Expression analysis of candidate genes for abiotic stress tolerance in Brassica genotypes with contrasting osmotic stress tolerance

Transcription

1 Indian Journal of Experimental Biology Vol. 55, June 2017, pp Expression analysis of candidate genes for abiotic tolerance in Brassica genotypes with contrasting osmotic tolerance D Phukan 1 *, V Goyal 1, P Palit 1, R Kalia 1, M Koundal 1, SVA Mithra 1, I Ravi 2, DK Yadava 3, V Chinnusamy 4 & T Mohapatra 1,5 * # Supplementary Fig. 1 C ML MH PL PH NL NH C ML MH PL PH NL NH Supplementary Fig. 1 In Vitro screening of Brassica genotypes for tolerance to abiotic. [C-Control; ML, Mannitol Low ( 0.5 MPa); MH, Mannitol High ( 0.7 MPa); PL, PEG Low ( 0.5 MPa); PH, PEG High ( 0.7 MPa); NL, NaCl Low ( 0.5 MPa = 200 mm); NH, NaCl High ( 0.7 MPa = 320 mm)].

2 2 INDIAN J EXP BIOL, JUNE 2017 Supplementary Table 1 List of candidate genes used for expression studies under drought Genes Function Phenotype Induction of gene expression ERECTA TMM LRR receptor-like serine/threonineprotein kinase ERECTA has an important role in plant morphogenesis. ERECTA gene also regulates plant transpiration efficiency in Transmembrane leucine-repeat containing receptor-like protein, TMM (TOO MANY MOUTH) is expressed in proliferative post protodermal cells. TMM appears to function in a position-dependent signaling pathway that controls the plane of patterning divisions as well as the balance between stem cell renewal and differentiation in stomatal and epidermal development Signal Perception Overexpression of thaliana receptor-like kinase ERECTA (ER) in, rice and tomato confers thermotolerance independent of water loss and that er mutants are hypersensitive to heat Recessive mutation leads to disruption of asymmetric cell division during stomata development. ABA metabolism and Signalling Upregulated by Heat Upregulated by ABA signaling ABA1 Zeaxanthin epoxidase Mutant is deficient in ABA and is wilty Drought ; ABA biosynthesis C707A3 PP2CA AREB1 PLDa CYP707A3, encodes an ABA 8'- hydroxylase involved in ABA degradation in ABA hypersensitive PP2C protein AHG3/PP2CA is a strong negative regulator of ABA signal transduction ABSCISIC ACID-RESPONSIVE ELEMENT BINDING PROTEIN1 (AREB1) (i.e., ABF2) is a basic domain/leucine zipper transcription factor that enhances drought tolerance in Phospholipase D alpha regulates plant response to water Overexpression: exhibited increased transpiration, lowered ABA content coupled with higher levels of the ABA metabolites phaesic acid and dihydrophaseic acid. mutant exhibits reduced transpiration rates, enhanced drought tolerance, higher ABA accumulation and hypersensitivity to exogenous ABA Overexpression: ABA insensitivity in plants Overexpression: ABA hypersensitivity and enhanced drought tolerance Mutant: ABA insensitivity and displayed reduced survival under dehydration Overexpression in : Increase sensitivity to ABA and reduce transpiration and enhanced the leaf's sensitivity to abscisic acid Antisense: accelerated transpirational water loss and a decreased ability to tolerate drought and suppression of PLDα1 increases freezing tolerance PLD1d PLDdelta, phospholipase D PLDδ positively regulates plant tolerance to es such as freezing, oxidative assault, and ultra-violet irradiation Up-regulated in ABA and Dehydration Up-regulated in Cold, Drought, salt and ABA Drought Upregulated by drought and ABA severe dehydration, high salt, and during cold acclimation Ref. 13, , 21, 22 23, 24

3 3 ROP10 INO1 SOS4 CaMBP2 5 Rac-like GTP-binding protein ARAC is localized to the plasma membrane and involved in the negative regulation of ABA signaling rop10 enhances the sensitivity of seed germination inhibition to mannitol and NaCl Signal amplification - Second messengers and ABA D myo-inositol-3-phosphate synthase INO1, involved in the biosynthesis of phosphatidyl inositol Pyridoxal kinase-like protein SOS4 Mutant lacks root hair in the maturation (Salt Overly Sensitive 4) is a novel zone salt tolerance determinant important for the regulation of Na+ and K+ homeostasis in plants and involved in the biosynthesis of pyridoxal-5- phosphate, an active form of vitamin B6. Calmodulin binding protein 25, a negative regulator of response to osmotic and salt tolerance MRP5 Multi drug resistance-associated proteins (MRPs) are important components of guard cell functioning. HD2C CPL3 CBP20 GF14a RabG3e Histone deacetylase 2C interacts with HDA6 and is involved in ABA and salt response in and play diverse roles in plant development and physiology through chromatin remodelling. AtHD2C, is involved in abscisic acid and abiotic responses CPL3 belongs to a family of CTD phosphatase-like (CPL) genes and negative regulator of responsive gene transcription and modulator of growth and development. It is an isoform that specially facilitates ABA signaling. Nuclear cap-binding protein subunit 20 has a role in drought tolerance Overexpression: transgenic plants hypersensitive to salt and osmotic, Antisense: transgenic plants more tolerant to these es Mutants had reduced water loss from excised leaves and were less wilty than wild-type plants under drought conditions. A high-affinity inositol hexakisphosphate transporter which play key role in guard cell signaling and phytate storage Transcription and RNA processing Repress transcription directly by targeting to promoters in planta. Over-expression of in transgenic plants conferred an abscisic acid-insensitive phenotype Proper localization of STRS in response to and ABA is impaired in hd2c mutant Mutants are hyper responsive to osmotic es and ABA Mutant displays elevated sensitivity to abscisic acid (ABA) and improved drought tolerance Metabolisms, cell cycle regulation, gene transcription and responses G-box Regulatory Factor, or General Regulatory Factor are proteins are phosphoserine/threonine binding proteins RAB GTPase homolog G3E, Intracellular vesicle trafficking Stay-green phenotype GF14a is associated with a DNA binding complex that binds to the G box, a wellcharacterized cis-acting DNA regulatory element found in plant genes. Protein trafficking and Proteolysis Overexpression: Salt and osmotic (Sorbitol) tolerance ABA, mannitol and NaCl salt Salt (NaCl) and abscisic acid (ABA) treatment dehydration, cold, ionic (Salt/Nacl) and non-ionic (mannitol) osmotic. ABA and Salt (NaCl) response to NaCl treatment and regulator of osmotic and ABA signaling Upregulated by ABA and Drought response to salinity and drought response to cold, salt, and drought 25 26, , 32, ,

4 4 INDIAN J EXP BIOL, JUNE 2017 STT3a PIP2B PIP1-2 AQP1 Dolichyl-diphospho-oligosaccharide- Protein glycosyltransferase subunit STT3A is involved in the cellular metabolic process, co-translational and post-translational protein modification and protein N-linked glycosylation via asparagines Plasma membrane aquaporin PIP2-2 proposed to participate in processes such as response to water deprivation, response to salt, water transport, etc. aquaporin PIP1-2 is a aquaporin which function as a water transporter Aquaporin (PIP1) plays a role in water transmembrane transporter activity HSA32 HEAT-STRESS-ASSOCIATED 32 is essential for acquired thermo tolerance during long recovery after acclimation. SHN1 ERF/AP2 transcription factor (SHN1) gene and involved in ethylene mediated signaling pathway, cutin biosynthesic process Mutants were sensitive to salt and hyperosmotic. The salt/osmotic sensitivity of stt3a seedlings was associated with root tip swelling and enhanced lateral root development Membrane Transport PIP2;2 Silencing abundantly expressed in roots (cortex, stele, endodermis) in Under drought : overexpression is detrimental, causing faster wilting in Nicotiana tabacum. Root system of Anti-sense arabidopsis plants were 5 more developed than in wild type. Overexpression leads to improved leaf growth and Silencing decreased water permeability at the cell level and water resistance in Nicotiana tabacum. Stress protection, damage control and metabolism Activation tag mutation & overexpression: in -high cuticular resistance, drought tolerance and recovery, probably related to the reduced stomatal density Salt and Osmotic Downregulation under drought and salt Downregulation upon drought and salt Downregulation under drought and salt Upregulated by HS (heat shock) treatment and maintenance of acquired thermo tolerance Drought , 45

5 5 Genes Supplementary Table2 List of primers used in Real time/qpcr for expression analysis Full name of the genes Brassica Genebank accessions Primer sequences Amplicon size ERECTA LRR receptor-like serine/threonineprotein XM_ F: 5'TGTCTACAGCTACGGGATAGT 3' 103 bp kinase ERECTA R: 5'GCTCACGGTCTTGGACATTA 3' TMM Transmembraneleucine-repeat XM_ F: 5'ATAACCGAGTCACTGGTCCTATC 3' 111 bp containing receptor-like protein R: 5'CTTGGAGAGAAGACGGGAACG 3' ABA1 Zeaxanthinepoxidase XM_ F: 5'TACAGAGGTCCGATTCAGATAC 3' 97 bp R: 5' TGATACATCCAGCTTCCATGAC 3' C707A3 abscisic acid 8'-hydroxylase 3 XM_ F: 5'GGGTTTCGCTGGACGAATAA 3' 121 bp R: 5'GATTAAGCACCGGAGGAAGTAG 3' PP2CA ABA hypersensitive PP2C protein JX F: 5'GTTGCCATCCCTCTCTCTTC 3' 99 bp AHG3/PP2CA R: 5'AGCTCCGTCCCAGTAGATTA 3' AREB1 ABA-responsive element binding XM_ F: 5'CCAGCAACATCAGCCAATC 3' 88 bp protein 1 R: 5' TCCCATAAGACCACCTCTTATC 3' PLDa phospholipase D alpha XM_ F: 5'AGAGGTGCTGGGAGGATATT 3' 104 bp R: 5'GGAGTCTCTAACCAAGGCAATC 3' PLD1d PLDdelta.a phospholipase D JF F: 5'TCACTATGGGCAGAGCATTTAG 3' 105 bp R: 5'CTTCCAGTTCCCTTCAGCTATT 3' ROP10 Rac-like GTP-binding protein ARAC XM_ F: 5'ACCTCTCTCTCTCTCTCTCTCT 3' 103 bp R: 5'CGACGGTGACGCACTTTAT 3' INO1 Inositol-3-phosphate synthase INO1 XM_ F: 5'CGTCATCAACGGTACCAAGAA 3' 101 bp R: 5'TCCACAGAACCACAACCTTATC 3' SOS4 Pyridoxal kinase-like protein SOS4 XM_ F: 5'GGATCTCATGACTGCTCTTCTAC 3' 135 bp R: 5'TACCCGGCTCGTTTGTAATC 3' CaMBP25 Calmodulin binding protein 25 XM_ F: 5'TGGTGACTTCGGAGGGGGTA 3' 102 bp R: 5'CGTTGTCGTGAGAGAAGGTATC 3' MRP5 Inositol hexakisphosphate transporter XM_ F: 5' GGTCCTCATCAACCTCACGCTC 3' 93 bp R: 5' TTAGAGAGTCTGCCTCTCCG 3' HD2C Histone deacetylase 2C XM_ F: 5'GACGCCCTAGAAAGCTCTAATC 3' 130 bp R: 5'GGTGAACCACTCTTAACCTCAA 3' CPL3 RNA polymerase II C-terminal domain XM_ F: 5' TGAAGGTGCCAAAGTCCATCATCC 3' 112 bp phosphatase-like 3 R: 5'GCTTGGAAGGTCATCTGATTTA 3' CBP20 Nuclear cap-binding protein subunit 20 XM_ F: 5'TTCTTGATGACCGCCCTATTC 3' 128 bp R: 5'ACCTCTAGCAGGATCGTAATCT 3' GF14a Stay-green phenotype XM_ F: 5'GACGATGAGCAGAGACCAATAC 3' 97 bp R: 5'GGTTACGAGGCTTTCCATGA 3' RabG3e RAB GTPase homolog G3E XM_ F: 5'GGACAAGCGAGAAGAGAAGAAG 3' 116 bp R: 5'CTACGGGAAGGCATCGAAAT 3' STT3a Dolichyl-diphosphooligosaccharide XM_ F: 5'CCGGAGTTATGGTTCGTCTTAT 3' 123 bp Protein glycosyltransferase subunit STT3A R: 5'CCGATCGACCTAACTGGTATTT 3' PIP2B Plasma membrane aquaporin PIP2-2 XM_ F: 5' GGTGACGTTCGGCTTATTCT 3' 101 bp R: 5' CAAACCCAACTCCGCAAATC 3' PIP1-2 aquaporin PIP1-2 XM_ F: 5' GGTCTCGGAGCTGAGATTATTG 3' 90 bp R: 5' ATGAGAGTCACGAGCGTTTC 3' AQP1 Aquaporin (PIP1) EU F: 5'CTCGTGACTCTCATGTTCCTATTC 3' 103 bp R: 5'GGGTTGATTCCAGTTCCAGTAA 3' HSA32 HEAT-STRESS-ASSOCIATED 32 XM_ F: 5'CGGGTCACTACAGATGGAAGAG3' 109 bp R: 5'TGGCTGAGAACGGAGTAACG 3' SHN1 AP2 transcription factor (SHN1) gene DQ F: 5'AAACGGAGGATATGGCTTGG 3' 134 bp R: 5'GACGTGTCTCCAGTGTTGTT 3' Actin Actin-like XM_ F: 5'CTCACGCTATCCTCCGTCTC 3' 199 bp R: 5'TTCTCCACCGAAGAACTGCT 3'