.infspire.org Central European Institute of Technology - CEITEC Masaryk University - MU Brno, Czech Republic

68 EuroClonality-NGS Bioinformatic pipeline basic major steps 00. everything is logged, in different formats 01. parameter choice, can be defaults, can be organised in 'scenarios' 02. reading files, counting sequences, handling data 03. if applicable: joining paired- end reads 04. if applicable: across- samples comparison and info gathering 05. primer / adapter cutting 06. quality trimming, filtering, masking 07. FASTQ to FASTA 08. dereplicating 09. error correction 10. final filtering steps 11. junction analysis, summaries, matrices, visualisations 12. wrapping up - minilogging, compressing/removing files Nikos Darzentas

69 EuroClonality-NGS Bioinformatic pipeline error correction error corrections are attempted through a module that can be repeated as many times as requested or required there is actually an 'auto' mode that goes on (within limits) until it reaches a plateau of small number of corrections error correction decisions can be different, for many reasons: - for different sequence regions, e.g. V, junction, J etc. - for different receptors, i.e. IG and TR - for different samples, runs, machines, protocols critically, we can learn on- the- fly from a sample or sequence region (e.g. V region in TR, which should be in germline- configuration) to apply in another region (e.g. junction) or other samples there can also be multiple individual factors affecting the decisions, e.g. strand biases Nikos Darzentas

70 EuroClonality-NGS Bioinformatic pipeline cluster gagctctgtgaccgccgcggacacggctgtgtattactgttcgagcagcttaggtgtggcagtngctggtacgggttcggactactttgagcaatggagccagggaaccngggtcaccgtctcctcag after corrections n a t - - g - g t - g - g - g - t g a - g t n g g g g Nikos Darzentas

71 EuroClonality-NGS Capture-based assays Exome Capture TruSeq (Illumina) DNA ê Fragmentation ~200 bp ê Library Prep ê Hybridisation to biotin-dna baits ê Streptavidin pull down ê Amplify/index ê Sequence

72 EuroClonality-NGS Capture-based analysis FFPE FF BCL2 IGH à to be extended to V(D)J rearrangements (IG-TR) David Gonzalez