Generating genetically modified model marmoset. Erika Sasaki Central Institute for Experimental Animals CIEA SINCE 1952
|
|
- Herbert Ward
- 5 years ago
- Views:
Transcription
1 Generating genetically modified model marmoset Erika Sasaki Central Institute for Experimental Animals CIEA SINCE 1952
2 Overview of production of transgenic marmoset Follicular stimulation using FSH and hcg Day Oocytes collection & IVM Day 11 In vitro fertilization Day 12 Neonates Additional 145days Confirm pronucleus Day 13 Total around 167 days Embryo transfer Day Viral injection in 0.25M sucrose supplemented media Day 14 Embryo culture Day Select embryo that express Fluorescent protein
3 Disadvantages of the viral vector technique for production transgenic animals Lentiviral vector Tg marmoset Difficult to introduce DNA longer than 5kb produce targeted gene knock out animals There are no pluripotent stem cells that have chimeric competent cells to produce targeted gene knockout animals in most of the mammal species including marmoset.
4 Production of target gene knock out marmoset using genome editing techniques FokI ZFN 5 C G A T G C C T A A G C T G A N N N N N N T C C T G C G G A G G C T G G 3 3 G C T A C G G A T T C G A C T N N N N N N A G G A C G C C T C C G A C C 5 FokI FokI TALEN 5 C G A T G C C T A A G C T G A N N N N N N T C C T G C G G A G G C T G G 3 3 G C T A C G G A T T C G A C T N N N N N N A G G A C G C C T C C G A C C 5 FokI CRISPR/Cas9 Cas9 guiderna crrna+ tracrrna chimera N N N N N N N N N N N N N N N N N N N N G G N N N N N N N N N N N N N N N N N N N N C C
5 Production of Interleukin 2 receptor, common gamma chain gene (IL2Rg) knock out marmoset using ZFN and TALEN Interleukin 2 receptor, common gamma (IL2Rg) Common gamma chain for interleukin Responsible gene for X-linked severe combined immunodeficiency (X-SCID) Ken-ya Sato Application of the X-SCID marmoset Transplantation immunology Regenerative medicine Oncology Hematology The KO animal(s) would indicate phenotype from the neonate. (Sato et al., Cell Stem Cells 2016)
6 Screening of the most effective ZFNs or TALENs Exon pzfn B pzfn A transfection Marmoset Fibroblast Culture for 3days Genome extraction CEL-1 assay Assay for detection mutated gene (Sato et al., Cell Stem Cells 2016)
7 Investigations of genome editing efficiency in the marmoset embryos Microinjection Culture the embryos until late stage PCR & CEL-1 assay (analysis for gene modification) HiFi-ZFN injected embryos ehifi-zfn injected embryos Platinum-TALEN injected embryos M PC M M % (1/3) 40.0% (2/5) 100% (5/5) (Sato et al., Cell Stem Cells 2016)
8 Estimation of mosaicism of the genome edited marmoset embryos PCR & CEL-1 assay Microinjection Culture embryos until 8 cell stage Split the blastomeres HiFi-ZFN ehifi-zfn Platinum-TALEN M M M 37.5% (3/8) 100% (8/8) 100% (8/8) (Sato et al., Cell Stem Cells 2016)
9 Production of the Il2rg knock out marmosets Construction Injected Transferred Pregnancies Mutant animals Recipients Neonates Oocytes embryos (%) (%) (%) HiFi-ZFN (72.5) (21.7) M:11, F:1 M:1 (8.3) ehifi-zfn (72.4) 38 5 (13.2) M:2, F:3 M:1, F:3 (80) TALEN-ex4 9 5 (55.6) 5 1 (20.0) M:1 M:1 (100) TALEN-ex (71.2) 24 4 (16.7) M:3 M:3 (100) M: Male, F: Female HiFi-A ehifi-1 ehifi-a ehifi-b ehifi-d ZFN IL2RG -/Y T-1 T-2 T-3 -/Y +/- -/- T-4 -/- TALEN IL2RG -/Y -/Y -/Y -/Y (Sato et al., Cell Stem Cells 2016)
10 Phenotypes of immunocompromised marmosets ehifi-a Thymu s (-) Wild type Normal thymus Template genome Tissue Serum Protein-G Tissue + Wild type (Sato et al., Cell Stem Cells 2016)
11 Germline transmission of the KO gene Progesteron (ng/ml) Ovarian cycles (ehifi-b) 0 11 月 12 日 12 月 12 日 1 月 12 日 Urine sample collection( 年 ) Wild type CCTCCCAGAGGTTCAGTGTTTTGTGTTCAATGTCGAGTACATGAATTGCACTTGGAAC T-4 sperm CCTCCCAGAGGTTCAGTGTTTT GCACTTGGAAC (-25bp) T-5 sperm CCTCCCAGAGGTTCAGTGTTTTG TGTCGAGTACATGAATTGCACTTGGAAC (-7bp) Modified genes are transferred to next generation
12 insulin gene mosaic mutation in marmoset embryo When Cas9 mrna was used, all embryos showed mosaicism When Cas9 nuclease was used, the most of blastomeres showed bi-allelic modification. -difficult to obtain offspring from bi-allelic-modified embryo of c-kit gene? -embryonic lethality? (Kumita et al., unpublished)
13 insulin gene mosaic mutation in marmoset embryo
14 Target gene knock down marmoset model Lenti viral vector Tet R Tet R GFP GFP Tet R H1 teto shrna Ub-p TetR T2A egfp Tet R Tet R Tet R Dox GFP GFP H1 teto shrna Ub-p TetR T2A egfp shrna Insulin receptor (INSR) KD diabetic model FH1t(INSR)UTG (Herold MJ et al, PNAS 2008) Normal Diabetes Normal Water+ Dox Water
15 Analysis of INSR-KD marmosets Pronuclear injection Fertilized embryo injection Fibroblast No ID No - ID % 99.9% 100% 51.3% 0.3% 24.1% WT 0% INSR β-subunit 95kDa Verification of knockdown by western blotting. WT No ID Dox FACS analysis of GFP β-actin 42kDa (Takahashi et al., Unpublished)
16 Count Time course of INSR knockdown in newborn fibroblast Wild Type XI778tgF XI681tgF 99.7% 63.8% 0.53% fibroblast Dox administration GFP Dox INSR β-subunit Without Dox Dox β-actin Without Dox XI778tgM I681tg (Takahashi et al., Unpublished)
17 420nm Glucose metabolism in Insulin receptor (INSR) KD Expression of Glut4 in tissues WT KD Glut4 (+) Glut4 (-) β-actin (+) β-actin (-) Measurement of 2-deoxyglucose metabolic rate Measurement result of glucose metabolism in INSR-KD neonate s fibroblasts Insulin dependent glucose metabolism From Without DOX With Dox DOX Cy: Cytochalasin B (Glucose uptake inhibitor ) I: Insulin (Takahashi et al., Unpublished)
18 Summary Both of ZFN and TALEN are effective strategies to produce target gene knock out marmosets. Pre-evaluations of the genome editing tools are important to obtain target gene KO animals. Target gene knock down would be another option to avoid embryonic lethality
19 Future perspective of marmoset disease models Drug induce/surgical model Lentiviral vector Parkinson s Genome editing Schizophrenia Brain infarction Tuberous sclerosis Parkinson s Alzheimer Ret syndrome Glaucoma ALS Spinal cord injury Myocardial infarction Immunodeficiency Arteriosclerosis Diabetes Diabetes
20 Central Institute for Experimental Animal Ken-ya Sato Wakako Kumita Tsukasa Takahashi Yasuhiro Suzuki Eiko Yamazaki Tomoe Morioka Acknowledgements Chihiro Usui Hitomi Suzuki Takashi Inoue and team Yoko Kurotaki and team Juntendo University Kisaburo Hanazawa Hiroshima University TaKashi Yamamoto Tetsushi Sakuma