SUPPLEMENTARY INFORMATION

Transcription

1 SUPPLEMENTARY INFORMATION A Cell-free Protein Producing Gel Nokyoung Park 1,4, Soong Ho Um 1,2,4, Hisakage Funabashi 1, Jianfeng Xu 1,3 and Dan Luo 1 1 Department of Biological and Environmental Engineering, Cornell University, Ithaca, NY Current address: Department of Materials Science and Engineering, Department of Biological Engineering, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA Current address: Arkansas Bioscience Institute, Arkansas State University, State University, AR These authors contributed equally to this work. Corresponding author: dan.luo@cornell.edu nature materials 1

2 Figure S1. Schematic drawing of X-DNA linkage with a linear plasmid (pivex1.3rl) Table S1. A comparison of protein production yields and fold increases from different lysates Lysates E. coli Rabbit reticulocyte Proteins Rluc (functional) Urokinase (functional) Rluc (functional) P-gel SPS P-gel SPS P-gel SPS Yields ( g/ml) 300 ± ± ± ± 0.1 Fold increase between P-gel and SPS 2 nature MATERIALS

3 Figure S2. A schematic illustration of Roche s cell-free Rapid Translation System (RTS). The device is composed of two chambers separated by a semi-permeable membrane for expression and continuous feeding. Transcription and translation take place simultaneously in the reaction chamber (50 L). Supplies including energy components and amino acids are continuously fed through the membrane. At the same time, potentially inhibitory by-products are eliminated by diffusion through the membrane into the feeding chamber (1 ml). nature materials 3

4 Rluc plasmid amount of S Figure S3. Effect of the total gene amounts on expression by varying the amounts of linear plasmids in SPS controls. 4 nature MATERIALS

5 a Standard n g) ( (50, 20, 5, 1) b R l u cplasmid amount P-gel in (n gin 400 pa 0.0 Standard n g) ( (50, 20, 5, 1) Ratio of -DNA X and plas 0.0 Figure S4. Northern blot of Rluc expression from P-gels. (a) The mrna level from P- gels with different amounts of plasmids. Left panel: A chemiluminescence image of Northern blot. Lanes 1-4: transcripts with plasmids at 80 ng, 160 ng, 397 ng, and 794 ng, respectively, in 400 pads (8 L) of P-gel. Right panel: quantified transcription levels from the left image. The line represents transcription efficiencies, and the bars represent protein yields. (b) mrna amount from P-gels with different ratios of X-DNA and plasmid. Left panel: A chemiluminescence image of Northern blot. Lanes 1-4: transcripts with X-DNA and plasmids ratios at 2000:1, 3000:1, 5000:1, and 6000:1, respectively. Right panel: quantified transcription levels from the left image. The line represents transcription efficiencies, and the bars represent protein yields. nature materials 5

6 Table S2. Oligonucleotide sequences of three X-DNAs and their protein yields (The red letters indicate the variations of sequences in each X-DNA) Strands for X1 X11 X12 X13 X14 Sequences CGACCGATGAATAGCGGTCAGATCCGTACCTACTCGGGCC CGAGTAGGTACGGATCTGCGTATTGCGAACGACTCGGGCC CGAGTCGTTCGCAATACGGCTGTACGTATGGTCTCGGGCC CGAGACCATACGTACAGCACCGCTATTCATCGGTCGGGCC Strands for X2 X21 X22 X23 X24 Sequences CGACCGATGAATAACCGCCAGATCCGTACCTACTCGGGCC CGAGTAGGTACGGATCTGCGTATTGTTCGCGACTCGGGCC CGAGTCGCGAACAATACGGCTGTACGTATGGTCTCGGGCC CGAGACCATACGTACAGCGCGGTTATTCATCGGTCGGGCC Strands for X3 X31 X32 X33 X34 Sequences CGACCGATGAATAGCGGTCAGATCCGTAGTAGGTCGGGCC CGACCTACTACGGATCTGCGTATTGCGAACGACTCGGGCC CGAGTCGTTCGCAATACGGCTGTACATACGGTCTCGGGCC CGAGACCGTATGTACAGCACCGCTATTCATCGGTCGGGCC 6 nature MATERIALS

7 X-DNA Rluc amount (mg/ml, based on activity) Standard deviation X X N/D X N/D nature materials 7

8 Table S3. List of proteins expressed from P-gels and their functionalities 1 Protein MW (kda) Functional AcGFP 27 Yes CAT 25 Yes Rluc 34 Yes Heavy chain IgG 46 N/A light chain IgG 30 N/A Leptin 16 Yes 2 Mytilus edulis foot protein type-1 (mefp-1) with 35 repeats Mytilus edulis foot protein type-1 (mefp-1) with 75 repeats 37 Yes 78 Yes CD Marginal 3 Urokinase 32 Yes 1 : six additional kinases, which were proprietary, were not shown 2 : this protein was synthesized with Lys C13 and Asp C13 isotope integrated for mass spectrometry : trace N/A: not applicable (subunits of an entire protein. Assembly of the entire protein is needed to be functional). 8 nature MATERIALS

9 a kda kda M 1 2 kda M 1 2 b kda M 1 2 kda M 1 2 c kda 50 M M d e kda kda M kda M kda M nature materials 9

10 f g kda M M (kda ) M h kda kda 148 M M Heavy chain Heavy chain 36 Light chain Light chain Figure S5. Western blotting and SDS PAGE analysis of various proteins. (a) Western blotting of Rluc produced form P-gel. Lane M: SeeBlue Plus2 Pre-stained protein marker (Invitrogen, Carlsbad, CA); Lane 1: Standard Rluc (50 ng, Prolume Ltd., Pinetop, AZ); Lane 2: P-gel lysate (0.01 L). (b) Western blotting of Rluc produced form SPS.Lane 1: Standard Rluc (5 ng, Prolume Ltd.); Lane 2: SPS lysate (0.1 L). (c) Western blotting of AcGFP. The standard AcGFP was purchased from Clontech (Mountain View, CA) contains a 6xHis epitope tag at its N-terminus and an enterokinase site between the 10 nature MATERIALS

11 tag and the protein, which made the protein exhibit a slightly higher molecular weight than those produced from P-gel and SPS.; Lane 1-4: Standard AcGFP (0.5, 0.05, 0.01, g each); Lane 5: P-gel, 0.01 L of lysate loaded; Lane 6: SPS, 0.1 L of lysate loaded. (d) Western blotting of Leptin; Lane 1: P-gel lysate; Lane 2: SPS lysate; Lane 3: blank lysate. (e) Western blotting of Urokinase; Lane 1: P-gel, 0.1 L of lysate loaded; Lane 2: P-gel, 1.0 L of lysate loaded; Lane 3: SPS, 1.0 L of lysate loaded. (f) SPS PAGE of CD 38; Lane 1: P-gel lysate; Lane 2: SPS lysate; Lane 3: blank lysate. (g) SPS PAGE of CAT; Lane 1: P-gel lysate; Lane 2: SPS lysate; Lane 3: blank lysate. (h) SDS- PAGE assay of IgG expressed by P-gel and SPS. Lane M: Molecular marker; Lane 1: P- gel lysate; Lane 2: SPS lysate; Lane 3: Control lysate. The lanes were reorganized from the same gel without any other image manipulation. nature materials 11

12 a M b M kbp kb plasmid bands 1 mrna bands degraded DNA (plasmid, X -DNA) Figure S6. (a) Enhanced stability/protection of plasmid with X-DNA against DNase. Lane M: 2-Log DNA marker. Lane 1: 500 ng of linear plasmid (pivex1.3rl). Lane 2: mixture of plasmid and X-DNA. Lanes 3-4: mixture of plasmid and X-DNA after DNase treatment for 30 and 120 min, respectively. Lane 5: plasmid. Lanes 6-7: plasmid after DNase treatment for 30 and 120 min, respectively. (b) mrna stability of plasmid coexisting with X-DNA vs. mrna of SPS. Lane M: Low Range ssrna marker. Lane 1: 500 ng of mrna. Lane 2: mixture of mrna and X-DNA. Lanes 3-4: mixture of mrna and X-DNA after RNase treatment for 30 and 120 min, respectively. Lane 5: mrna. Lanes 6-7: mrna after RNase ONE treatment for 30 and 120 min, respectively. 12 nature MATERIALS

13 Table S4 Effect of plasmid capping with X-DNA on protein production Condition Schematic drawing Rluc yield (μg/ml, based on activity) Fold increase X-plasmid-X in SPS (plasmids capped with X- DNAs, agarose gel purified) lysate 7.3 ± 2.3* 1.9 Control SPS (agarose gel purified) lysate 3.9 ± 0.8* 1 *: note the lower expression level was due to the agarose purification of plasmid which was necessary for the purification of X-plasmid-X. nature materials 13

14 a b c d Figure S7. SEM images of P-gel with different ratios of X-DNA and plasmid. a: 2000:1, b: 3000:1, c: 5000:1 and d: 6000:1. Scale bars: 100 m. 14 nature MATERIALS

15 Figure S8. Confocal images of P-gel. Only plasmids were pre-stained with SYBR1. Left: fluorescence image showing pre-stained plasmids, Middle: bright field image, Right: overlaid image. Scale bars: 10 m Number of reu Figure S9. Reuse of a P-gel in Rluc expression. *: relative to the expression level of the first time. nature materials 15

16 Discussion S1 A brief examination of substrate (gene) concentration reveals that even when the total amount of genes was identical for both P-gel and SPS, the concentration of the gene of the entire P-gel micropads increased at least 6 times simply because P-gel was enzymatically crosslinked, and thus effectively concentrated the same amount of genes into a much smaller gel volume (8 μl for P-gel vs. 50 μl for SPS). In addition, because of the random nature of crosslinking, the nano-sized/micro-sized plasmid domains exist and are non-uniformly distributed throughout the P-gel (Fig. S8). We thus speculate that the enzyme turnover rate of T7 polymerase (the transcription enzyme) in those areas increased significantly because the plasmids were forced to cluster physically together forming the gel scaffolding and were unable to diffuse: After a T7 polymerase came off from one gene substrate, it could easily jump onto the next gene substrate, which was literally only several nanometers away. These off-and-on processes can recycle many times within a very short period of time, which is much more efficient than in SPS where both enzymes and substrates diffuse constantly in solution, and consequently, the T7 polymerase chiefly relies on thermo energy and random collision to find its next substrate. The above discussions collectively point to at least two aspects contributing to enhanced transcription efficiency from P-gel: 1) a higher overall gene concentration due to a more compressed volume from the gel; this fact cannot be realized with solution phase because of the solubility of DNA; and 2) a faster enzyme turnover rate due to a closer proximity of genes; this speculation needs further evaluation in future. 16 nature MATERIALS

17 Discussion S2 Note that all P-gel protein production presented so far has followed the exact same conditions which had been in the past optimized for SPS and not for the P-gel system except that we have changed the format and the amount of genes involved. Conditions can be and should be optimized specifically for P-gel itself, independent of SPS. By changing the established conditions for SPS, we further improved P-gel protein productivity. For example, the P-gel expression level kept increasing up to 36 hours while SPS reached its highest expression level at 12 hours (Fig. 2d). Since the reaction solutions and feeding buffer used were exactly the same between P-gel and SPS, and since only P-gel continued protein production beyond 12 hours, it was evident that the protein production machinery of P-gel was not significantly degraded after 12 hours. Rather, the plasmid molecules in SPS were more likely to have been lost due to degradation and adhesion on device wall, resulting in no new protein production. The plasmid in P-gel, on the other hand, appeared to be protected against degradation due to the gel structure resulting up to 72 hours activity. P-gels are also physically robust enough to be recovered by a simple centrifugation from lysates after expression and could be reused up to 5 times (Supplementary Information, Fig. S9 and Methods S2). Note as well that the reaction solution and the feeding buffer used in the P-gel system were also optimized for SPS but not for P-gel. For example, we observed that when the plasmid amount was increased from 400 ng to 4 μg, the protein yields of SPS also increased non-linearly from mg/ml to about 0.6 mg/ml (Supplementary Information, Fig. S3). In contrast, the protein yields of P-gel almost remained unchanged when the plasmid amount was increased from 400 ng to 800 ng (Fig. 2b). This suggested that at least one factor in the reaction solution or the feeding buffer either reached saturation and/or was close to depletion due to the tremendous expression power of P-gel. Indeed, by simply doubling the amino acid concentrations, we observed a 52% increase in Rluc yield. In addition, by simply refreshing the feeding buffer twice within 48 hours, nature materials 17

18 we observed a further increase in Rluc production of up to 5.0 mg/ml (data not shown), a 270% increase in yield, and 288 times higher in efficiency than SPS. This productivity corresponded to 2750 mg of proteins produced per mg of gene (or 47,300 copies of proteins produced per copy of gene). All of these newer conditions have improved protein production for P-gel only, suggesting that the gel format had the unique advantages over a solution phase. 18 nature MATERIALS

19 Method S1. Quantitative analysis of produced proteins (We assumed 100% of purchased proteins were functional) AcGFP (Aequorea coerulescens green fluorescent protein) Functional proteins: relative fluorescence units (RFU) were measured for each sample. After expression reaction, each lysate solution was diluted 20 times with 1x PBS buffer. Eighty μl of the diluted solution was used for each RFU measurement. The samples were excited with 475 nm light and the peak fluorescence was measured at 505 nm. The measured RFU was converted to weight concentration according to a calibration curve which was obtained from commercially purified AcGFP standards (Clontech, Mountain View, CA). The measured specific activity of standard AcGFP was 2.1x10 7 RFU/mg. Total proteins: The yield of AcGFP was determined by titration from the Western blot membrane. Briefly, 0.01 μl, 0.05 μl, 0.1 μl and 0.2 μl of P-gel and SPS lysates, and varying amounts (0.005 μg, 0.01 μg, 0.05 μg and 0.1 μg) of AcGFP standards were loaded onto a 4-15% gradient SDS-PAGE gel (Bio-Rad, Hercules, CA). After separation with electrophoresis, the proteins were electrically transferred to a PVDF membrane (Bio-Rad), and then detected with the rabbit anti-gfp polyclonal antibody (MBL, Woburn, MA) as the primary antibody, and anti-rabbit IgG alkaline phosphatase conjugated (Chemicon, Temecula, CA) as the secondary antibody. The image developed on the Western blot membrane was scanned and analyzed with software ImageJ. The amounts of AcGFP in each sample were then calculated by comparing the density of the corresponding band with those of the AcGFP standards. CAT (Chloramphenicol Acetyltransferase) Functional proteins: the activities of expressed proteins were determined by the comparison with the calibration curve which was obtained from commercially purified CAT standards (Promega) using FAST CAT Green (deoxy) Chloramphenicol nature materials 19

20 Acetyltransferase Assay kit (Invitrogen, Carlsbad, CA). The activity unit was converted to weight according to conversion rate; 3x10-4 units per 2 pg of protein per instructions from the manufacturer. One unit is defined as the amount of enzyme required to transfer 1 nmol of butyrate or acetate to chloramphenicol in one minute at 37 C. Total proteins: the CAT concentration was measured using CAT ELISA kit (Roche) following the manufacturer s instructions. Briefly, the lysate solutions were placed in the wells of the anti-cat antibody precoated microplate. A digoxigenin-labeled anti-cat antibody was added followed by incubating with an anti-digoxigenin antibody, conjugated with peroxidase. Finally, the peroxidase substrate was added and absorbance was measured at 405 nm. The absorbance of the sample was directly correlated to the weight concentration of CAT in the lysates. Rluc (Renilla luciferase) Functional proteins: relative luminescence units (RLU) were measured for each sample. Each reaction was diluted 10 7 times with 1x lysis buffer (Promega). Five μl from diluted solution was used for each RLU measurement. The measured RLU was converted to weight concentration according to a calibration curve which was obtained with commercially purified Rluc standards (Prolume, Pinetop, AZ). The specific activity of the standard was 7.5x10 13 RLU/mg. Total proteins: the total amount of produced Rluc was measured by western blot. The mouse anti-renilla luciferase monoclonal antibody, clone 1D5.2, (Chemicon) was used as a primary antibody. The goat anti-mouse IgG(H+L) conjugated with alkaline phosphatase (Chemicon) was a secondary antibody. Color was developed by adding the Western Blue stabilized substrate for alkaline phosphatase (Promega). The commercially available Rluc (Prolume) was used to construct the calibration curve. One ng, 5 ng, 10 ng, 50 ng and 100 ng of Rluc proteins were electrophoresed at the same gel with the 20 nature MATERIALS

21 diluted samples. The concentration of the expressed Rluc was determined by the comparison of band intensities and the calibration curve. Leptin Total proteins: The expression of leptin was assayed with SDS-PAGE and western blot. For SDS-PAGE, one μl of P-gel and SPS lysates were loaded onto a 4-15% gradient SDS-PAGE gel (Bio-Rad, CA) and separated with electrophoresis. For Western blot, one μl of lysates was loaded onto a 15% SDS-PAGE gel. After electrophoresis, protein bands were transferred onto an Immun-Blot PVDF membrane (Bio-Rad), which were subsequently detected with a primary antibody, rabbit polyclonal anti-mouse Leptin antibody (BioVision, Mountain View, CA), and a secondary antibody, alkaline phosphatase-conjugated goat anti-rabbit IgG (Promega). CD38 (Cluster of differentiation 38) Functional proteins: The activity of CD38 was assayed by detecting its ability to convert NGD+, an analogue of NAD+ into cyclic GDP-ribose following a reported method (Muller-Steffner, H. M., Augustin, A. and Schuber, F. Mechanism of Cyclization of Pyridine Nucleotides by Bovine Spleen NAD1 Glycohydrolase. J. Biol. Chem. 271, (1996). Total proteins: the total yield of the expressed CD38 with a 6x His tag on the C- terminus was determined by Western blot with an anti-6xhis antibody (Invitrogen). A pure CD38 (with 6xHis tag), which was provided by Quan Hao s lab at Cornell University was used as the standard for calibration. Urokinase Functional proteins: the activity of urokinase was assayed with a colorimetric method by using upa Activity Assay Kit (Chemicon). Briefly, P-gel and SPS lystaes were diluted nature materials 21

22 serially by 100, 1000 and folds with ddh 2 O, and 50 μl of the diluted samples were added to the 96-well plate. The samples were then supplemented with the assay buffer and the chromogenic substrate. After incubation at 37 C for 30 min, the absorbance was read at 405 nm. The activity (international unit, or IU) was calculated by comparison with the absorbance of the known standard provided by the kit. The specific activity of urokinase is IU/mg (Nobuhara, M. et al. A Comparative Study of High Molecular Weight Urokinase and Low Molecular Weight Urokinase J. Biochem. 90, (1981). Method S2. Reuse of P-gel An E. coli lysate based system, PURE system (New England Biolabs, Ipswich, MA), was used to determine the reusability of P-gel. Expressions were carried out as instructed by the manufacturer. Each 25 μl reaction contained 200 micropads (4 μl) of P-gel including 200 ng of Rluc plasmids. Each expression was carried out for 1.5 hours at 37 o C with a gentle rotation. After each cycle of reaction, the reaction tube was centrifuged at 1500 rpm for 3 min and 20 μl of supernatant was pipetted out and stored for assay. The remainder of the P-gel received 20 μl of fresh lysate solution and the expression reactions were repeated four times using the same conditions. In the calculation of protein yields for each cycle, the contribution from previous cycle was subtracted. 22 nature MATERIALS